ID: 1143038789

View in Genome Browser
Species Human (GRCh38)
Location 17:4017048-4017070
Sequence TGCGTGTGTGTGTGTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14161
Summary {0: 2, 1: 20, 2: 380, 3: 2680, 4: 11079}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143038786_1143038789 -1 Left 1143038786 17:4017026-4017048 CCAAATGAACTTCCTCATGGACT 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1143038789 17:4017048-4017070 TGCGTGTGTGTGTGTGAAGGTGG 0: 2
1: 20
2: 380
3: 2680
4: 11079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143038789 Original CRISPR TGCGTGTGTGTGTGTGAAGG TGG Intronic