ID: 1143049539

View in Genome Browser
Species Human (GRCh38)
Location 17:4112926-4112948
Sequence CAGCAACTAACTTGAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143049535_1143049539 23 Left 1143049535 17:4112880-4112902 CCTCAAAGAGCTTACATTTGATA 0: 1
1: 0
2: 4
3: 47
4: 438
Right 1143049539 17:4112926-4112948 CAGCAACTAACTTGAAATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 133
1143049534_1143049539 26 Left 1143049534 17:4112877-4112899 CCACCTCAAAGAGCTTACATTTG 0: 1
1: 0
2: 3
3: 31
4: 190
Right 1143049539 17:4112926-4112948 CAGCAACTAACTTGAAATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 133
1143049533_1143049539 27 Left 1143049533 17:4112876-4112898 CCCACCTCAAAGAGCTTACATTT 0: 1
1: 1
2: 6
3: 62
4: 417
Right 1143049539 17:4112926-4112948 CAGCAACTAACTTGAAATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 133
1143049537_1143049539 -3 Left 1143049537 17:4112906-4112928 CCAAAGACTGGTTTTCCTAACAG 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1143049539 17:4112926-4112948 CAGCAACTAACTTGAAATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143049539 Original CRISPR CAGCAACTAACTTGAAATGC TGG Intronic
904365524 1:30008607-30008629 CAGAACCTAAATTCAAATGCTGG + Intergenic
905923532 1:41734225-41734247 CAGCAACTCAATTCAGATGCAGG - Intronic
909269981 1:73610654-73610676 CAGAAAGAAACTTGAAATGGAGG + Intergenic
913027984 1:114865102-114865124 CAGCAAAGAACTTAAAATTCTGG - Intronic
913077612 1:115354212-115354234 CAGCAAGTAACCTGCAAGGCGGG - Intergenic
916398957 1:164424687-164424709 CAGCAATTAACTTAAAACTCTGG + Intergenic
917123891 1:171668778-171668800 CAGCATCAAACTTGAACTCCTGG - Intergenic
919238523 1:194879138-194879160 CAGAAACTAAATTAAAATGTAGG - Intergenic
1069542735 10:69307575-69307597 CAGCAACTGAATGGAAAAGCTGG - Intronic
1071695592 10:87865573-87865595 CAGCTAATATCTAGAAATGCTGG + Intronic
1073679618 10:105688393-105688415 AGGCAAATAACTTGAAATGATGG + Intergenic
1075219374 10:120571412-120571434 CAGACACTCACTTGGAATGCAGG + Intronic
1075917588 10:126182634-126182656 CAGCAACTTACATGAAATCTGGG - Intronic
1078374101 11:10778295-10778317 CAGCAACAAAGGTGAAATCCAGG - Intronic
1079191736 11:18283395-18283417 CAGCTACTAATTGTAAATGCTGG - Intronic
1082590963 11:55009044-55009066 CAGAAACTACCTTGAGATTCGGG - Intergenic
1085577133 11:77616254-77616276 CAGAAACTAACCTAAAAGGCTGG + Exonic
1088236187 11:107726005-107726027 CAGCAGCTAACTTAGAATGTAGG - Intergenic
1089686582 11:120152558-120152580 CAACAATTAACTTGAAATAGTGG - Intronic
1092664067 12:10774530-10774552 CAGTAACTAATTTCCAATGCAGG - Intergenic
1094429464 12:30351293-30351315 AAGCAAATAACTTGTAATGAGGG + Intergenic
1095756066 12:45768553-45768575 AAGCAACTAACTTCATTTGCTGG + Intronic
1095886734 12:47196266-47196288 GAGCAACTAGCTTCAAATCCTGG + Intronic
1096656585 12:53096410-53096432 CAGTGACTAAGTTTAAATGCTGG - Intergenic
1099556345 12:84112519-84112541 AAGTAACCAACTTGATATGCTGG + Intergenic
1101344226 12:103870756-103870778 TTGCAACTATCTTGAACTGCTGG + Intergenic
1102446984 12:113010665-113010687 CAGCAACTATTTTTAAAGGCAGG - Exonic
1108572554 13:51765680-51765702 AAGCAACTCACTTGATATGATGG - Exonic
1110990190 13:82031658-82031680 CATCAAATAACTAGAAAAGCTGG - Intergenic
1112639242 13:101254543-101254565 TAAAAACTAACTTGAAATCCTGG - Intronic
1114557854 14:23571956-23571978 CAGGGACTAACTTGAAGTGGGGG - Intronic
1118978664 14:70698957-70698979 GAGCAATCAAATTGAAATGCAGG - Intergenic
1121206970 14:92177623-92177645 CAGCAACTAAATGGAAACACTGG - Intergenic
1123574086 15:21648356-21648378 CAGCAACTCATTTCAAAGGCAGG + Intergenic
1123610702 15:22090941-22090963 CAGCAACTCATTTCAAAGGCAGG + Intergenic
1123705914 15:22951163-22951185 CAGGAACTGACTGGAAATGAGGG + Intronic
1125408833 15:39383566-39383588 GAGCAAGTCACGTGAAATGCAGG - Intergenic
1126521821 15:49604387-49604409 CAGCAGATACCTTGAAATCCAGG - Intronic
1202982951 15_KI270727v1_random:382702-382724 CAGCAACTCATTTCAAAGGCAGG + Intergenic
1135241352 16:20809202-20809224 CAGCAACTACTTTCAAATGTTGG - Intronic
1135245508 16:20853412-20853434 CAGCAACTGATTTGAAAGGAGGG + Intronic
1135263444 16:21000825-21000847 CAGCAAGTAAGTGAAAATGCAGG + Intronic
1143049539 17:4112926-4112948 CAGCAACTAACTTGAAATGCTGG + Intronic
1143396253 17:6600315-6600337 CAGCAACTCATTTTAAATCCAGG + Intronic
1144160704 17:12554843-12554865 CAGGGAGTGACTTGAAATGCTGG + Intergenic
1149341625 17:55692589-55692611 CAGCAACTTAGTGGAAATCCAGG - Intergenic
1149794498 17:59506815-59506837 CAGAAACTTATTTCAAATGCAGG - Intergenic
1150385715 17:64757994-64758016 CAGCTAGTAGCTAGAAATGCAGG + Intergenic
1150770595 17:68037721-68037743 CAGCTAGTAGCTAGAAATGCAGG - Intronic
1151029356 17:70718346-70718368 CAGAAACAAACTTGATATGGTGG - Intergenic
1159551937 18:69904342-69904364 CAGCAAAGGACTTGCAATGCAGG + Intronic
1160083157 18:75749995-75750017 CAGCAAATAACCTGAAATATTGG - Intergenic
1160242630 18:77133821-77133843 TAGCAACTGTCTTCAAATGCTGG + Intergenic
1162058429 19:8079970-8079992 CAGCAACAAACATAAAAGGCAGG - Intronic
1162191067 19:8947387-8947409 CAGCACCTCAGTTGAAATACCGG - Exonic
1162191770 19:8952655-8952677 CAGCACCTCAGTTGAAATACTGG - Exonic
1162192019 19:8954392-8954414 CAGCACCTCAGTTGAAATACTGG - Exonic
1164559591 19:29280423-29280445 CAGCAACTCACATGAACTGGAGG - Intergenic
925855640 2:8126551-8126573 CAGCAAGTAACTGGAAGTACAGG - Intergenic
926802635 2:16672713-16672735 CAGCCAATAACTTAAAATACAGG + Intergenic
927915515 2:26933669-26933691 TGGCAACTAACATAAAATGCTGG + Intronic
930818196 2:55620128-55620150 CTGTCACTAACTTGAAATTCAGG + Intergenic
931097637 2:58959696-58959718 CAGAAATTTACTTGAAATGTAGG + Intergenic
931302517 2:60994437-60994459 CAGCACCTATCTTAAAATTCAGG - Intronic
931879542 2:66554019-66554041 CAGCAACTGCCTTTGAATGCTGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940717623 2:157245727-157245749 CAGCAACGAAGTTGAGATCCTGG + Intergenic
944921463 2:204418026-204418048 CAGCGTCTACCTTGACATGCAGG - Intergenic
945185025 2:207131619-207131641 CAGAAACCAACTTGAAAATCTGG + Intronic
945660724 2:212682108-212682130 ATGCAACTAACTGGAAATACAGG + Intergenic
947362547 2:229360966-229360988 CAGCTAGTAAGTTGAAATGCAGG - Intronic
948236619 2:236395542-236395564 GAGCAATTCACTTCAAATGCAGG - Intronic
1173002723 20:39116271-39116293 CAGCTCCTAACTGGAAATCCTGG - Intergenic
1173026207 20:39309791-39309813 CAGGAACTCATTAGAAATGCAGG - Intergenic
1184627482 22:45747937-45747959 CACCAAGTAACTGGAAATACCGG - Intronic
1185326243 22:50227177-50227199 GGGCAACTAACTTTAGATGCAGG + Intronic
949693942 3:6672348-6672370 CAGAAGCTGACTTTAAATGCAGG + Intergenic
950515573 3:13462835-13462857 CAGCAAGTAACTGGTAATGTGGG + Intergenic
952163614 3:30721612-30721634 CTGCAACCAAATTAAAATGCTGG - Intergenic
954824461 3:53360350-53360372 CAGTAAATTACTTTAAATGCAGG - Intergenic
956659770 3:71585305-71585327 CAGCCAGTAGCTGGAAATGCTGG - Intergenic
959550910 3:107656128-107656150 AAACCACTAACTTGAAATGAAGG - Intronic
960212139 3:114982428-114982450 CAGCAACCAATTTGTAATGCAGG + Intronic
963901020 3:150733642-150733664 CACCCACAAACTTGTAATGCAGG - Intergenic
964181806 3:153897070-153897092 CAGGAACTAACTTAAAATTCAGG - Intergenic
964442752 3:156728838-156728860 CAGCAAATAATTTGAGATGGTGG + Intergenic
965312526 3:167148559-167148581 CAGTAACTATCTGGAAATGAAGG - Intergenic
966390402 3:179447212-179447234 CAGAAACTAACCTGACATGCTGG + Intronic
969911333 4:10449342-10449364 CAGCCAGTAATTTGGAATGCTGG - Intronic
974663923 4:64933460-64933482 CAGCAACTAACTGGATAAGCTGG + Intergenic
978173811 4:105705958-105705980 CAGCAAATAACTGTAAATGTTGG + Intronic
979287982 4:118948447-118948469 CACCAAATAAAATGAAATGCTGG - Intronic
979780676 4:124647878-124647900 AAGCAACTAACTGGAAAGGTAGG + Intergenic
982407552 4:155036859-155036881 CAGCAGCTACCTTGTAGTGCAGG + Intergenic
984382177 4:179008644-179008666 CAGGAACTAAATTGCAATTCAGG + Intergenic
984765387 4:183396876-183396898 CAGCCACTATCTGGAAGTGCCGG + Intergenic
984860820 4:184236350-184236372 CAGCAGATAGCTTGAAGTGCTGG + Intergenic
988118515 5:26927927-26927949 CAGCCACTAACTTGAGGAGCAGG - Intronic
988665806 5:33326202-33326224 CAGCAACAACCTTGTAAAGCAGG + Intergenic
990072983 5:51807697-51807719 CAGGATCTAACTTCAAATTCTGG + Intergenic
993799047 5:92306896-92306918 CTGCAAATATTTTGAAATGCTGG - Intergenic
997150976 5:131494884-131494906 TAGCAACTGACTGGAAATCCTGG + Intronic
1000777612 5:165440013-165440035 CAGGAAGTACCTCGAAATGCTGG + Intergenic
1004171393 6:13298112-13298134 CAGCAGCTATCTTGGAATGTGGG - Intronic
1006559589 6:34898674-34898696 CAGAAATTAACTTGAAATTTTGG + Intronic
1008187777 6:48415406-48415428 CAGCAAGAAATTTGAAATGCAGG - Intergenic
1008558432 6:52698468-52698490 CAACAACTTACTTGAAATATTGG - Intergenic
1011346883 6:86379986-86380008 CAAAAATTAACTTTAAATGCTGG - Intergenic
1012033340 6:94100839-94100861 TACCAACTGACTTGAAAAGCTGG + Intergenic
1014012884 6:116496817-116496839 CAGCCAGAAATTTGAAATGCAGG - Exonic
1015963865 6:138678099-138678121 CAGCAATTCCCTTGAAATGCAGG + Intronic
1017364423 6:153617499-153617521 AAGCAAATAACTAGAAAAGCAGG - Intergenic
1021151548 7:17157373-17157395 CAGCAACTAATTTGTAATGATGG - Intergenic
1023527155 7:41116830-41116852 CCACAACTAACTTGTAATGCTGG + Intergenic
1023683866 7:42715601-42715623 TAGCAACTATCTTGACATTCTGG - Intergenic
1027368063 7:77479092-77479114 CAGCATATAGCTAGAAATGCTGG - Intergenic
1030928600 7:115491989-115492011 AACAAATTAACTTGAAATGCTGG - Intergenic
1033066602 7:138161294-138161316 CAGCAACTAACTCAAAATGCTGG - Intergenic
1037258797 8:16984292-16984314 CAGCAAATAACTCAGAATGCTGG + Intergenic
1038833241 8:31086634-31086656 CAGATACTAACTGGAAAAGCTGG - Intronic
1040694567 8:49980021-49980043 CAGCAGCTTCTTTGAAATGCAGG + Intronic
1042985943 8:74583041-74583063 CAGTAACCAAGTTGAAGTGCAGG + Intergenic
1045010115 8:97951471-97951493 CCGGAACTTACTAGAAATGCAGG + Intronic
1045032630 8:98152038-98152060 CAGCAAATAGTTTGAAACGCAGG - Intronic
1045992396 8:108324355-108324377 CAAGATCTAACTTGAAATCCAGG + Intronic
1047596386 8:126381858-126381880 CAGCCACTAACTTGAGAGGAGGG - Intergenic
1047603912 8:126455356-126455378 CAGCACCTAAATTGACATGAGGG - Intergenic
1048100883 8:131350333-131350355 CAGCAGGTAACTAGCAATGCTGG + Intergenic
1051807811 9:21015523-21015545 CAGAAACTAACTGTAAATTCTGG + Intronic
1055173422 9:73288729-73288751 TATCAAATAACTTGAAATTCAGG + Intergenic
1055355152 9:75429858-75429880 CAGCAGCTGACTTGGGATGCTGG + Intergenic
1055770631 9:79713530-79713552 CAACAAATAACTAGAAATACAGG - Intronic
1056749875 9:89340870-89340892 CAGCAAATAATATTAAATGCAGG - Intronic
1058774618 9:108271490-108271512 CAGCAGAGAACTTGAAGTGCTGG - Intergenic
1060778744 9:126396058-126396080 CAGCAACTCATTTGAAACCCAGG + Intronic
1186587214 X:10888156-10888178 AAGAAACTAAATTGCAATGCAGG - Intergenic
1186774278 X:12848534-12848556 CAGCATATAACTAGAAATACAGG + Intergenic
1187572002 X:20514339-20514361 CAGCAGCTAATTTGAAATTGAGG + Intergenic
1188486432 X:30687180-30687202 CAACCACTAAATTGAAATGATGG - Intronic
1192246279 X:69374447-69374469 AAGCAGCTAACTAGAAATTCTGG + Intergenic
1193151759 X:78132503-78132525 AAGCAACTAACGTAAAATACTGG - Intronic
1195947297 X:110228848-110228870 CAGCAGCTAAGTAGAAATGATGG - Intronic
1197414431 X:126157307-126157329 CAGAAACTAATTTGAAAAACCGG - Intergenic
1199966004 X:152821554-152821576 TAGCAACTAACTTTATATGAAGG + Intergenic