ID: 1143044635

View in Genome Browser
Species Human (GRCh38)
Location 17:4067652-4067674
Sequence GAGTTTATATATTTAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 581}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143044635 Original CRISPR GAGTTTATATATTTAAAACA TGG Intronic
900074962 1:806766-806788 GATTTTAAATATTTCAAATATGG - Intergenic
901298439 1:8179377-8179399 GACATTATCTTTTTAAAACATGG + Intergenic
901310908 1:8268875-8268897 GAATTTACATATTCAAAAGAGGG - Intergenic
901824379 1:11851129-11851151 TTGTTTATTTATTAAAAACAGGG - Intergenic
902225687 1:14995130-14995152 GAGTGTATGTCTTTAAAACGAGG + Intronic
902946944 1:19847794-19847816 TATTTTATTTATTTAAGACAGGG - Intergenic
903105181 1:21072056-21072078 GAGAAAATATATTTAACACATGG + Intronic
903634572 1:24802375-24802397 GTGTTTATATATATAAAAAGTGG + Intronic
904153559 1:28463626-28463648 TACTTTTTATTTTTAAAACAGGG - Intronic
906266554 1:44435381-44435403 GAGATAATGTATTTATAACATGG + Intronic
906412377 1:45589132-45589154 TTGTTTATTTATTTGAAACAAGG + Intronic
906806978 1:48788539-48788561 GATATTATATATTTAAAACATGG + Intronic
906899434 1:49817527-49817549 GAGTCTGAATATTTAACACAGGG - Intronic
908040947 1:60112459-60112481 GTGTTTTTAAATTAAAAACATGG + Intergenic
908240470 1:62184934-62184956 TAATATATATATTTTAAACAGGG + Intergenic
908440597 1:64150063-64150085 GTATTTTTATATTTAAACCATGG + Intronic
908621324 1:65983497-65983519 GAGATTATAAAGTTAAAATAAGG + Intronic
909324689 1:74335664-74335686 GAATTTCTATATTTAAAAAATGG + Intronic
909945252 1:81656239-81656261 GAGGTTAGATATTTGAGACAGGG - Intronic
911281396 1:95933830-95933852 CAATTAATATATTTAAAACAAGG + Intergenic
912278336 1:108285098-108285120 TAGTTAGTAGATTTAAAACAGGG + Intergenic
912289890 1:108409259-108409281 TAGTTAGTAGATTTAAAACAGGG - Intronic
912679037 1:111716919-111716941 GAGTTTTTATCTTTAGAAAATGG + Intronic
914261695 1:146004386-146004408 GTGTTTAAAATTTTAAAACATGG - Intergenic
916192057 1:162189294-162189316 GACTTCATCTATTTGAAACATGG + Intronic
916416554 1:164597732-164597754 GAGGTATTATATTTACAACATGG - Intronic
916915211 1:169399437-169399459 GAAAATATATTTTTAAAACAAGG + Intronic
916925742 1:169518858-169518880 GAGTTTAAATGTTTAGAACATGG - Intronic
916974623 1:170062545-170062567 AACTTTAAATATTTAGAACATGG - Intronic
918187261 1:182139223-182139245 GAATATATATATTTAAATAAAGG - Intergenic
918405405 1:184207448-184207470 GTGTTCTTATCTTTAAAACAGGG - Intergenic
918549039 1:185718808-185718830 GAGTTTCTTTAATTAAAATATGG + Intergenic
918759550 1:188385586-188385608 GAGATGATATATGTAAAAAATGG - Intergenic
918893623 1:190310549-190310571 GAGCTCATTTATTTAAAAAATGG - Intronic
919027717 1:192199579-192199601 GACAGTATTTATTTAAAACATGG + Intergenic
919163008 1:193855861-193855883 GTGTGAATACATTTAAAACAAGG - Intergenic
919518695 1:198559879-198559901 GGATTTTGATATTTAAAACACGG + Intergenic
919669003 1:200321631-200321653 AATTTTATTTATTTGAAACAGGG + Intergenic
919940008 1:202279827-202279849 GAGTCAATAAATTTAAAACAAGG - Intronic
920810981 1:209285387-209285409 GAATATATATGATTAAAACAGGG - Intergenic
921240568 1:213177256-213177278 GAGCAAATATACTTAAAACATGG - Intronic
921693659 1:218182232-218182254 GTTTCTATATATTCAAAACATGG + Intergenic
921739017 1:218662245-218662267 AATTTTAGATATTTAAAAGATGG - Intergenic
921952819 1:220949491-220949513 GAGTTGATACATTTTAAAAACGG + Intergenic
922270803 1:224031665-224031687 GATTTTAAATATTTCAAATATGG - Intergenic
923476713 1:234340543-234340565 TATTTTCTATGTTTAAAACATGG - Intergenic
923833476 1:237583644-237583666 TGGGTTATATATTTAATACATGG + Intronic
924019213 1:239763237-239763259 GAGTTCATAAATGAAAAACATGG + Intronic
924621292 1:245663337-245663359 CAGTTTCTATTTTTCAAACATGG + Intronic
924675871 1:246177312-246177334 GAGTTTATAAGTTTAAAAGGAGG + Intronic
924696281 1:246403496-246403518 TAGGATATATGTTTAAAACAGGG - Intronic
924833012 1:247617189-247617211 AAGTTTATATTTTTGAATCAGGG + Intergenic
924862649 1:247941380-247941402 GAGTTTAGATATATAAAGAATGG + Intronic
1064820308 10:19322445-19322467 CCATTTATATATTTAAAAAATGG - Intronic
1065158718 10:22896791-22896813 GAGTGAATATATTGAAAACATGG - Intergenic
1065663604 10:28034357-28034379 GATTTTTTAAAATTAAAACATGG + Intergenic
1066079649 10:31917644-31917666 GATTATATCTTTTTAAAACATGG - Intronic
1066210158 10:33228756-33228778 GAGTTTATATCTTTAAAACCAGG - Intronic
1068328397 10:55527431-55527453 GAGTTTTTATTTTTTAAAAAAGG - Intronic
1069126282 10:64638938-64638960 AGGTTAATATCTTTAAAACAAGG - Intergenic
1069269782 10:66512325-66512347 CAGTTTATATATTTCAATTAGGG + Intronic
1069330984 10:67292568-67292590 GAGTTTATAGATATAAAAATGGG - Intronic
1069384045 10:67868306-67868328 CACTTTATATATGTGAAACAAGG + Intergenic
1070006974 10:72433805-72433827 CAGTTTCTTTATTTTAAACAAGG + Intronic
1071173929 10:82901248-82901270 AATTGTAAATATTTAAAACACGG - Intronic
1071782181 10:88858515-88858537 GAGATAATATATCTAAGACAAGG + Intergenic
1071952107 10:90715486-90715508 AAATTTATATCTTTAAAATATGG - Intergenic
1072065619 10:91868137-91868159 GATTTGAGATTTTTAAAACAAGG + Intergenic
1073352357 10:102828875-102828897 GAGTTTATATTTTGAAAGTAGGG - Intergenic
1073705472 10:105978974-105978996 GAGTTTCTGTATTTTTAACAAGG + Intergenic
1073993061 10:109285922-109285944 CAGTTTATAAATTTGCAACATGG - Intergenic
1074199017 10:111215796-111215818 GATTGTATAGATTAAAAACATGG + Intergenic
1074308869 10:112303938-112303960 ATGTTTATATATTTAACAAATGG - Exonic
1074990943 10:118706998-118707020 GACTCTCGATATTTAAAACAGGG + Intronic
1075882220 10:125863017-125863039 CAGTTTATATCTTTAAATTAAGG + Intronic
1076226589 10:128781412-128781434 GTGTTTATATATTTAAGATGGGG + Intergenic
1077630126 11:3805989-3806011 TTATTTATTTATTTAAAACAAGG - Intronic
1077904839 11:6523180-6523202 GAGATTATATAATTAAAATTAGG - Intronic
1079395398 11:20058134-20058156 GAGTTAATAAATTCAAAAAAAGG - Intronic
1079402977 11:20120914-20120936 GAATTTATATATTTCAAAATTGG - Intronic
1079582078 11:22078085-22078107 GATTTTATATATTTAAATGCAGG - Intergenic
1080201996 11:29682767-29682789 CATTTTGTATATTTACAACAAGG + Intergenic
1081143183 11:39529322-39529344 GAGTTTTTTTTTTTAAATCAGGG + Intergenic
1081260406 11:40953187-40953209 GAGTTTATATTTTCTAAATAGGG - Intronic
1081832828 11:46128602-46128624 GATGTAATATATTTCAAACAGGG - Intergenic
1082914979 11:58423505-58423527 CAGTTTATAAATTTATAAAATGG - Intergenic
1083559593 11:63662484-63662506 CTGTTTATTTATTTAAGACAAGG + Intronic
1085109435 11:73874623-73874645 AAGGTTATTTATTTGAAACAGGG - Intronic
1085184901 11:74567471-74567493 TAGTTTGTTTATTTAAAACCAGG + Intronic
1085373812 11:76039500-76039522 AAGTTTACATATTTGAAAAAAGG + Intronic
1086014869 11:82155225-82155247 GAGTTTTCATTTTTAAAAAATGG - Intergenic
1086313259 11:85560297-85560319 CAGTTTATATATTTAAAAACTGG + Intronic
1086374055 11:86182790-86182812 GAGTTCATACAATTAATACATGG - Intergenic
1086793874 11:91075697-91075719 GAATTTTTATATTTAAAAGCTGG + Intergenic
1086896863 11:92323253-92323275 GTATATATATATTTGAAACAGGG + Intergenic
1088224323 11:107603073-107603095 GAGTTGATATTTTAAATACAAGG - Intronic
1088226771 11:107629159-107629181 GAGTTTTTATTTTTAACACAAGG + Intronic
1090877308 11:130802157-130802179 GAATTTATATATTAACAAGAAGG + Intergenic
1093223953 12:16458631-16458653 GAAATTATATATTATAAACATGG + Intronic
1093291465 12:17329059-17329081 GTGTATATATATGTAAAATAAGG + Intergenic
1093830514 12:23751421-23751443 AGTTTTATAAATTTAAAACATGG - Intronic
1093886130 12:24463501-24463523 GCGTTTAGAAATTTAAAACTGGG - Intergenic
1094210339 12:27883842-27883864 TTGTTTATTTTTTTAAAACAGGG + Intergenic
1094369143 12:29717129-29717151 CATTTGACATATTTAAAACAAGG + Intronic
1094407228 12:30129656-30129678 GAATTTTAATATTTAAAAAATGG - Intergenic
1094589571 12:31807828-31807850 GAGTTTTTAAATTGAACACATGG + Intergenic
1095208355 12:39464040-39464062 GAGTTAATATATTTAAAATATGG - Intergenic
1095354193 12:41252107-41252129 TTATTTATTTATTTAAAACAGGG - Intronic
1095734459 12:45541413-45541435 AAGTTGCTATATTTAAAATATGG + Intergenic
1096135444 12:49196316-49196338 GATTTAATAAATTAAAAACAGGG + Intronic
1096612559 12:52812452-52812474 GAGTATAGATATTTAAAACAAGG + Intronic
1097658521 12:62399597-62399619 GAGTTCATATATTGAGAACAGGG + Intronic
1097832929 12:64244753-64244775 GAGTTTATATTTTAATAAGATGG - Intergenic
1097971364 12:65636713-65636735 TAGTTTACTTATTTGAAACAGGG + Intergenic
1098930524 12:76407256-76407278 AAATTTATATATTTGAGACAAGG + Intronic
1099102694 12:78461602-78461624 CAGTTTGTAGGTTTAAAACAAGG - Intergenic
1099581110 12:84447822-84447844 GAGTTTATGGATTTTAAATAGGG - Intergenic
1101238374 12:102813003-102813025 GGGTTAATATATATAAAACTTGG + Intergenic
1101823443 12:108202023-108202045 GAGGTCAGATATGTAAAACAGGG - Intronic
1101989833 12:109475909-109475931 GAGTTTGTGTATTAAACACAGGG - Intronic
1102912098 12:116724218-116724240 AAGCTTATATACTTAAAAAATGG + Intronic
1103224548 12:119275540-119275562 GACTTTGGATATTTAAAACCAGG + Intergenic
1103410472 12:120708110-120708132 GTATTTATTTATTTAAGACAGGG - Intergenic
1104095714 12:125555825-125555847 ACGTTTATATATCTAAAATAAGG + Intronic
1105297606 13:19103089-19103111 TATTTTATATTTTTAAGACAGGG - Intergenic
1106440159 13:29759474-29759496 GAGTTTGGATATATAAATCAAGG - Intergenic
1106642821 13:31602075-31602097 GTGTTTGTCTTTTTAAAACATGG + Intergenic
1106655367 13:31738759-31738781 GAGTTTATATTTTACTAACAGGG - Intergenic
1106732389 13:32554925-32554947 GAGCTTATATATCTTAAATATGG + Intergenic
1106811944 13:33367132-33367154 GAGATAATATATCAAAAACAAGG + Intergenic
1106895446 13:34295589-34295611 CAATTTATATTTTCAAAACATGG - Intergenic
1107036563 13:35908562-35908584 TACTTTATTTATTTGAAACAGGG + Intronic
1107518276 13:41153258-41153280 TCATTTATATTTTTAAAACAGGG - Intergenic
1107540266 13:41382975-41382997 AAGTTTATAGATTTAGTACAGGG - Intergenic
1107828843 13:44356474-44356496 GAACTTCTATCTTTAAAACAGGG + Intergenic
1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG + Intronic
1108604626 13:52025220-52025242 GAGTTTCTTTATTTATAAAATGG - Intronic
1108845437 13:54673249-54673271 TATTATATATATTTAAAGCAAGG + Intergenic
1108861618 13:54867529-54867551 GTGTTGATCTAATTAAAACAAGG + Intergenic
1108912193 13:55568896-55568918 AACTTTATTTATTTAAAAAATGG + Intergenic
1109122454 13:58475061-58475083 GAATATTTATATTTAAACCATGG + Intergenic
1109154093 13:58883009-58883031 TAGTGTGTATATTTAAAACGAGG + Intergenic
1109556233 13:63979481-63979503 GAATTAATTTATTTAAAAAAAGG - Intergenic
1109611923 13:64776761-64776783 AAAATTATATATATAAAACATGG + Intergenic
1109843787 13:67956807-67956829 GAGTTTTTATACGTAAAAGAGGG - Intergenic
1109897651 13:68714351-68714373 GCGTTTTTATATTTAAAAAAAGG + Intergenic
1110030479 13:70605239-70605261 GACATTATATAATTAAAAGAAGG + Intergenic
1110043301 13:70793905-70793927 GAGTTTATATATGTCAATTATGG - Intergenic
1110153613 13:72285794-72285816 AAGTTTAGATATTTGAAAGAGGG + Intergenic
1110215417 13:73019698-73019720 GAGAGTATTTATTGAAAACATGG - Intergenic
1110280100 13:73683093-73683115 TATTTGATATATCTAAAACATGG - Intergenic
1110397013 13:75042049-75042071 GTGTATATATATATAAAATAAGG - Intergenic
1110508336 13:76316435-76316457 GTGTATATATATTTAAAACTAGG + Intergenic
1110671237 13:78181161-78181183 GTTTGTATATAATTAAAACAAGG + Intergenic
1111191650 13:84815951-84815973 AAGTATACATATTTTAAACACGG - Intergenic
1111200624 13:84931504-84931526 GAGTATGTAGATTTAAACCAGGG - Intergenic
1111248642 13:85574496-85574518 AAGTTTATAGATTTAAAGTAAGG + Intergenic
1111310462 13:86477556-86477578 GACTTAAGATATTTGAAACAAGG + Intergenic
1111444561 13:88330305-88330327 GAGTTTAAACCTTCAAAACATGG + Intergenic
1111794901 13:92906373-92906395 GATTTTCTATATTTTGAACATGG - Intergenic
1112105947 13:96239680-96239702 GAGTTTATATATAAAAGGCAAGG + Intronic
1112208706 13:97351238-97351260 CAGTATATGTATTTACAACATGG - Intronic
1112510417 13:100004192-100004214 AATTTGAGATATTTAAAACATGG + Intergenic
1112650191 13:101388163-101388185 GAGTTGATACATTTAAAGCTTGG + Intronic
1112861836 13:103838354-103838376 GAGTTTACATGTTTTAAACTAGG + Intergenic
1113193494 13:107777882-107777904 GAATTTATATGTTTAACAAAAGG + Intronic
1115109333 14:29802530-29802552 AAGTTGCTAAATTTAAAACAAGG + Intronic
1115440451 14:33428834-33428856 GATTTTAATTATTTAAAATACGG - Intronic
1116307121 14:43271468-43271490 GTGTTTATGTATGTAATACAAGG - Intergenic
1116351029 14:43862849-43862871 AAGATAAGATATTTAAAACAGGG - Intergenic
1116382487 14:44288421-44288443 AATATTAAATATTTAAAACATGG + Intergenic
1117034260 14:51711069-51711091 GACTTTATATGTTTAAAACTGGG - Intronic
1117228696 14:53692401-53692423 GAATTTTTTTATTTAAATCAGGG + Intergenic
1118582773 14:67320166-67320188 GTATTTATATCTTTAATACATGG + Intronic
1118625372 14:67654111-67654133 GCTTTTATTTATTTGAAACAGGG + Intronic
1119318467 14:73714637-73714659 GGGTTATTATTTTTAAAACACGG - Intergenic
1119506195 14:75175392-75175414 GAAATTACAAATTTAAAACAAGG + Intronic
1119630970 14:76231898-76231920 AAATATATATATATAAAACAGGG + Intronic
1119993995 14:79231756-79231778 TAGTTTATCTATTCAAATCAAGG - Intronic
1120202345 14:81551572-81551594 GAGTTCTTATATTTATAATATGG - Intergenic
1120602573 14:86530314-86530336 GAGTATATGTGTTTAACACATGG + Intergenic
1120663334 14:87276821-87276843 AAGTTAAAATATTTAAAAAATGG - Intergenic
1120674631 14:87406665-87406687 GAGTTTATATTTTTAAAATCAGG + Intergenic
1120725597 14:87936365-87936387 GATTTTATTTATTAAAAAAAGGG - Intronic
1121186681 14:91978511-91978533 GTGTATATATATTTGAGACAGGG + Intronic
1121440519 14:93946082-93946104 GAGTATAGATATTTAAAATCAGG + Intronic
1122073875 14:99223313-99223335 GATATTATATTTTTAAAAAATGG - Intronic
1122587727 14:102821373-102821395 GAGTTTATATAATTAAGATTAGG + Intronic
1123463803 15:20498576-20498598 AAGTTGATATGTTTAAAAAATGG + Intergenic
1123654259 15:22501852-22501874 AAGTTGATATGTTTAAAAAATGG - Intergenic
1124308166 15:28597048-28597070 AAGTTGATATGTTTAAAAAATGG - Intergenic
1124815344 15:32985364-32985386 AAGTTGACATATTTAAAAGATGG - Intronic
1125102165 15:35926700-35926722 TAATTTATTTATTTAATACAAGG - Intergenic
1126389714 15:48133567-48133589 TAGTCTATTGATTTAAAACATGG - Intronic
1126704603 15:51395748-51395770 TAATTTATATATTTAAAAAAAGG + Intronic
1127416915 15:58767094-58767116 TAATTTATTTATTTAAGACAGGG - Intergenic
1127442468 15:59023644-59023666 GGGCATATATATTTAAAAGAAGG - Intronic
1128342543 15:66832426-66832448 GATTTCCTATATTTAAAACAAGG + Intergenic
1128824986 15:70705938-70705960 CAGTATGTATTTTTAAAACATGG - Intronic
1129093127 15:73173095-73173117 GAGTCTTTCTATTTAGAACAAGG - Intronic
1129290444 15:74562866-74562888 GAATTTGTATTTTTAAAAAAGGG - Intronic
1130104133 15:80916648-80916670 CAGTTTAAATATTTAACACTGGG + Intronic
1131671061 15:94619911-94619933 GTGTTTATACATTTTAAAGAAGG + Intergenic
1131718577 15:95141620-95141642 AAATTTATATATCAAAAACAAGG - Intergenic
1133914018 16:10092587-10092609 TATTTTATATGTTTGAAACAGGG - Intronic
1134089031 16:11380694-11380716 GGGTTTATTTTTTTAAATCAAGG - Intronic
1135103551 16:19627324-19627346 GTGGATATATATTTACAACATGG + Intronic
1136010137 16:27358340-27358362 GTGTTTATTTATTGAAACCATGG + Intronic
1136357658 16:29756388-29756410 AATTTTATGTTTTTAAAACATGG + Intergenic
1136621066 16:31428444-31428466 GGGTTTCTATATTTAAAATGGGG + Intergenic
1136985559 16:35100980-35101002 AAGATTATTTATTTAAATCATGG + Intergenic
1137243079 16:46675262-46675284 AAGGTTATTTATTTAAATCATGG - Intronic
1138587841 16:57983121-57983143 TAATTTATTTATTAAAAACAAGG + Intronic
1139091563 16:63654422-63654444 GTATTTATTTATTTAAGACAGGG - Intergenic
1139126202 16:64080842-64080864 AAGTTTATATGTTTAAAAATAGG + Intergenic
1139570396 16:67808041-67808063 CAGCTTATATATCTCAAACATGG + Intronic
1139643098 16:68307591-68307613 AAATTTACATATGTAAAACATGG + Intronic
1140486295 16:75296246-75296268 GACTTTATTTTTTTAAGACAGGG + Intronic
1140971365 16:80016186-80016208 GAGTTTTTCTTTTTAAAAAAAGG - Intergenic
1142895145 17:2971027-2971049 TAGTTTATTTATTTAAAAACAGG - Intronic
1143044635 17:4067652-4067674 GAGTTTATATATTTAAAACATGG + Intronic
1143237590 17:5416638-5416660 GACTTGATAGATTTCAAACAGGG + Exonic
1143413504 17:6727441-6727463 GTGTATATATATATAAAACATGG - Intergenic
1143894534 17:10125843-10125865 GTGTTTATATAAATAACACAGGG - Intronic
1144277163 17:13682300-13682322 AACTTTATATCTTTAAAACTTGG + Intergenic
1144622724 17:16828813-16828835 AAATTTAAATATTTAAAATATGG + Intergenic
1144883707 17:18443903-18443925 AAATTTAAATATTTAAAATATGG - Intergenic
1145052044 17:19670260-19670282 GAATTTATATCTTTAAAATGTGG + Intronic
1145148524 17:20500483-20500505 AAATTTAAATATTTAAAATATGG + Intergenic
1146191921 17:30776189-30776211 TAGTTTATAAATTTAATAAATGG + Intronic
1146337096 17:31982891-31982913 TAGTTTATAAATTTAATAAATGG + Intronic
1147233072 17:39033508-39033530 GAGATTAAATGATTAAAACAGGG + Intergenic
1147577055 17:41608747-41608769 TAATTTAAATAGTTAAAACATGG + Intergenic
1149351081 17:55788100-55788122 GAGTTTAGATATATAAAATTCGG - Intronic
1150039095 17:61839103-61839125 GAGGTAATTTATTTAAAAAATGG - Intronic
1150081505 17:62243691-62243713 AAGTTTATAGATATAAAACCTGG - Intergenic
1150269447 17:63853761-63853783 GAGTTTTTTTTTTTAATACAGGG - Intergenic
1150664961 17:67125748-67125770 AAAGTTATAAATTTAAAACAGGG + Intronic
1150996144 17:70319724-70319746 GACATTATAAGTTTAAAACAAGG + Intergenic
1151907432 17:77057643-77057665 AAATTTATTTATTTTAAACATGG - Intergenic
1152043743 17:77922182-77922204 GTATTTATGTATTTAAGACAAGG - Intergenic
1153449114 18:5206761-5206783 TAGTTTATATAAATGAAACAGGG + Intergenic
1153853599 18:9121989-9122011 GAGTTTACATATTTAAAATATGG + Intronic
1153942056 18:9986896-9986918 GAGTGTAAGTATTTAACACATGG + Intergenic
1154505260 18:15032163-15032185 TAGTTTATAAATATAAAATAAGG + Intergenic
1155321885 18:24627388-24627410 TAGTTAATATCTATAAAACAAGG + Intergenic
1155662634 18:28269004-28269026 TAATTTAAATATTTTAAACAAGG + Intergenic
1155930685 18:31704559-31704581 GATTTTATATATTTGGAATATGG - Intergenic
1156107443 18:33682060-33682082 GTCTTTAGTTATTTAAAACAAGG + Intronic
1156998151 18:43493973-43493995 GAGGTAATAAAGTTAAAACAAGG + Intergenic
1157175876 18:45451508-45451530 GATTTTGTTTATTTAAAAGAGGG + Intronic
1157719925 18:49915875-49915897 AAGTGTCTATATTTAAAACTTGG - Intronic
1158047232 18:53170890-53170912 TTGTTTGTTTATTTAAAACAAGG + Intronic
1158240186 18:55368725-55368747 CAGTTTAAATATTTAAAAAGAGG + Intronic
1158342560 18:56482379-56482401 GATTTTTTATATATAAAAAAAGG + Intergenic
1158817118 18:61115259-61115281 GTGTATATATATATAAAAAAAGG + Intergenic
1159409320 18:68050954-68050976 GTGATTATATATATAAAATATGG - Intergenic
1162602970 19:11683549-11683571 GTGTATATATGTTTAAGACAGGG + Intergenic
1162624172 19:11870747-11870769 GAATTTATATATTTTAACTAAGG - Intronic
1162855850 19:13468013-13468035 GAATTTATACATTTAAATTATGG - Intronic
1163056093 19:14719329-14719351 GTGTTTATATTTTTACAAAATGG - Exonic
1164794079 19:31012312-31012334 GTGTTTTTGTATTTAACACAGGG + Intergenic
1166290259 19:41859011-41859033 AAGATCATATATTTAAATCAAGG - Intergenic
1166577742 19:43858837-43858859 CAGTTTATATCTTTTAAATATGG - Intergenic
925945938 2:8863770-8863792 GAATTGAAATATTTAAAACCAGG + Intronic
927302488 2:21531538-21531560 GAGTTTATATCATGAATACAAGG - Intergenic
927436015 2:23067130-23067152 GAGTTTATTTATTTAACAGCTGG + Intergenic
928044387 2:27913582-27913604 GTGTATATATATGTAAAGCATGG - Intronic
928350993 2:30554452-30554474 GACTTGATATTTTTAAATCACGG - Intronic
928461602 2:31478662-31478684 GATTTTATATTTGTAAAATAAGG - Intergenic
928999885 2:37336568-37336590 AATTTCATATCTTTAAAACATGG + Intergenic
929272829 2:39992162-39992184 GAGAATATATATTTAAAAGAAGG - Intergenic
930160430 2:48149759-48149781 GAGATAATATTTTTCAAACATGG - Intergenic
930899753 2:56490572-56490594 GATTTTAAATAATGAAAACAAGG - Intergenic
931078381 2:58741842-58741864 GAGTTTATAAATTCAAAAACAGG + Intergenic
931280936 2:60791182-60791204 GAATAAATATATTTAAAAAACGG - Intronic
931890694 2:66668164-66668186 CAGTTAATAAACTTAAAACAGGG + Intergenic
932532615 2:72552697-72552719 GAGTTTATCTAATAAACACAAGG + Intronic
932878558 2:75477855-75477877 GATGTGATAGATTTAAAACAGGG + Intronic
933547873 2:83738262-83738284 GCATATATATATTTAAGACAGGG - Intergenic
935505873 2:103901715-103901737 TAATTGACATATTTAAAACATGG - Intergenic
935613322 2:105048830-105048852 GAGTTTTGATATTTGACACATGG - Intronic
935892352 2:107692414-107692436 GGGTCAATATATTGAAAACATGG + Intergenic
935965313 2:108466832-108466854 GAGTTTATTTGTTTATAATATGG + Intronic
936977073 2:118230989-118231011 GAGTTTATTTGTTTGAGACAGGG - Intergenic
937577016 2:123435966-123435988 GAGTTTTTAAATTTGCAACATGG + Intergenic
937605545 2:123797247-123797269 GAGATCATATATTTAAATAACGG - Intergenic
937648399 2:124292511-124292533 GAATTTATCTATTTAAAAATAGG - Intronic
937673118 2:124560075-124560097 GAGTTTATCATTGTAAAACAAGG + Intronic
938504451 2:131862420-131862442 TAGTTTATAAATATAAAATAAGG + Intergenic
938655733 2:133431285-133431307 CAGTTTAAATATATAAAACATGG - Intronic
939281058 2:140065681-140065703 GATTTTATATATTGAAGATAAGG - Intergenic
939538138 2:143458854-143458876 GAGGTAATATATGTAAAAAATGG + Intronic
939833400 2:147099559-147099581 GAGGTTAGATATTCAAAAGAGGG - Intergenic
940276472 2:151945642-151945664 AAATTTATTTATTTGAAACAGGG - Intronic
940383254 2:153041257-153041279 GAGGTTATATTTTTAAAGAAAGG - Intergenic
940532275 2:154893585-154893607 GAATTTATTTAATTATAACAGGG + Intergenic
940959472 2:159767614-159767636 TTGCTTAGATATTTAAAACAAGG - Exonic
941173339 2:162166018-162166040 GAGTCTTTATTTCTAAAACAAGG - Intergenic
941189827 2:162367526-162367548 GAGTAGATATGTTTATAACAAGG + Intronic
941287638 2:163633386-163633408 TAGTTTATTTATTTGAAAGATGG - Intronic
941379271 2:164772385-164772407 GACTGTATATTTTTTAAACAAGG - Intronic
941449969 2:165648580-165648602 AAGTTTATAACTTTAAAATATGG + Intronic
941481671 2:166023451-166023473 CATTTTACATATTTAAAAAATGG - Intronic
942161804 2:173196734-173196756 GAGCTTTTGTTTTTAAAACAAGG + Intronic
942652455 2:178182854-178182876 AAATTTATATAATTTAAACATGG - Intergenic
942664093 2:178298255-178298277 GAATGAATATATTTAAAAAAGGG - Intronic
943445220 2:187977046-187977068 GACTTTCTATAATTAGAACAAGG - Intergenic
943666332 2:190612810-190612832 GGTTTTTTATATATAAAACAAGG - Intergenic
943824295 2:192369552-192369574 GAATATATATATTTAAAATGTGG + Intergenic
943958691 2:194230262-194230284 GAGTTTAAATATTGAAAATGAGG - Intergenic
944135158 2:196391142-196391164 GAGACTATATATTTAGAACTGGG - Intronic
944318456 2:198308431-198308453 CAGTTTAGATATTTAATATAGGG - Intronic
944330091 2:198455332-198455354 GCGTATATATTTTTAAAAAAGGG - Intronic
944405125 2:199375462-199375484 GCATATATATATTTAAAACAGGG - Intronic
945275225 2:207981348-207981370 AAGTTTATTTATTTGAGACAGGG + Intronic
945323863 2:208459972-208459994 AAGTTTGTATAGTTAAAAAAGGG + Intronic
945367967 2:208979494-208979516 TAGTCAATATATTTAAACCAGGG + Intergenic
946581123 2:221129062-221129084 TAATTTATATTTTTAAAAAAAGG - Intergenic
946821079 2:223630220-223630242 GTATATATATATTTTAAACAGGG + Intergenic
947232945 2:227906674-227906696 AAGTTTCTATACTTAAAAAATGG + Intronic
947272303 2:228350370-228350392 GAGTTGATAAATATTAAACAAGG + Intergenic
947584097 2:231341884-231341906 GAGATTATTTATTTGAAAGAAGG - Intronic
948415680 2:237801320-237801342 GTGTGTATATATTTAAGTCAGGG - Intronic
949082761 2:242118018-242118040 GATTTTAAATATTTCAAATATGG + Intergenic
1169307604 20:4505963-4505985 GACTTTTAAAATTTAAAACATGG + Intergenic
1169777746 20:9274842-9274864 GATTTTAAACATTTTAAACAAGG - Intronic
1169924550 20:10769115-10769137 GAGTCTACATTTATAAAACAGGG + Intergenic
1170296968 20:14838040-14838062 TAGTTAACATATGTAAAACAAGG + Intronic
1170974342 20:21148327-21148349 GAGTTTTTATATTTAAAAAATGG - Intronic
1171033824 20:21700940-21700962 GAGTAGATATATTTTAAACGTGG - Intergenic
1172367613 20:34362172-34362194 TAGTTTATATATTTGTAAAATGG + Intergenic
1172458631 20:35098289-35098311 AAATTTATTTATTTAAGACAGGG + Intergenic
1172595263 20:36146818-36146840 CAGTTTTTCCATTTAAAACAGGG - Intronic
1172839948 20:37896867-37896889 TAATTTATTTATTTAAGACAGGG - Intergenic
1172956388 20:38762550-38762572 CAGATTATATTTTTAAAAGAAGG - Intronic
1174976705 20:55344027-55344049 GAGTTTGAATATTTAGAATAAGG + Intergenic
1175351420 20:58323029-58323051 CAATTTATATATTCAACACAAGG - Intronic
1176792588 21:13336910-13336932 TAGTTTATAAATATAAAATAAGG - Intergenic
1177215164 21:18118806-18118828 GAGTTTTTGTATTTAAAGTATGG - Intronic
1177465680 21:21476491-21476513 GTGTTTAAATTTTTAATACATGG + Intronic
1177598752 21:23282589-23282611 AAGTTTATGTCTTTAAAACATGG + Intergenic
1177624371 21:23640961-23640983 AAATTTATATTTTTAAAACTAGG + Intergenic
1177991990 21:28047814-28047836 TAGTTTATAAATATAAAATAAGG - Intergenic
1178048575 21:28723574-28723596 GAGATTAAAAATCTAAAACAGGG + Intergenic
1178816130 21:35931203-35931225 TAGTTTATTTATTTTAAATATGG + Intronic
1179514675 21:41898462-41898484 GAATTTATAGTTTTAAAGCACGG + Intronic
1183204504 22:36409528-36409550 GTGTTTATTTATTTGAGACAGGG + Intergenic
1183285797 22:36962802-36962824 GAAATTATAGATTAAAAACAGGG + Intergenic
1185009254 22:48304071-48304093 CTGTTTATATTTTTAAAACCAGG + Intergenic
949114294 3:301083-301105 GGGTTAATATTTTTAAAAAATGG - Intronic
949260025 3:2095400-2095422 GAGTTTATATTTTAAAATCAGGG + Intergenic
949504333 3:4712969-4712991 GAGTTTATAAATATAAATGATGG + Intronic
949744472 3:7272389-7272411 GAGTTAATATATGGAATACATGG + Intronic
950510364 3:13421868-13421890 GCATATATATATATAAAACATGG + Intergenic
951041069 3:17989329-17989351 GAATTTCTATGTTTATAACAAGG - Intronic
951829735 3:26912798-26912820 TAGTTTAAATATATAAGACAGGG - Intergenic
951972338 3:28461110-28461132 ATGTTTATATATTTAAAATCTGG - Intronic
951977905 3:28534227-28534249 TACTTTATATATTTTAGACAAGG + Intronic
952063502 3:29539610-29539632 GAGTTCATGTATTAAAAACTCGG - Intronic
952087683 3:29846319-29846341 GAGTTAATATATTTTGAATAAGG + Intronic
952597807 3:35040238-35040260 GATTCCATTTATTTAAAACATGG - Intergenic
952617595 3:35293569-35293591 GAGTCTATATTTTTAAAATATGG - Intergenic
955126895 3:56121753-56121775 GTGTATATATATTTTAAACTAGG + Intronic
955372485 3:58365252-58365274 GAGATTTTGTCTTTAAAACATGG + Intronic
955960441 3:64335152-64335174 GACTTTACAGATTTAATACATGG + Intronic
957081038 3:75635737-75635759 GATTTTATTTTTTTAAAAAAGGG + Intergenic
957239590 3:77640833-77640855 GAGTTTGTATATTTTAAGAAAGG - Intronic
958494863 3:94831482-94831504 AAATTTATAATTTTAAAACATGG - Intergenic
958675279 3:97261875-97261897 AAGATTATATAGTTAATACATGG + Intronic
959518369 3:107297177-107297199 AAGTTTTTGTATTAAAAACAGGG - Intergenic
959817818 3:110696009-110696031 AAGACAATATATTTAAAACAAGG + Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
960226086 3:115170368-115170390 AAGTTTATATTTTTAACTCAAGG + Intergenic
960677446 3:120209988-120210010 GAGGTTAAATATCTAAAACCTGG + Intronic
960934143 3:122886368-122886390 GACTTTATATATGAAACACAGGG + Intergenic
962176974 3:133165602-133165624 CAGTTTATAAATTTAGAAAAAGG + Intronic
962785662 3:138766050-138766072 GAGTTTATGTATTTGAGACATGG - Intronic
963043591 3:141086631-141086653 CAGTTTCTTTATTTGAAACAAGG + Intronic
963614284 3:147515806-147515828 GAGTTTAAATCTTTAAAACTTGG - Intergenic
964165053 3:153693873-153693895 GTGTATATATATATAAAAAAAGG + Intergenic
964232363 3:154486318-154486340 GTGTTTCTATATTTAAAAATTGG - Intergenic
964454460 3:156846817-156846839 GTATTTATTTATTTGAAACAAGG + Intronic
964729285 3:159847916-159847938 GAGGTTATAAATCTAATACATGG + Intronic
964775326 3:160269336-160269358 GAGTTTATAAAATTAAAAACTGG + Intronic
964962245 3:162441136-162441158 GAGATTATATATTCAAAACATGG - Intergenic
965261175 3:166488587-166488609 GAGTATTTAGATTTAAAATAAGG - Intergenic
965331253 3:167377663-167377685 AAATATATATATTTAAAATAAGG - Intronic
965470303 3:169082028-169082050 TTGTATATATATTTAAGACAAGG + Intergenic
965548350 3:169938118-169938140 GTGTTTACAGATGTAAAACAGGG - Intronic
965760603 3:172071879-172071901 CAGTTTCTATCTGTAAAACAAGG - Intronic
966081008 3:176000506-176000528 GAATTGACATATTTAAAGCATGG + Intergenic
966502613 3:180660873-180660895 TAGTTTATATTATTAAAATATGG - Intronic
966705885 3:182912865-182912887 GATGTTATATATGTAAAAGAAGG + Intronic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
970422675 4:15919920-15919942 GAGTTTATAAATTTTAGAGAGGG - Intergenic
970928101 4:21476645-21476667 GAGTCTTAATATTTAAAATAGGG - Intronic
971924441 4:32989122-32989144 CCGTTAAAATATTTAAAACACGG - Intergenic
971967793 4:33583672-33583694 GTGTATATATCTTTAAAACATGG + Intergenic
972072689 4:35040415-35040437 CAGTTTATATATTTGACAAAGGG - Intergenic
972358196 4:38302502-38302524 GAGTTTTTATAATAAAAAGATGG - Intergenic
972873253 4:43326757-43326779 CAGTTTAGATAGTTAAAACTTGG - Intergenic
972950922 4:44321204-44321226 TAGCTTATATAGTTAAAATAGGG - Intronic
974092499 4:57326646-57326668 AAATATATATATTTAAATCATGG - Intergenic
974285928 4:59867305-59867327 GAGTTAATATTTTTCAAAGATGG + Intergenic
974338228 4:60579343-60579365 GAGTTTATGTATTTAATAGCTGG - Intergenic
974416657 4:61616757-61616779 GAGATTATATATTTATAACATGG - Intronic
974417092 4:61622713-61622735 GTGTTTCTATTTTTAAAACGAGG + Intronic
974911141 4:68121524-68121546 TATTTTATATATATATAACATGG + Intronic
975296526 4:72741056-72741078 ATGTTTATATATTTACAAAATGG + Intergenic
975971463 4:80043293-80043315 GAGATCAAATATTTAAAACTAGG - Intronic
976069930 4:81230116-81230138 GAGTTTCTGCATTTAAAACTAGG + Intergenic
976243692 4:82986418-82986440 GTATTTTTATATTTAAAAAAAGG - Intronic
976424632 4:84887656-84887678 TACTTTATACATTTAAAATATGG + Intronic
976508269 4:85876044-85876066 GAATAGATATATTTAATACATGG + Intronic
976570550 4:86603661-86603683 CATTTTATATAGTTAAAAAAGGG - Intronic
977657663 4:99541029-99541051 CAGTTTCTAGCTTTAAAACAAGG + Intronic
977753646 4:100638924-100638946 AAGTGTGTATATTAAAAACAAGG + Intronic
978068073 4:104431012-104431034 GGGTGTTTTTATTTAAAACATGG - Intergenic
978089607 4:104698740-104698762 CAGTTTACATATTTAATAGATGG - Intergenic
978380241 4:108120035-108120057 GTATGTATATATTTAAAAGAAGG + Intronic
978407872 4:108398925-108398947 CAGTTTATATAGTTTATACATGG - Intergenic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
978847822 4:113294926-113294948 CATTTGATATCTTTAAAACAAGG + Intronic
979585682 4:122413341-122413363 GAATTTTTAAATTTAAAACATGG + Intronic
979691079 4:123559212-123559234 GAGATCATGTATGTAAAACAGGG - Intergenic
980557310 4:134425627-134425649 CATTTTATATATTTAAAGCAAGG - Intergenic
980712279 4:136585226-136585248 GAGTTTATTTGTCTAAAACATGG - Intergenic
980817982 4:137973393-137973415 ATGTTTATAGATTTAAAATAAGG + Intergenic
980842051 4:138275523-138275545 GTGTTCAGATATTTAAAATAGGG - Intergenic
980966563 4:139526937-139526959 AAGTTTATTTTTTTAAAAAAAGG - Intronic
981143966 4:141303703-141303725 GAATTTATCTATTTTAAACCTGG + Intergenic
982024822 4:151241569-151241591 TAATTTATTTATTTAAGACAGGG + Intronic
982155697 4:152518300-152518322 TTATTTATATATTTGAAACAGGG + Intronic
982381190 4:154750212-154750234 TAGTTTATATCCTTAAAAGAAGG + Exonic
982781619 4:159497107-159497129 GAGTTTCTCTATTTTAAAAATGG + Intergenic
982836622 4:160126769-160126791 GATTTTATGTTTTTGAAACATGG - Intergenic
983270286 4:165552985-165553007 GAGTTTTTATATTAAAATTATGG + Intergenic
983724300 4:170901140-170901162 ATGTATATATATTTTAAACAGGG + Intergenic
984135720 4:175935627-175935649 GAGAAAATATATTTAATACAAGG + Intronic
984163415 4:176281565-176281587 GAGGTCATAGATTTAAAAAATGG + Intergenic
984861015 4:184238541-184238563 GAGTTAATTTATGTAAAGCAAGG + Intergenic
986165181 5:5266833-5266855 GTTTTGATAGATTTAAAACAGGG - Intronic
986532162 5:8749007-8749029 GAATTTTTATATATAAATCAGGG - Intergenic
987855694 5:23417257-23417279 GTATATATATATTTAAAGCACGG + Intergenic
988094218 5:26582217-26582239 GATTTTATACCTTAAAAACATGG - Intergenic
988136530 5:27178743-27178765 GAGTATGTACATTTAAAAAAGGG + Intergenic
988444491 5:31270293-31270315 GAGTCTAACTATTTAATACATGG - Intronic
989227717 5:39049349-39049371 TGTTTTATATATCTAAAACAGGG + Intronic
989263662 5:39447781-39447803 GAGTTTATTTAATTAAAATCAGG - Intronic
990042982 5:51395146-51395168 GAGCTTATATATTTGACATATGG - Intergenic
990626208 5:57614061-57614083 GTGTTTGTATATTTTCAACATGG + Intergenic
990892982 5:60667899-60667921 TATTTTATATATATAAAAAATGG + Intronic
991186138 5:63810398-63810420 GAGTTTATTTCTTTCAAACTAGG + Intergenic
993094273 5:83463825-83463847 GAGTTTTAATAATTAAAACCTGG - Intergenic
993231583 5:85244754-85244776 GAGTTTATATATATTAGAAAGGG + Intergenic
993284813 5:85980222-85980244 GAATTTATATTTTTAATACTAGG - Intergenic
993835650 5:92817308-92817330 GAGTTTTTGTAGTTAAAAGATGG - Intergenic
993978767 5:94516206-94516228 CAGTACATATATTTAAAATATGG - Intronic
994604662 5:101952724-101952746 GTGTTTTTATTTTTAATACAAGG - Intergenic
994765068 5:103905170-103905192 GTGTGTATATATATAAAACATGG - Intergenic
994992508 5:107015207-107015229 GAGTTTGTATATTTTAAGAATGG - Intergenic
995319737 5:110820200-110820222 GATTTTATATATTTAAAGACTGG - Intergenic
995720536 5:115127552-115127574 GAATTTATTTATTTAAGACAGGG - Intronic
996647850 5:125838757-125838779 GAATTTATGTATTTAAAAAGTGG - Intergenic
996676558 5:126181877-126181899 CAGTTTAGATATATAAAATAAGG - Intergenic
997178369 5:131802073-131802095 GAGTGTATATATAAAAAAGAGGG + Intergenic
997954797 5:138270840-138270862 GATTTTATATATTTACCAAAAGG + Intronic
998452089 5:142242580-142242602 TAATTTATATATTAAAAAAAAGG - Intergenic
998946763 5:147348339-147348361 GAGATTACATTTTTAAAAGAGGG - Intronic
999360150 5:150977480-150977502 GAATTTATATGTTTAATACGAGG - Intergenic
999602481 5:153282528-153282550 GAATTTATATTTTAAAAAAAGGG + Intergenic
999852363 5:155556086-155556108 GATTTATTATATTTAAAATACGG + Intergenic
1000150274 5:158493617-158493639 GAGTTTCTATTTTCAAATCATGG - Intergenic
1000359639 5:160435033-160435055 GAGTTAATCAAGTTAAAACAGGG - Intergenic
1000598930 5:163248719-163248741 GAGGTTTAATATTTAAAACCTGG - Intergenic
1001040502 5:168331261-168331283 TAGTTTATATGTTTAAAGAATGG + Intronic
1001093365 5:168757739-168757761 CTGGTTATATATTTAAAACAGGG - Intronic
1001368503 5:171169912-171169934 GCGTTTATATATTTCAAAATAGG + Intronic
1002235802 5:177802044-177802066 GCTTTTATTTATTTAAAACTGGG + Intergenic
1002496115 5:179612757-179612779 GAGTCTTCATATTAAAAACAAGG - Intergenic
1004246916 6:13987099-13987121 GGGTTTAATCATTTAAAACAAGG - Intergenic
1004668739 6:17775091-17775113 TGGTTTATATATTTAATATAAGG + Intronic
1004924888 6:20406555-20406577 GCTTTTAAATATATAAAACATGG + Intronic
1005004461 6:21273937-21273959 GTGTTTATGTGTTTAAGACAGGG + Intergenic
1005151627 6:22758073-22758095 GAATTTATTTATTTAAAGTAAGG - Intergenic
1005179074 6:23083174-23083196 GAGTGTTTATATTTAAATCAGGG + Intergenic
1005314563 6:24592189-24592211 GAGTTAATTTTTTTAAAATAAGG + Intronic
1005344549 6:24876368-24876390 GAATTTTTTTTTTTAAAACAAGG + Intronic
1005605663 6:27474331-27474353 AGGTTTTTATATTTAAGACATGG + Intergenic
1005878793 6:30038001-30038023 GAGTTTTAACATTTAAAACCTGG + Intergenic
1006110494 6:31741680-31741702 GAGTTAATGTAAGTAAAACATGG - Intronic
1007542302 6:42659189-42659211 GAATGTATATATTTAACACATGG - Intronic
1008246294 6:49178212-49178234 TAATTTATATATATAAAAAAAGG + Intergenic
1008378335 6:50816698-50816720 GAGTTTATTTATTTTAGACTAGG + Intergenic
1008923848 6:56870870-56870892 TATTTTATATATTTAAATAAAGG + Intronic
1009293288 6:61911202-61911224 AAATTTATATATTCAAGACAGGG + Intronic
1009692036 6:67047814-67047836 GAGTTCATATATTATAAACATGG + Intergenic
1010226620 6:73495367-73495389 GTGATTATATATTTTAAACTTGG + Intronic
1010672944 6:78708470-78708492 TAGTTTATATTTTTAATACTTGG - Intergenic
1011275104 6:85623251-85623273 GAGTTTATATATTGTCAACATGG - Intronic
1012119114 6:95341014-95341036 GAGTTTCCATTTTTAAAATATGG - Intergenic
1012181438 6:96158215-96158237 ATTTTTATATTTTTAAAACAAGG + Intronic
1012630904 6:101465769-101465791 GATGTTATTTATTTAAATCAAGG + Intronic
1012709149 6:102576277-102576299 GAGTTTATATATTTTCATCATGG + Intergenic
1013810301 6:114037657-114037679 GACCTTACATATTTAATACAAGG - Intergenic
1014134747 6:117875723-117875745 GAGTTAGTACATTAAAAACAGGG - Intergenic
1014389069 6:120838291-120838313 GATTGAATAGATTTAAAACATGG - Intergenic
1014439507 6:121458010-121458032 GAGTTTTAATAAGTAAAACAAGG + Intergenic
1014682582 6:124450840-124450862 GAGTTCAAATTTTTAAAAAAAGG - Intronic
1014854231 6:126379955-126379977 GAATTTAAATATTTCAATCAAGG + Intergenic
1014884763 6:126766328-126766350 GAGCTTATATTTTTAAAGCCAGG - Intergenic
1015492801 6:133846857-133846879 GTCTTTGTATATTTAAAAGATGG - Intergenic
1015571003 6:134621475-134621497 GACTTTATATCTTTAAAGAATGG - Intergenic
1016998982 6:149982463-149982485 GAGTTTATTTTTTTAGAGCAGGG - Intergenic
1017008539 6:150045807-150045829 GAGTGTATATTTTTAGAGCAGGG + Intergenic
1018080104 6:160252115-160252137 GAGGTTGTATATTTACAGCAGGG - Intronic
1018186835 6:161272992-161273014 AAGCTTAAATATTTAAAAGATGG - Intronic
1018489949 6:164281861-164281883 GAATTTTTATATTTAAAAAAAGG - Intergenic
1018897226 6:168028207-168028229 AAATTTATTTATTTAAAAAAAGG + Intronic
1019073340 6:169367595-169367617 GAGTTGATTAAGTTAAAACAAGG + Intergenic
1020474623 7:8581184-8581206 AAGTATATATTTTTAAAAAAAGG - Intronic
1021054538 7:16030849-16030871 GATATTATGTATCTAAAACAAGG + Intergenic
1021094355 7:16518500-16518522 CAGTCTATGTATTCAAAACAGGG + Intronic
1021928821 7:25559301-25559323 TATTTTATACATTAAAAACATGG - Intergenic
1022059503 7:26777670-26777692 CTGTTTATGTATGTAAAACAAGG - Intronic
1022770150 7:33462208-33462230 TATTTTATATGTTTAACACAAGG - Intronic
1023468645 7:40488765-40488787 GAGATGATATATTTAACACATGG - Intronic
1023715069 7:43035650-43035672 ATGTTCATATATTTAAAAAATGG - Intergenic
1024589511 7:50868825-50868847 GAGTTGATTTATTTAAAGCTTGG - Intergenic
1026180895 7:68039889-68039911 GAGATTATTTATTTCAAAAAAGG + Intergenic
1026382956 7:69817704-69817726 GAGTTATGATATTTAAACCATGG + Intronic
1026571068 7:71531607-71531629 GAGATTATATTTTTGAGACAGGG + Intronic
1027486495 7:78768277-78768299 GAGGTGATATAATGAAAACATGG - Intronic
1027658050 7:80956035-80956057 TAGTTTACATTTTTAAAACATGG - Intergenic
1027715676 7:81666578-81666600 GAGTGTACATAATTAAAACATGG + Intergenic
1027872360 7:83723602-83723624 GAGATTAAATATTTAATACATGG - Intergenic
1027969829 7:85064772-85064794 GAGTTTATTTAATTAATCCAAGG - Intronic
1028343732 7:89754727-89754749 AAGTATATATATTTTAAACTTGG + Intergenic
1028533859 7:91869298-91869320 GGGTTTATTTATTTAAATCAGGG - Intronic
1029869121 7:103670015-103670037 TAATTTATATTTTTAAAATAAGG + Intronic
1029912218 7:104165340-104165362 AACGTTATTTATTTAAAACATGG + Intronic
1030349779 7:108471001-108471023 TAGTTTGTATGTCTAAAACAAGG + Intronic
1030528316 7:110680248-110680270 GATCTTATATATGAAAAACACGG - Intronic
1030717961 7:112832919-112832941 AAGTAAATATATATAAAACAAGG - Intronic
1030928417 7:115487517-115487539 AAGTTTATTTATTTAAAAAAAGG - Intergenic
1031059329 7:117032398-117032420 GAGTTTTTATATTCAAAAACAGG + Intronic
1031153461 7:118081561-118081583 GAGATTATATCTTATAAACACGG - Intergenic
1031657525 7:124376539-124376561 GCTTTTATATATCTAAAAGAGGG + Intergenic
1031768998 7:125818739-125818761 ATGTTAATATATATAAAACATGG - Intergenic
1032103582 7:129004721-129004743 AATTTTATATTTTTAAAACAAGG + Intronic
1032287113 7:130547505-130547527 GAATATATATATTTATAAAATGG - Intronic
1033561575 7:142536929-142536951 TAATTTATATATTGAAAACTTGG - Intergenic
1033638222 7:143233285-143233307 GACTCTAAATATTTAACACATGG + Intergenic
1033774913 7:144598610-144598632 CATTTTATATATTTAAAATACGG - Intronic
1033803126 7:144924365-144924387 GAGTATATATCTTATAAACAGGG - Intergenic
1035540684 8:434717-434739 GATTTTAAATATTTCAAATATGG + Intronic
1037330299 8:17737317-17737339 GAGATTATGCATTTAAAAGAGGG + Intronic
1037860611 8:22402822-22402844 GAGAATATAAATTTAAAACTTGG - Intronic
1038202053 8:25421988-25422010 GAGTTTATAGTTGTAAAAAAAGG + Intronic
1038719439 8:30020542-30020564 AAATTTATATACTTAAAAAATGG - Intergenic
1039956835 8:42214302-42214324 GAGTTTGCACATTTAAAATAAGG - Intergenic
1040036759 8:42877608-42877630 GAGTTTTTATATTTTTAATATGG - Intronic
1040048351 8:42986370-42986392 TAGTTTAAATATTTAAATCAGGG + Intronic
1040449736 8:47532420-47532442 GTGTTTTTATATTTAAAATGAGG - Intronic
1040713904 8:50224245-50224267 TGTTTTAAATATTTAAAACAAGG + Intronic
1041385367 8:57296785-57296807 TTGTTTTTATTTTTAAAACAGGG + Intergenic
1041837878 8:62237524-62237546 AAGTATATATATATAAAAAAAGG - Intergenic
1041920081 8:63172089-63172111 GAGTTCTGATATTTAACACAGGG - Intronic
1042053981 8:64743164-64743186 TAGTTTAAATATTAAAAAAATGG - Intronic
1042067700 8:64897234-64897256 AAGTTTATATACTTTAAATAGGG + Intergenic
1042303104 8:67307242-67307264 GAGTTTATTCATTTAAAAGGAGG - Intronic
1042579372 8:70259650-70259672 AGTTTTATATATTTAAATCATGG - Intronic
1043264866 8:78252822-78252844 AATTTTATATATTTAACACAAGG - Intergenic
1043283948 8:78505653-78505675 GAGTTTATAATTTTAAAATGTGG + Intergenic
1043287233 8:78548345-78548367 GAGTTTATTTAATTAACATATGG - Intronic
1043852293 8:85228854-85228876 GAGTACATATATTTCAAATAAGG - Intronic
1043919508 8:85965171-85965193 GAGTTTATATATTTATCCCGGGG + Intergenic
1044062697 8:87658677-87658699 GACTTTATATATTTCCAACCTGG - Intergenic
1044711894 8:95066470-95066492 GAGTTTTTATTTTTAATAAAAGG - Intronic
1044718752 8:95125307-95125329 AAGTTTATATATTTCTAAAAGGG - Intergenic
1044979209 8:97698357-97698379 GAATTTATATCTATAAAGCAAGG + Intronic
1045130985 8:99152121-99152143 GAGTTCATATATTACAAAAAAGG - Intronic
1045203864 8:100016275-100016297 TAGTTTATTTATTTTTAACAGGG - Intronic
1046021276 8:108668237-108668259 GAGGTTATATTTCTAAAAGAGGG - Intronic
1046193327 8:110828132-110828154 GAACATATATATTTAAAATAAGG + Intergenic
1046713984 8:117547230-117547252 GAGTTACTACATTTAGAACAGGG - Intergenic
1047658927 8:127011214-127011236 GAGCTTTTATATTTAAAATTTGG + Intergenic
1047707789 8:127518026-127518048 GTGTTTATATATATAAAATGGGG + Intergenic
1047734727 8:127755184-127755206 ACGTATATATATTTAAGACAAGG - Intergenic
1047927614 8:129696903-129696925 CACTTTATTTATTTAACACATGG - Intergenic
1048701749 8:137099031-137099053 GAGTTTGTAAAATTAAAAGAAGG + Intergenic
1050447096 9:5736096-5736118 TACTTCTTATATTTAAAACATGG + Intronic
1050710725 9:8459762-8459784 GAGATTATATTTTTTAAAAAAGG + Intronic
1050828016 9:9973943-9973965 GATTTGATATTTTTAAAAGAGGG + Intronic
1051401683 9:16690531-16690553 GTATTTATTTATTTGAAACAGGG - Intronic
1052223962 9:26061479-26061501 GAATATATTTATTTAAAAAAAGG - Intergenic
1053228527 9:36384432-36384454 AAGTTTATGTAATGAAAACAAGG + Intronic
1054752781 9:68925583-68925605 GGGTTAATATCTTTAATACATGG - Intronic
1054803046 9:69371354-69371376 AAGTTTGTACATTGAAAACACGG + Intronic
1055034630 9:71805259-71805281 GAGTGTGTCTATTTAATACAAGG + Intronic
1055341686 9:75291143-75291165 TAGTTTACATATTAAAAGCATGG + Intergenic
1055823633 9:80298210-80298232 GAGTTTTTAAATTCAAATCAGGG + Intergenic
1056159403 9:83873418-83873440 GTGTTTAGATTTTTAGAACAAGG + Intronic
1056351166 9:85750505-85750527 GTGTTTACATTTTTAGAACAAGG - Intergenic
1056877295 9:90346147-90346169 GAGTTTATATTTTTAAAGATGGG - Intergenic
1056895236 9:90540491-90540513 AAATTGATATATTTAAAATACGG - Intergenic
1057746380 9:97755387-97755409 AATTTTTAATATTTAAAACAAGG + Intergenic
1058304684 9:103423842-103423864 GATGTTATATATTTTAAATATGG - Intergenic
1058332511 9:103781024-103781046 ATTTTTATATATTTAATACATGG + Intergenic
1059086912 9:111313498-111313520 GAGTGTTTATAATTAAAAAATGG - Intergenic
1059333304 9:113550448-113550470 AAGGTTATATATTTATAAAATGG + Intronic
1187065983 X:15838391-15838413 GAATTTTTATTTTTAAAAAAAGG + Intronic
1187092957 X:16116793-16116815 GATTTTATATATGAAAAAAATGG + Intergenic
1187685416 X:21811040-21811062 GAGTATACATTTTGAAAACAAGG - Intergenic
1188776893 X:34231037-34231059 CAATTAATATTTTTAAAACATGG - Intergenic
1189517143 X:41725025-41725047 GGTTTTATATATTTATACCAGGG + Intronic
1190703156 X:53003233-53003255 GTGTGTATATATTTTAACCAAGG - Intergenic
1190859242 X:54328051-54328073 TAGTTTATATATTTTAATAATGG + Intronic
1192078163 X:68021377-68021399 CAGTTTATTTACTTAAAAAATGG - Intergenic
1192625640 X:72725058-72725080 AAGTGTACATATTAAAAACAAGG - Intergenic
1192639764 X:72850577-72850599 CTGTTCATAGATTTAAAACATGG + Intergenic
1192641947 X:72870228-72870250 CTGTTCATAGATTTAAAACATGG - Intergenic
1192938803 X:75891275-75891297 GAGTATATATTTTTTAAAAAAGG + Intergenic
1193339192 X:80325904-80325926 GGTTTTATATATATAAAATAAGG - Intergenic
1193339193 X:80325925-80325947 GGTTTTATATATATAAAATAAGG - Intergenic
1193756158 X:85411032-85411054 GGGTATATATTTTTAAAAAATGG - Intergenic
1194843356 X:98773059-98773081 AAGTTTTTGTATTTAAAACAAGG + Intergenic
1195067585 X:101251664-101251686 GAGTTTATATAATTTAATAATGG + Intronic
1195207241 X:102614146-102614168 GAGTTCAAATTTTCAAAACAGGG - Intergenic
1196428208 X:115593892-115593914 GAGTTTATACTTTTTAAAAATGG + Intronic
1196555097 X:117076672-117076694 GAGTTTAAATATTTAGGATATGG - Intergenic
1197401754 X:126001142-126001164 AAGTTTATATATTTATAAAATGG + Intergenic
1197690152 X:129490826-129490848 GTGTTTTTATATTTAGTACAAGG - Intronic
1198562876 X:137870424-137870446 CATTTTATATATTTTAAATACGG + Intergenic
1198731239 X:139731811-139731833 GTGATTATATATTTAAAAAAAGG + Intronic
1199426403 X:147706173-147706195 GCATTTATATATTTAAAATATGG - Intergenic
1201055229 Y:9982185-9982207 TAATTTATATTTTTAAAAAAGGG + Intergenic
1201594403 Y:15651794-15651816 TAGTTTATATATTTATAATTAGG + Intergenic
1201736554 Y:17269303-17269325 GAGTTGGTATGTTAAAAACAGGG - Intergenic