ID: 1143040827

View in Genome Browser
Species Human (GRCh38)
Location 17:4035271-4035293
Sequence TGCCCTCTTGAGTCACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143040827_1143040829 27 Left 1143040827 17:4035271-4035293 CCTCAGTGTGACTCAAGAGGGCA 0: 1
1: 0
2: 0
3: 20
4: 125
Right 1143040829 17:4035321-4035343 ATCAAAGAACAAAAAGTTCTTGG 0: 1
1: 1
2: 3
3: 42
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143040827 Original CRISPR TGCCCTCTTGAGTCACACTG AGG (reversed) Intronic
901012197 1:6208211-6208233 GGCCATCTGGAGTCACACTTGGG - Intronic
901120602 1:6890063-6890085 TGCCCTCTGGTGGCACACAGAGG + Intronic
901508612 1:9702419-9702441 TGCCATCTAGAGGCACACAGAGG - Intronic
902655616 1:17866006-17866028 TGCCCCCTTGAGGACCACTGAGG + Intergenic
903198829 1:21716022-21716044 TTCCATCTTAACTCACACTGTGG + Intronic
903916198 1:26766233-26766255 TGCCCCCTTGATTCATATTGGGG - Exonic
913357457 1:117938674-117938696 TGCCATCTTGAGGGACAGTGAGG + Intronic
915352676 1:155236117-155236139 TGCCCTTTTGAGCAACTCTGGGG - Intronic
915455408 1:156037227-156037249 TGCCCTCCTGATTGACTCTGAGG - Intronic
922135143 1:222817752-222817774 TCCCCTTTTGAGTCACTCTGAGG - Intergenic
922504719 1:226119795-226119817 TGCCCTCTTCATTCCCATTGAGG - Intergenic
1063652650 10:7953816-7953838 TGCACTCTTGAGTCTCACTATGG - Intronic
1064206391 10:13327738-13327760 TGCTCTCCTGTTTCACACTGGGG - Intronic
1064337346 10:14455904-14455926 TGCCGTACTGAGCCACACTGAGG - Intronic
1068756861 10:60665169-60665191 TACCTTCTTGAGGAACACTGGGG + Intronic
1069174205 10:65270442-65270464 TCCCATCTTTAGTCAAACTGAGG - Intergenic
1070982438 10:80660319-80660341 TACCCTCTTGAGTTCCCCTGGGG + Intergenic
1072637843 10:97188691-97188713 TCTCTTCTTGAGTCACACGGGGG - Intronic
1078759177 11:14237954-14237976 TGGCCTCTAGAATCAGACTGAGG + Intronic
1080802899 11:35624848-35624870 TGTCCTCTTGAGTCATCCTTGGG - Intergenic
1083954968 11:65978076-65978098 TGCCCACTAGAGACAAACTGAGG - Intronic
1084033263 11:66493337-66493359 TTTCCTCTTGGGTCACACTAGGG + Intronic
1084468255 11:69339909-69339931 TGCCCTGTGGAGTCACACACTGG - Intronic
1089485856 11:118845592-118845614 TTTCCTCATGAGTCACCCTGGGG - Intergenic
1091054932 11:132408949-132408971 TCTCCTCTTGAGGCACACAGAGG - Intergenic
1091276711 11:134357689-134357711 TGCCCACCTGAGTCACACATGGG - Intronic
1091415348 12:278099-278121 TGCCTACTTGAGTCAATCTGTGG + Intergenic
1091697492 12:2637825-2637847 CGCCCTCATGGATCACACTGAGG - Intronic
1091938296 12:4450963-4450985 GGCCTTTTTGTGTCACACTGGGG - Intergenic
1093364923 12:18282286-18282308 TGCCCTGTTGAGTCCCATTTTGG - Exonic
1103937507 12:124484385-124484407 TGCCCTCTCTAGGCACACTGCGG - Intronic
1107249823 13:38346179-38346201 TGCCCTCTTGTACCACCCTGTGG - Intergenic
1107437360 13:40391863-40391885 TTCCATCTTCATTCACACTGGGG + Intergenic
1108666776 13:52640662-52640684 TGCCCTCCAGAGACACACTGGGG + Intergenic
1113413186 13:110108028-110108050 TGGCCTTTGGAGTCACTCTGTGG + Intergenic
1117966727 14:61214091-61214113 AGCCCACGTGAGTCACACTGTGG + Intronic
1121956101 14:98214869-98214891 AGCCATCTTGAGCCACACTGGGG + Intergenic
1121985460 14:98501235-98501257 TGTACTCTTAAGTCACACAGAGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122999258 14:105283437-105283459 ACCCCTCTTGAGTCTTACTGGGG - Intronic
1123572856 15:21632553-21632575 TGCACTAATGAGGCACACTGAGG + Intergenic
1123609476 15:22075140-22075162 TGCACTAATGAGGCACACTGAGG + Intergenic
1123707131 15:22958805-22958827 TGCCCTCCTGGGGCACTCTGGGG - Intronic
1124092636 15:26620753-26620775 TGCCTTCCTGAGTCCCAGTGAGG - Intronic
1125880661 15:43191421-43191443 TGGCCTCTTGAATGATACTGAGG + Exonic
1128780270 15:70354503-70354525 TGCCCTCCGGAGACACACCGGGG - Intergenic
1129910038 15:79219533-79219555 GGCCAGCTGGAGTCACACTGGGG - Intergenic
1130174883 15:81558212-81558234 TGACCTCTCTAGTGACACTGAGG + Intergenic
1131823121 15:96293069-96293091 TTCCCACTGGAGCCACACTGAGG + Intergenic
1202981719 15_KI270727v1_random:366925-366947 TGCACTAATGAGGCACACTGAGG + Intergenic
1132704563 16:1237512-1237534 GGCCCTCCCGAGTCACCCTGAGG + Intergenic
1132706950 16:1248913-1248935 GGCCCTCCCGAGTCACCCTGAGG - Intergenic
1132957196 16:2600650-2600672 AGCCCTCTTGGGACACACTGTGG + Exonic
1132969539 16:2679062-2679084 AGCCCTCTTGGGACACACTGTGG + Intergenic
1136013816 16:27382451-27382473 AGCCCTCTGACGTCACACTGTGG - Intergenic
1136077198 16:27825269-27825291 TGCCGTCTTGTTTCCCACTGTGG - Intronic
1137638077 16:50004753-50004775 TGCCCTCTTGGGTTGCACTATGG - Intergenic
1137638280 16:50006545-50006567 TGCCCTCTTGGGTTGCACTATGG + Intergenic
1141021314 16:80499191-80499213 TTTCCTCATGTGTCACACTGAGG + Intergenic
1141422212 16:83924732-83924754 TGGCATCGTGAGCCACACTGGGG - Exonic
1142092201 16:88220496-88220518 TCCCGTCATGGGTCACACTGTGG - Intergenic
1142100050 16:88266164-88266186 TGCCCTCCTGAGCCTCACAGTGG - Intergenic
1143040827 17:4035271-4035293 TGCCCTCTTGAGTCACACTGAGG - Intronic
1144495723 17:15743535-15743557 TACCCTCTGGAGTCACCCTCTGG + Intronic
1145761571 17:27428775-27428797 TCCCCTCCTGAGTCACCCTCTGG + Intergenic
1146527648 17:33580547-33580569 TGCACTCATGAGTGACGCTGAGG + Intronic
1159398539 18:67898350-67898372 TGTCTTCTTGAGTCAAACTAGGG - Intergenic
1162528989 19:11224718-11224740 TACTCTCTTGAGCCACTCTGAGG + Intronic
1162910235 19:13844128-13844150 TCCCCTTTTGAGTAACTCTGGGG + Intergenic
1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG + Intronic
1165153531 19:33774350-33774372 TGCCCTCCTGGGTCATTCTGTGG + Intergenic
1166385647 19:42379059-42379081 TTCCCTCCTGAGCCAAACTGGGG - Intergenic
1167612826 19:50515442-50515464 TGCCCTTCTGAGTGGCACTGTGG + Intergenic
924986993 2:281055-281077 TGCCCTCTGGTGTCTCACTGAGG + Intronic
926784871 2:16508992-16509014 TTCCCTCTTGATTCTCACTGTGG - Intergenic
926849104 2:17175155-17175177 TGCCCACTTCAGTCACTTTGGGG - Intergenic
927509738 2:23636951-23636973 TCCCCTCCTGAATCACACTCCGG - Intronic
928233313 2:29518801-29518823 TGTCCTCTAGAGTCATACAGAGG - Intronic
928595506 2:32855747-32855769 AGCCCTCTTGACTCACACAAAGG - Intergenic
932051656 2:68404271-68404293 TGCCCTCTGGACTTACACAGTGG - Intergenic
936503394 2:113084445-113084467 TGCCCTCTAGAGTTACACAGTGG - Intergenic
936776911 2:115985094-115985116 TGCCCTCCTGACTCCCACAGGGG - Intergenic
942211252 2:173673220-173673242 TGCTCCCTTGAATCACAATGTGG - Intergenic
948128443 2:235582479-235582501 AGCCCTCTTGAGTCAGATCGTGG + Intronic
1170950254 20:20930389-20930411 TCCCCTCTTGGGTCAGGCTGAGG + Intergenic
1171228847 20:23465840-23465862 TGCCCTTTGGAGAGACACTGTGG + Intergenic
1175389075 20:58615041-58615063 TCCCCTGTAGAGTCACAGTGGGG + Intergenic
1175534635 20:59700269-59700291 TGCCCTGTTGGTTGACACTGGGG + Intronic
1179458699 21:41518427-41518449 TGGCCTTTTGGGTCAAACTGTGG - Intronic
1179594632 21:42434112-42434134 CTCCCTCTTGAGTCAGACTCTGG + Intronic
1180787751 22:18556510-18556532 TGCCCTCTGGAGATGCACTGAGG - Intergenic
1181233986 22:21438796-21438818 TGCCCTCTGGAGATGCACTGAGG + Intronic
1181244662 22:21496035-21496057 TGCCCTCTGGAGATGCACTGAGG - Intergenic
1182926386 22:34129289-34129311 TGCCCTCTGGTTTCAGACTGGGG + Intergenic
949153249 3:796114-796136 TGCACTCTTGTGTCACACACAGG - Intergenic
949382059 3:3457472-3457494 TGGGCTCCTGAGTCACTCTGTGG + Intergenic
950000016 3:9649544-9649566 GGCCCGCTTGAGGCACACTGAGG + Exonic
950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG + Intergenic
951406881 3:22312213-22312235 TTCCCTCTTCAGAAACACTGAGG + Intronic
953228400 3:41042138-41042160 TAACCTCTTGAGTGGCACTGTGG - Intergenic
953999048 3:47541932-47541954 TGCCTCCCTGAGTCACACTGTGG - Intergenic
963316959 3:143769797-143769819 TCCATCCTTGAGTCACACTGAGG - Intronic
968657576 4:1785338-1785360 TGCCCCTTTGATCCACACTGAGG + Intergenic
970955030 4:21800944-21800966 TGCCTTCTTTAGTCAAACTGGGG + Intronic
971062535 4:22988805-22988827 TGCCCAGTTGAGTCACTGTGGGG - Intergenic
985231281 4:187820886-187820908 GGCCCACTTGAGCCACGCTGGGG - Intergenic
988398678 5:30732156-30732178 TTCAGTCCTGAGTCACACTGGGG + Intergenic
989336124 5:40319195-40319217 TGCCCTCTTGCTTCACTCTGGGG + Intergenic
990204838 5:53417364-53417386 AGGCCTGTTTAGTCACACTGGGG + Intergenic
992117199 5:73550955-73550977 GTCAATCTTGAGTCACACTGGGG + Intergenic
994928137 5:106146011-106146033 TGCCATGTTGAGGCACACTGGGG + Intergenic
996357728 5:122615342-122615364 AGCCCTCTGGAGTCACTCAGTGG - Intergenic
997150548 5:131489878-131489900 TGCCCTCTGGGATCATACTGAGG + Intronic
999770685 5:154773453-154773475 TGCCCTCTGCAGGCACGCTGGGG + Intronic
1000232053 5:159325145-159325167 TGCCCTCCTAAGTCACACCTCGG + Intronic
1006046070 6:31299704-31299726 GCCCTTCTTGAGTCATACTGAGG - Intronic
1006168116 6:32077529-32077551 TGCCCGGTTTAGTCACAGTGAGG - Intronic
1006914697 6:37586598-37586620 TGCCATCCAGATTCACACTGTGG - Intergenic
1011557952 6:88588738-88588760 TGCCCTCTGGCGTCAAGCTGGGG + Intergenic
1015708349 6:136112189-136112211 TGCCCTCCTGTGACAAACTGGGG - Intronic
1018148079 6:160912188-160912210 TGTCCTCATGACTCCCACTGTGG + Intergenic
1019962702 7:4474100-4474122 TGGCCTCTTTAGTGACACAGTGG - Intergenic
1021502411 7:21345683-21345705 TGCACTCTTTATTTACACTGTGG - Intergenic
1024576322 7:50767571-50767593 CGCACTCTTGAGTCACAGTATGG + Intronic
1026158442 7:67848035-67848057 AACCCTCATGAGTCACACTGTGG + Intergenic
1028951136 7:96636399-96636421 TACCTTCTTAAGTCACTCTGTGG + Intronic
1029213872 7:98931065-98931087 TCCCCTTTTCAGACACACTGTGG - Intronic
1032403937 7:131642445-131642467 TGGCCATTTGAGTTACACTGTGG + Intergenic
1039042459 8:33421301-33421323 TGCCCTCTAGTGTCACTTTGTGG + Intronic
1039243321 8:35580801-35580823 TGCTCTCTTTAGTCAAACTTTGG - Intronic
1049598515 8:143496225-143496247 TGCCCTCTTGAGTCAGAACAAGG - Intronic
1050168002 9:2786564-2786586 TACCCTCTAGAGCCACACAGAGG - Intronic
1050645217 9:7712435-7712457 TGCCATCTTCAATAACACTGAGG - Intergenic
1051337393 9:16078263-16078285 TGCCCTCTAGATTCACACCTTGG - Intergenic
1051504871 9:17815906-17815928 TGCCCTCTTGAGGAAAACTTAGG - Intergenic
1051819053 9:21143286-21143308 TGCCCACCTGAGAAACACTGAGG - Intergenic
1053500178 9:38582003-38582025 TGTTCTCTTGTGTAACACTGTGG - Intergenic
1060547514 9:124469985-124470007 CGCCCTCTGGGGTCACACTCTGG + Intronic
1060967565 9:127720442-127720464 TGCAATCTTGGGGCACACTGAGG - Intronic
1185577514 X:1185670-1185692 TGCCTTTTTAAGTCACACTCGGG + Intergenic
1186367878 X:8914224-8914246 TTCCCTGTTGCCTCACACTGTGG + Intergenic
1187560941 X:20403120-20403142 GGCCCACTTGAGTCACACTTGGG - Intergenic
1189272156 X:39759381-39759403 CGCCCTCCTGAGACACCCTGGGG - Intergenic
1193198779 X:78663536-78663558 TGTCCTCTTCAGTCCCACTGAGG - Intergenic
1198686958 X:139237463-139237485 AGCCATCTTGAATCACTCTGAGG - Intergenic
1202031204 Y:20576028-20576050 TGCCCTATTTGGTCACATTGGGG + Intronic