ID: 1143037109

View in Genome Browser
Species Human (GRCh38)
Location 17:4005610-4005632
Sequence CCCTCTGTGCAGGGTCTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 293}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143037109_1143037119 5 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037119 17:4005638-4005660 CAGAGGCCACGGGGCACACTGGG 0: 1
1: 0
2: 0
3: 21
4: 201
1143037109_1143037117 -4 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037117 17:4005629-4005651 AGGGATCTTCAGAGGCCACGGGG 0: 1
1: 0
2: 3
3: 11
4: 156
1143037109_1143037118 4 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037118 17:4005637-4005659 TCAGAGGCCACGGGGCACACTGG 0: 1
1: 0
2: 0
3: 21
4: 208
1143037109_1143037122 25 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037122 17:4005658-4005680 GGGCCATGGCAATGCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 136
1143037109_1143037115 -6 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037115 17:4005627-4005649 AGAGGGATCTTCAGAGGCCACGG 0: 1
1: 0
2: 3
3: 25
4: 334
1143037109_1143037116 -5 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037116 17:4005628-4005650 GAGGGATCTTCAGAGGCCACGGG 0: 1
1: 1
2: 1
3: 30
4: 233
1143037109_1143037121 11 Left 1143037109 17:4005610-4005632 CCCTGCAGACCCTGCACAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1143037121 17:4005644-4005666 CCACGGGGCACACTGGGCCATGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143037109 Original CRISPR CCCTCTGTGCAGGGTCTGCA GGG (reversed) Exonic
900092791 1:927690-927712 GCCCCTGTGCAGGGTCCCCAAGG - Intronic
900405642 1:2491830-2491852 CACCCTGTGGAGGGTCTGTAGGG - Intronic
900405683 1:2491995-2492017 CACCCTGTGGAGGGTCTGTAGGG - Intronic
900907787 1:5572915-5572937 CTCTCTCTGCAGTGTCTGCATGG + Intergenic
900939462 1:5788847-5788869 ACCTCAGTGCAGGATCTTCATGG - Intergenic
901954922 1:12777193-12777215 CTCTAAGTCCAGGGTCTGCAGGG - Exonic
901972642 1:12920034-12920056 CTCTAAGTCCAGGGTCTGCAGGG - Exonic
901988106 1:13091878-13091900 GGCCCTGTGCAGGGTCTGCTGGG + Intergenic
901988248 1:13092475-13092497 GGCCCTGTGCAGGGTCTGCTGGG + Intergenic
901993564 1:13134292-13134314 GGCCCTGTGCAGGGTCTGCTGGG - Intergenic
901993706 1:13134889-13134911 GGCCCTGTGCAGGGTCTGCTGGG - Intergenic
902012538 1:13281728-13281750 CTCTAAGTCCAGGGTCTGCAGGG + Exonic
902831290 1:19014591-19014613 CCCTCTGAGCAGGGACTCAAAGG + Intergenic
904340463 1:29830758-29830780 CCCTCTCCCCGGGGTCTGCAGGG + Intergenic
904588155 1:31591655-31591677 CCCTCTGTGCCAGGTGTGTATGG - Intergenic
904992925 1:34608237-34608259 CCCTCTGTGGCTGGTATGCATGG - Intergenic
905017268 1:34786271-34786293 CCCTGGGAGCAGGGTCTGAAAGG - Exonic
905283355 1:36863307-36863329 CCCTCTGGGCAGGGACTAGAGGG + Intronic
905932747 1:41801162-41801184 CCCTCTGTGCTGAGCCTGGAAGG + Intronic
906566627 1:46805628-46805650 CCCTCTTTCCAGGCTCTCCATGG + Intronic
908851641 1:68382564-68382586 CCCTCTGTTCAGGATCTCAAAGG - Intergenic
910223868 1:84916780-84916802 CCATCTCTGCAGGGTCTGGATGG + Intergenic
911293479 1:96085120-96085142 TCCTCTGTGCAGTGGCGGCATGG - Intergenic
912515901 1:110216417-110216439 CCCTGCGGGCAGGGCCTGCAGGG - Intronic
913507711 1:119533607-119533629 CCCTCTTCAGAGGGTCTGCATGG + Intergenic
915589562 1:156862799-156862821 CCCTCTGGGCAGGGGCTGGGGGG + Intronic
916290059 1:163155785-163155807 CGCTCTGTGCAGGCTCAGCAGGG - Intronic
918073605 1:181152426-181152448 CACTCTGTACAGGGACTCCATGG + Intergenic
920960008 1:210655619-210655641 CCCTCAGAGCAGGGTCTGTAAGG + Intronic
921158040 1:212453276-212453298 CCCTCTCTGTAGGGTCACCAAGG + Intergenic
922722259 1:227905045-227905067 CCTTCTGTCCAGGGGCTGCTGGG - Intergenic
923045726 1:230354341-230354363 GCCTCAGCTCAGGGTCTGCAGGG - Intronic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
924741935 1:246799243-246799265 TGGTCTGTGCAGGGGCTGCAGGG + Intergenic
1062780710 10:203787-203809 CCCTCTCTGCAGTTTCTGGAAGG + Intronic
1062856192 10:780643-780665 TCTACAGTGCAGGGTCTGCAGGG + Intergenic
1062971275 10:1651317-1651339 CCATCTGGGCAAGGTCTCCAAGG + Intronic
1063123903 10:3123838-3123860 CGCTCTGTGCAGGCTCTGCCTGG - Intronic
1063225571 10:4012274-4012296 ACCATTGTGCAGGGTCTGCTGGG - Intergenic
1063557926 10:7098029-7098051 CTCTCTGTTTGGGGTCTGCAAGG - Intergenic
1063964948 10:11339532-11339554 CCCCCTATGCAGGCTCTGCCTGG + Intergenic
1065782879 10:29186889-29186911 CCCTTTGTGCTGGGTCAGAATGG - Intergenic
1067414998 10:46096098-46096120 CTCTGTGTGCAGACTCTGCAAGG - Intergenic
1067435045 10:46270678-46270700 CTCTGTGTGCAGACTCTGCAAGG - Intergenic
1067438710 10:46296319-46296341 CTCTGTGTGCAGAATCTGCAAGG + Intronic
1068338290 10:55667198-55667220 CCCTCTTCAAAGGGTCTGCATGG + Intergenic
1069963361 10:72092469-72092491 CCCTCTCTTCATGGCCTGCAGGG + Intergenic
1070820435 10:79350987-79351009 GACTCTGTCCTGGGTCTGCAAGG + Intronic
1071251770 10:83826241-83826263 CCCTCTCTTCAAGTTCTGCATGG - Intergenic
1071334367 10:84589209-84589231 CCATCTGTGCAGGGCCTCCCAGG - Intergenic
1073245550 10:102087822-102087844 CTACCTGTGCAGGTTCTGCAGGG + Intergenic
1075563469 10:123485851-123485873 TCCTCAGTGAAGGGTCAGCATGG + Intergenic
1075744602 10:124718025-124718047 CCCTCTGTGCAGTGTCTTTGGGG - Intronic
1076196151 10:128519772-128519794 CCCTCTGTGTGGCGTCTGCCAGG - Intergenic
1076246944 10:128954616-128954638 TCCTCTGTGCAGCGTGTGAATGG + Intergenic
1076364571 10:129913787-129913809 GCCTGTGTGCAGGGTTGGCACGG - Intronic
1076451098 10:130557553-130557575 ACGTCTGTGCAGGGTCTCTAGGG - Intergenic
1076751404 10:132545309-132545331 CCCTCTGTCCAGGGGCTAGAGGG + Intronic
1077539590 11:3140274-3140296 CTCTCTGTGAAGGGCCAGCATGG + Intronic
1079156564 11:17953478-17953500 CTATCTGTGCTGGCTCTGCAGGG + Intronic
1080496994 11:32830031-32830053 CGCTCTCCGCAGGGTCTGGATGG - Exonic
1081436685 11:43034594-43034616 CCCTCTGTGCCAGGTCACCATGG - Intergenic
1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG + Intergenic
1082793515 11:57363861-57363883 CCCTCTGAGGAGGGTTGGCAGGG - Intronic
1082835363 11:57647152-57647174 CCGTCTCTGCGGGGGCTGCACGG - Exonic
1084708853 11:70831512-70831534 GCCTGTGGGCAGGGGCTGCAGGG - Intronic
1085534985 11:77212292-77212314 CACTCTTTCCAGGGTCTGCCTGG - Intronic
1090402417 11:126457753-126457775 CCCTATGTGCCGGGTCTCCGTGG - Intronic
1090942930 11:131404443-131404465 CTCTGTATGCTGGGTCTGCAAGG + Intronic
1091075215 11:132609156-132609178 CCTTCTGTGCATGGCATGCAAGG + Intronic
1092083088 12:5734456-5734478 GCCCCTGTGCAGGGTCTGGAAGG - Intronic
1093135083 12:15440011-15440033 CCCTGTGTGCAGAGGCTACAGGG + Intronic
1094305689 12:29016747-29016769 CTATCTGTCCAGGGTCTTCATGG - Intergenic
1094361018 12:29631060-29631082 TCTTCTGTGCAGGGTCTACTTGG + Intronic
1094502045 12:31030461-31030483 CACTCTTTCCAGGGTGTGCAGGG - Intergenic
1094502117 12:31030992-31031014 CACTCTTTCCAGGGTGTGCAGGG - Intergenic
1095981677 12:47977934-47977956 GTCTCTGTGCTGGGTCAGCAAGG - Intronic
1096111600 12:49032145-49032167 CAGTCTGGGCAGGGTCTGCCTGG - Exonic
1096869342 12:54583666-54583688 TATTCTGTGCAGGGTCTGGAAGG + Intronic
1097268702 12:57760943-57760965 TCCTCTGTGATGGCTCTGCAGGG + Intergenic
1098102696 12:67035311-67035333 CCCCCTCAGCAGGGTGTGCATGG + Intergenic
1100087186 12:90925924-90925946 CCCTGGGTCAAGGGTCTGCAAGG + Intronic
1100358049 12:93850198-93850220 CCCGTTGTGCAGGCTCTGGAAGG - Exonic
1102184043 12:110934011-110934033 CTCTCTGTGCTGTGTCTCCAGGG + Intergenic
1103842145 12:123873813-123873835 ACCTCTGTGCAATGTCTGCAGGG + Intronic
1103975755 12:124701493-124701515 TCCTCCTGGCAGGGTCTGCATGG + Intergenic
1104422160 12:128645175-128645197 CCGTCTGTGGAGGGTCTGGGTGG + Intronic
1104591243 12:130085915-130085937 GCCTCTGTGGAGGGTCTGGGTGG + Intergenic
1104594554 12:130112317-130112339 CCGTCTCTCCAGGGTCAGCAAGG - Intergenic
1104687131 12:130793752-130793774 CCCTCCCTGCAGGGTGTGCCAGG - Intronic
1105854984 13:24364827-24364849 CCATCTGTGCAGGGTCCCAAGGG + Intergenic
1106258834 13:28046263-28046285 ATCTCAGTGCAGGGTTTGCATGG - Intronic
1107610907 13:42111994-42112016 CTCTCTGTGCAGGGCATGCCAGG - Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1108688171 13:52838883-52838905 CCCTCTGTGAAGCCTCAGCACGG - Intergenic
1111063240 13:83052175-83052197 CCTTCTTTGCAAGGTCTGAATGG + Intergenic
1113999938 14:18225132-18225154 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1114455866 14:22853190-22853212 CCCGCGGGGCAGGGTTTGCAGGG + Intergenic
1117673629 14:58133080-58133102 CCCACTGTGGAAGGTCTGTAAGG - Exonic
1118816295 14:69316623-69316645 TCCTCTGTGTAGGGCCTGCAGGG - Intronic
1119774910 14:77242335-77242357 CCCTCTCTGCAGTGTCCGTAAGG + Exonic
1119965915 14:78915661-78915683 CCCTCTGTGCAGCTTCTTGATGG + Intronic
1122122877 14:99563855-99563877 CCCTCTGAGCACGGCCTCCAGGG + Intronic
1122817551 14:104321014-104321036 CCGTCTGAGCAGGGTCAGGAGGG + Intergenic
1125499811 15:40232552-40232574 TCATCTGGTCAGGGTCTGCAGGG + Intergenic
1126075558 15:44905500-44905522 CCTTGTGTGCAGGCTCTGAAAGG - Intergenic
1126082760 15:44981958-44981980 CCTTGTGTGCAGGCTCTGAAAGG + Intergenic
1128340448 15:66819024-66819046 CCTTCTCTGCAGAGTCTGCGTGG + Intergenic
1129297756 15:74609199-74609221 GCCTCTGAGGAGGGGCTGCATGG - Intronic
1129384584 15:75188889-75188911 AGGTCTGTGCAGGGGCTGCAGGG + Intergenic
1130321457 15:82846024-82846046 CCCTCTGTGCACAGTCTTCCTGG + Intronic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1131229542 15:90649663-90649685 CCCTCTGGGAAGGGTCCCCACGG + Intergenic
1131317710 15:91354938-91354960 TCCTCTGTTCAGTGGCTGCATGG + Intergenic
1131342951 15:91619834-91619856 CCCTCTGGCCAGGGTCTTCTTGG + Intergenic
1131623411 15:94091661-94091683 CCTCCTATGCAGGGTCTCCATGG - Intergenic
1132514949 16:361908-361930 TCCTCTCAGCAGGGGCTGCAAGG - Intergenic
1132598860 16:765098-765120 GCCTCTCTGCAGGGTGTGCGGGG + Exonic
1132669099 16:1095424-1095446 CCCCCAGGGCAGGGCCTGCAGGG + Intronic
1132753798 16:1472046-1472068 CCCTGTGCGGATGGTCTGCAGGG - Intronic
1133315506 16:4881237-4881259 GCCTCTGTGAAGTGTCTGCCGGG + Exonic
1136143606 16:28302450-28302472 CACTCTGGGCAGGGTGTGAAGGG + Intronic
1136186145 16:28590135-28590157 CCCTCTGCGCATGGTCTTCCGGG - Exonic
1136318052 16:29465680-29465702 CCCTCTGCGCATGGTCTTCCGGG + Exonic
1136432627 16:30205029-30205051 CCCTCTGCGCATGGTCTTCCGGG + Exonic
1136683054 16:31978989-31979011 GCCTCTGTGCAGGGGCTTGAAGG + Intergenic
1136783693 16:32922545-32922567 GCCTCTGTGCAGGGGCTTGAAGG + Intergenic
1136886095 16:33931261-33931283 GCCTCTGTGCAGGGGCTTGAAGG - Intergenic
1137751539 16:50864542-50864564 CCCTCTGTGCCAGGCCTGCTGGG + Intergenic
1138022204 16:53494875-53494897 TTCTCTGCTCAGGGTCTGCAAGG - Intronic
1138972551 16:62163360-62163382 CCCAAAGTGCTGGGTCTGCATGG - Intergenic
1139476306 16:67204208-67204230 CCCTCCATGCTGGGCCTGCAGGG + Intergenic
1139680481 16:68558051-68558073 TCCTCTGAGCAGGGTCGACATGG - Exonic
1140766824 16:78167733-78167755 TCCTCTCTGCAGGGTATGAATGG - Intronic
1140995348 16:80253636-80253658 GCCTCTGTGGAGGCTCTGGAAGG - Intergenic
1141643961 16:85357539-85357561 GCCTCTGGGCAGGGTCTCCGTGG - Exonic
1142177190 16:88650726-88650748 CGCGCTCCGCAGGGTCTGCAAGG + Intronic
1142255752 16:89013056-89013078 CTCTCTGTTTAGGGGCTGCAAGG + Intergenic
1203086344 16_KI270728v1_random:1186546-1186568 GCCTCTGTGCAGGGGCTTGAAGG + Intergenic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1143361455 17:6374942-6374964 TCCCCTGTGCTGGGACTGCATGG - Intergenic
1144334249 17:14255043-14255065 CCCACTGTGAAGGGTCTGCTTGG - Intergenic
1144654304 17:17025478-17025500 GCCTCTCTGCAGGGTCTCCAGGG - Intergenic
1144853136 17:18254140-18254162 CCGCAGGTGCAGGGTCTGCAGGG + Exonic
1144998729 17:19288827-19288849 CACTGAGTGCATGGTCTGCAAGG - Intronic
1145124263 17:20287086-20287108 GCCTCTGTACGTGGTCTGCAAGG + Intronic
1145209900 17:21005083-21005105 ACCTCGGTGCAGCATCTGCATGG - Intronic
1146785637 17:35718531-35718553 CCCTCTGTGCTGTTTCTGGAGGG + Intronic
1146923487 17:36729013-36729035 CCCTCTGTGCAATGTCAGAATGG - Intergenic
1147143963 17:38474698-38474720 GCCTCTGTGCAGGGGCTTGAAGG + Intronic
1147443646 17:40462144-40462166 CCCTCTTCGCAGGGGCTGCGGGG + Intergenic
1148008487 17:44454680-44454702 CCCACAGTGCTGGGACTGCAGGG + Intronic
1148793592 17:50186912-50186934 CTCTCTGTGCAGGGTCCCCCCGG - Exonic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1150298564 17:64029103-64029125 CCAGCTGTGCAGGCTCTCCAAGG + Intergenic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1150726826 17:67658086-67658108 CCCACTGTGCAGGACCTGAAGGG + Intronic
1151885548 17:76921403-76921425 CACACTGAGCAGGGTGTGCATGG + Intronic
1152453201 17:80396784-80396806 CCCTCTCTGCAGGATATGCTGGG + Exonic
1152616075 17:81338497-81338519 CCCACTGTGCAGAGGCTGCTTGG - Intergenic
1153983504 18:10332708-10332730 GACTCTGTCCAGGGTTTGCAAGG - Intergenic
1155166314 18:23235207-23235229 CCCTTTGTGCAGGGTCCAGACGG + Intronic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1161283843 19:3459001-3459023 CCCTCTCTCCGGGGTCTGCAGGG - Intronic
1161431142 19:4233117-4233139 CACCCTGTGCAGGCTCGGCATGG + Exonic
1161561105 19:4972876-4972898 CCCTCATTGCAGGGCGTGCAGGG - Intronic
1164347950 19:27291032-27291054 CTCTCTTTGCAGTATCTGCAAGG + Intergenic
1165380238 19:35474318-35474340 CCCTGTGTGCAGGCCCTGAAGGG - Intergenic
1165429561 19:35764846-35764868 CCATGTGTGGAGGTTCTGCAGGG - Exonic
1166400019 19:42471691-42471713 CCCGCTGTCCAGGGTTTGCAAGG + Intergenic
1167603950 19:50470221-50470243 CCAACTGTGCAGGCTGTGCACGG + Intronic
1167958602 19:53087942-53087964 ACCTCAGAGGAGGGTCTGCAGGG + Intronic
925020936 2:567248-567270 ACCTCTGGCCAGGGTTTGCAGGG + Intergenic
926238718 2:11069032-11069054 CCTACTGTGCCTGGTCTGCAGGG - Intergenic
927225275 2:20758843-20758865 CCCTAAGTGCAGGGACTGTAAGG + Intronic
927496543 2:23555179-23555201 CCCTCTGTGCTAGGTCAGCCAGG - Intronic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
927937410 2:27083487-27083509 CTCTCCTTGCAGGGCCTGCAGGG - Exonic
928373153 2:30755698-30755720 CCCTCTGTGCTAGGACAGCAAGG + Intronic
928743717 2:34386968-34386990 CCCTCAGTGCATGGGATGCATGG - Intergenic
929165069 2:38874012-38874034 TCCTCTATGCAGGTTCTACAGGG - Intronic
929488659 2:42376945-42376967 CTCTCTGTTCAGGGTCAGCTGGG - Intronic
929674062 2:43906830-43906852 TCCTGTGTCCAGGGACTGCAGGG - Intronic
930274565 2:49296628-49296650 CACTCAGTCCAGAGTCTGCATGG + Intergenic
931811815 2:65861680-65861702 CCCTCTGGGCAGGTTTTGCATGG + Intergenic
932465906 2:71923980-71924002 TGCTGTGTGCAGGGTCTGGAAGG + Intergenic
933014792 2:77111622-77111644 TCCTGTGTCCAGGGTCTCCATGG + Intronic
933699312 2:85243444-85243466 CCCTCTGTGCAGGGTTCGAGGGG + Intronic
935274360 2:101463464-101463486 CCCTCTGTGCAGGCTGAGAATGG + Intronic
935891951 2:107688483-107688505 GCCTCTGTGCATGTTCTCCAAGG + Intergenic
937303054 2:120854988-120855010 CTCTGTGTGGAGGGTGTGCAGGG - Intronic
937981921 2:127620672-127620694 GCCCCTACGCAGGGTCTGCAGGG + Intronic
938801949 2:134771758-134771780 CACACAGTGCAGGGTCTTCAAGG + Intergenic
940339089 2:152560951-152560973 CCCTCTGTGCAGGTCCTCGATGG - Exonic
941403309 2:165058538-165058560 ACCTCTGCACAGGGTCTACAAGG - Intergenic
947602949 2:231465461-231465483 CCCTCCGTCCAGGGCCTGCCGGG + Intronic
948565211 2:238881924-238881946 CACTCTGTGAAGGGACTGCCTGG + Intronic
948998586 2:241597812-241597834 CCCAGGGTGCAGGGGCTGCATGG + Intronic
949048161 2:241881752-241881774 CCCTGTGTGCGGGGGCTGGACGG + Intergenic
949052669 2:241905501-241905523 TCCACGGTGCAGGGCCTGCATGG - Intergenic
1171286767 20:23946096-23946118 CCCTATGTCCAGGGTGTCCAGGG + Intergenic
1173217616 20:41100728-41100750 CACTCTGTGCAGCTTCTGTATGG + Intronic
1173249509 20:41357242-41357264 CCCTCTGTGCTGGGTGTGGTGGG + Intronic
1173771933 20:45667159-45667181 CTCACTGTGCAGGGGCTCCATGG - Exonic
1174065607 20:47862754-47862776 CCCTCTGATCAAGGTCTCCAAGG + Intergenic
1174078038 20:47951779-47951801 CACGCTGTCCAGGGTCGGCAAGG + Intergenic
1174361652 20:50032632-50032654 CCCTATATGCATGGTGTGCATGG - Intergenic
1174463073 20:50696761-50696783 GTGTCTGTGCAGGGTCTGCTGGG + Intergenic
1175373813 20:58511006-58511028 CCCTCTGTGCTGTCCCTGCAGGG - Intronic
1175491054 20:59381500-59381522 GCCTCAGAGCAGTGTCTGCAGGG + Intergenic
1175520572 20:59600074-59600096 GCCTCTTTGCAGGGACTTCAGGG + Intronic
1175803404 20:61813861-61813883 CCCTCTGTGCAGGGTTTGTGCGG - Intronic
1176660779 21:9633616-9633638 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1179471730 21:41614814-41614836 CACTCAGTGCAGGGTGGGCAAGG + Intergenic
1179511245 21:41875206-41875228 CCCCCTGTGGAGGCTCTGGAGGG - Intronic
1180424402 22:15154905-15154927 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1184037732 22:41926503-41926525 CCCTGTGGGCAGGGCCTGGAGGG - Intronic
1184675070 22:46037115-46037137 CCCTCTGCCCAGGATCTGAATGG + Intergenic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
1185042879 22:48514576-48514598 CTCCCTGGGCAGGGTCTGCAGGG - Intronic
1185083086 22:48720563-48720585 CCCTCTGTCCTGGCTATGCACGG - Intronic
1185087695 22:48749602-48749624 CCCTCTGTGCACGACCTGGAGGG - Intronic
1185269327 22:49921691-49921713 CCCGCTGTGCACTGACTGCATGG + Exonic
950309893 3:11948154-11948176 TTCTCTTTGCAGGGTCTCCAAGG - Intergenic
953019476 3:39104521-39104543 CCCTCTGGGCTGGGTCTGGCTGG - Intronic
953349162 3:42201841-42201863 CCGTCCGTCCAGGTTCTGCAGGG - Intronic
953732727 3:45464177-45464199 CCATGTGTGCATGCTCTGCAGGG - Intronic
954134043 3:48573880-48573902 CTCTCTATGTAGGGTCTGCAGGG - Exonic
954800603 3:53184986-53185008 CCCTGTGTCCAGGGTCCCCATGG - Intronic
959720243 3:109478849-109478871 CCATGTGTGCAGAGACTGCATGG - Intergenic
959805197 3:110542925-110542947 CCCTCTGAGCACAGTCAGCATGG - Intergenic
960268768 3:115651324-115651346 CCGTATGTGCAGAGTGTGCATGG - Intronic
961077307 3:123993802-123993824 GCCTCTGTGGAGGGGCTGCCAGG + Intergenic
961370629 3:126427488-126427510 CCCTCAGTGCCGTGTCTGTATGG + Intronic
961817810 3:129560287-129560309 CCCTCTGTGCAGTGGGTACAAGG - Intronic
962531307 3:136283391-136283413 CCTTCTGTGGAGGGTGTGGAGGG + Intronic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
963311521 3:143715212-143715234 CCCTCTCTTTAGGGTCTGTATGG + Intronic
965572135 3:170183285-170183307 GCCTCTGTGCCTGGTCTACAGGG - Intergenic
965769930 3:172171049-172171071 CCTTCTGTGCAGGGTCTATGTGG + Intronic
969114831 4:4865030-4865052 CGCCCTGGGCAGGTTCTGCACGG + Intergenic
969465416 4:7353455-7353477 TCCTGTGTGAAGGGTCTGCAGGG + Intronic
969681331 4:8645014-8645036 CCCTTGGTGCAGGGTCAGCATGG - Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
978449389 4:108814441-108814463 CCCTCTGTGAATGTTGTGCAAGG + Intronic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
982066227 4:151657102-151657124 TCCTCTGTGGAGGGTCTAGAGGG + Intronic
982452619 4:155570940-155570962 CCCTTTTTGCATGTTCTGCATGG + Intergenic
984821357 4:183885517-183885539 CCATCTGTGGAGGCTGTGCAGGG + Intronic
985372703 4:189303130-189303152 CCCTATGAGCAGGTTCTGAATGG - Intergenic
985819949 5:2152996-2153018 CACTCTATGCAGTGTCTGTAGGG - Intergenic
986287474 5:6370570-6370592 CCCTCTGTGCTGGTTCTGGGTGG - Intergenic
986576950 5:9222203-9222225 CCCTGTGTTCAGGCTCAGCAGGG + Intronic
992778189 5:80106069-80106091 TCCTCTGAGAAGGATCTGCAGGG + Intergenic
994264117 5:97694290-97694312 ACCTCTTTGCAGAGTCTGAAGGG - Intergenic
995474830 5:112537353-112537375 GCTTCTGTGCAGTGTCTTCATGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996732390 5:126728497-126728519 ACCAGTGTTCAGGGTCTGCAGGG - Intergenic
997303854 5:132824742-132824764 CCCTCTGTTCACTGTCAGCAGGG + Exonic
997867512 5:137477832-137477854 CCCTCTTTCCAGAGTCAGCAGGG - Intronic
1000535313 5:162471435-162471457 CCCTCTGTGTAGGGGCTTAATGG + Intergenic
1001130961 5:169063164-169063186 TCCTCTGTGCAGGGCTGGCACGG - Intronic
1002103479 5:176868728-176868750 CACTCTGGGCAGGGCCAGCATGG + Intronic
1005859090 6:29887829-29887851 GCGTGAGTGCAGGGTCTGCAGGG + Intergenic
1005944627 6:30586284-30586306 CCTCCAGTGCTGGGTCTGCATGG + Exonic
1006809222 6:36809181-36809203 CTCTCTGCGTAGGGGCTGCAAGG - Intronic
1006894242 6:37456638-37456660 CCCTCTCTACAGGTTCGGCATGG - Intronic
1007391327 6:41551168-41551190 CCCTGCGTCCAGGCTCTGCAAGG - Intronic
1007748377 6:44057053-44057075 CCGCCTGTGAAGGCTCTGCAGGG - Intergenic
1011338366 6:86285063-86285085 CTCTGAGTGCAGGGTCTGCCAGG + Intergenic
1011694477 6:89899615-89899637 CCCTCTGTACAGTGACTCCATGG - Intergenic
1019180775 6:170186333-170186355 ACCTCACTGCAGGGACTGCAGGG + Intergenic
1019309540 7:353405-353427 ACCCATTTGCAGGGTCTGCAGGG + Intergenic
1019462960 7:1170980-1171002 ACCTCTGTGCAGGGTGAGGAAGG + Intergenic
1019513263 7:1429003-1429025 CCCTCCTGGCGGGGTCTGCAGGG + Intronic
1019938145 7:4269664-4269686 CCCTAAGTGCTGGGACTGCAGGG + Intergenic
1020111822 7:5451887-5451909 CCCTCCTCCCAGGGTCTGCAGGG + Intronic
1021451230 7:20785242-20785264 ACCTCTGTGGACGGGCTGCAGGG - Exonic
1021891303 7:25188548-25188570 ACCCCAGTGCAGTGTCTGCATGG + Intergenic
1021971680 7:25971156-25971178 CTCCCAGTGCAGGGTCTCCAGGG - Intergenic
1024550979 7:50562194-50562216 CCATGAGTGCAGGGGCTGCAGGG + Intronic
1035093051 7:156330513-156330535 CCTCCAGGGCAGGGTCTGCAGGG + Intergenic
1035658908 8:1332056-1332078 CCCTCTGTGAGGGGTTTCCATGG + Intergenic
1039122190 8:34159482-34159504 CCATGTCTGCAGGTTCTGCATGG - Intergenic
1039362554 8:36894674-36894696 GCCTCTGTGAATAGTCTGCATGG + Intronic
1039648473 8:39314100-39314122 CCGTCTGAGCAGGGACTGTATGG + Intergenic
1042187721 8:66153840-66153862 CCCTCTGTCCAGCATCTGGATGG - Intronic
1047411322 8:124626959-124626981 CCCTGTGTGCAGGCTGGGCAGGG - Intronic
1048073328 8:131042312-131042334 CCCGGGGTGCAGGGTCTGCAGGG + Exonic
1049213616 8:141397878-141397900 CTCTCTGTCCAGGGTCGGCCCGG + Intronic
1049228563 8:141470130-141470152 CCTTCAGGGCAGGTTCTGCAGGG + Intergenic
1049392609 8:142379927-142379949 CCCTCTCCCCAGGGTCTGAAGGG + Intronic
1049759543 8:144325881-144325903 CACTCTCAGAAGGGTCTGCAAGG + Intronic
1050780790 9:9332029-9332051 CCCTCTCTGCGGAGTCTGCATGG + Intronic
1052070076 9:24070880-24070902 CCCTCTTTGTAGGGTCTACTTGG + Intergenic
1053289532 9:36870931-36870953 CCCTCAGGGCAGGGGCTGCCTGG + Intronic
1053713977 9:40862731-40862753 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1054424364 9:64993079-64993101 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1056619085 9:88195480-88195502 GCATCTGTGCAGAATCTGCACGG - Intergenic
1056665781 9:88579581-88579603 CCCTCTGTGGAGTGTCACCAGGG + Intronic
1058662906 9:107282992-107283014 GCCTCTGTGCAGGCTCCGCCCGG - Intergenic
1060888744 9:127174969-127174991 CCCTCTGTGCCGGGGCTCCCTGG + Intronic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1061989765 9:134152565-134152587 TCCTTTCTGCAGGCTCTGCAAGG - Intronic
1062118816 9:134822986-134823008 CTCTCTCTGCAGGGTCCGCCTGG + Exonic
1062168284 9:135119877-135119899 CCAGGTCTGCAGGGTCTGCAGGG - Exonic
1203638347 Un_KI270750v1:135460-135482 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1186506610 X:10098362-10098384 CAATCTGTGCAAGGTCTGGAAGG - Intronic
1187869205 X:23750409-23750431 TCCTCTGTTCAGGGTCTCCAAGG - Intronic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1189475110 X:41346326-41346348 CCCTCTGAGAACGGTCTCCATGG - Exonic
1189820238 X:44863757-44863779 ACCTCTGTGAATAGTCTGCAGGG - Intergenic
1191251161 X:58260848-58260870 GCCCCTGTGCTGGGCCTGCAGGG + Intergenic
1191253490 X:58270135-58270157 GCCTCTGTGCGGGGCCTGCAGGG - Intergenic
1191713654 X:64178804-64178826 CCATATGTGCAGGGCCTGCATGG + Intergenic
1197404153 X:126029412-126029434 TCCTCTGTGCTGGGGTTGCAGGG + Intergenic
1198686709 X:139235391-139235413 TCCTCTGTGCAGGGTGTGTGTGG - Intergenic
1199676185 X:150191118-150191140 CTCTCTGTGCAGAGGCTGCTTGG - Intergenic
1201988844 Y:20002142-20002164 CCCAAAGTGCAGGGACTGCAGGG + Intergenic