ID: 1143050118

View in Genome Browser
Species Human (GRCh38)
Location 17:4118377-4118399
Sequence AGTTATCTGCAAAAGATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 2, 2: 28, 3: 241, 4: 353}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143050112_1143050118 27 Left 1143050112 17:4118327-4118349 CCAATGTTCAGTTTCTACCAAGG 0: 1
1: 1
2: 5
3: 5
4: 135
Right 1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG 0: 1
1: 2
2: 28
3: 241
4: 353
1143050116_1143050118 4 Left 1143050116 17:4118350-4118372 CCCGGAGCTGTCTCTCAAAAGAA 0: 1
1: 23
2: 207
3: 260
4: 430
Right 1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG 0: 1
1: 2
2: 28
3: 241
4: 353
1143050115_1143050118 10 Left 1143050115 17:4118344-4118366 CCAAGGCCCGGAGCTGTCTCTCA 0: 1
1: 0
2: 1
3: 24
4: 339
Right 1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG 0: 1
1: 2
2: 28
3: 241
4: 353
1143050117_1143050118 3 Left 1143050117 17:4118351-4118373 CCGGAGCTGTCTCTCAAAAGAAG 0: 2
1: 1
2: 3
3: 18
4: 261
Right 1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG 0: 1
1: 2
2: 28
3: 241
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143050118 Original CRISPR AGTTATCTGCAAAAGATAGT AGG Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901153575 1:7120923-7120945 AGTTATCTTTCAAAGAGAGTCGG + Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906760935 1:48377885-48377907 AGTTATTGGCAATAGAAAGTAGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG + Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912067769 1:105766515-105766537 AGTTATCAGCAAGAGTTATTAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
915632811 1:157164880-157164902 AGTTATCAGCCAGAGATACTTGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920666900 1:207969644-207969666 ACTTTTCTGCCAAAGCTAGTGGG - Intergenic
921122972 1:212152782-212152804 TGTTATCCTAAAAAGATAGTGGG - Intergenic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063497292 10:6521748-6521770 AGTGCTCTGCAAGAGATAGATGG - Intronic
1063648087 10:7905966-7905988 AGTTATATTCAAAAGTTTGTTGG + Intronic
1063835929 10:10012009-10012031 AGTTATCTGAAAATGACACTGGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068232924 10:54194540-54194562 AACTATATGTAAAAGATAGTTGG - Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068530218 10:58177289-58177311 ATTTATCTGCTAAACATACTGGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG + Intergenic
1074890531 10:117732446-117732468 AGGTAGCTGCAAAAGGCAGTGGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080910196 11:36589118-36589140 TGTAAGCTGTAAAAGATAGTGGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081282456 11:41226445-41226467 ATTTATCTGTAAAAGGTAGATGG - Intronic
1081429308 11:42958081-42958103 AGATTTATGCAAAAGATATTGGG + Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085008921 11:73122092-73122114 AGTTATCTGTTTAGGATAGTGGG + Intronic
1085269832 11:75263667-75263689 AGTCATCAGCAAAGGATGGTAGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086162306 11:83735517-83735539 AATTATCTGCAACAAATAGAAGG - Intronic
1086990192 11:93294513-93294535 AGTTATGTGCAATAAATAATTGG - Intergenic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090800550 11:130168890-130168912 AGGGATCTGCAGAAGCTAGTGGG - Intronic
1090866079 11:130702026-130702048 AGGTATCTGCAACTGATTGTAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099328810 12:81254840-81254862 AGTTATCTGGAAAAAAAATTAGG - Exonic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100244825 12:92746684-92746706 AGTTATTTGAAAACAATAGTTGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101342040 12:103850793-103850815 AGATAACTGCAAAAGATTGAGGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103160751 12:118727248-118727270 AAATATCAGCAAAAGATATTTGG + Intergenic
1104201191 12:126591027-126591049 AGTTATCTGCAAAGTATTATAGG + Intergenic
1104545282 12:129705975-129705997 AGTTATCAGAAAAGTATAGTTGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106634204 13:31509590-31509612 TGTTATCTGCAAAAGATGCTTGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110104372 13:71652683-71652705 AGATATCTGCAAAATTTAGAAGG - Intronic
1110821070 13:79916910-79916932 AGTAATGAGCAAAAGATCGTTGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112674020 13:101677174-101677196 AGTTATCTGAAACATATTGTCGG + Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114033638 14:18598911-18598933 ATTTATCTGCAAAAGAGAGTAGG + Intergenic
1114078429 14:19178091-19178113 ATTTATCTGCAAAAGAGAGTAGG + Intergenic
1114125061 14:19716438-19716460 ATTTATCTGCAAAAGAGAGTAGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115143396 14:30199360-30199382 AGTTATCTCCAGAAGATAACAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116631534 14:47341748-47341770 AGCTATTTGCAAAAGACAGAGGG + Intronic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118473959 14:66100057-66100079 ATTTGACTTCAAAAGATAGTAGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1122259463 14:100504348-100504370 AGTTATAAGAAAAAGAAAGTAGG - Intronic
1122734110 14:103825642-103825664 AGGAAGCTGCAAAAGAAAGTTGG + Intronic
1123568481 15:21577375-21577397 ATTTATCTGTAAAAGAGAGTAGG - Intergenic
1123604590 15:22012699-22012721 ATTTATCTGTAAAAGAGAGTAGG - Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126881318 15:53101204-53101226 AGGACTGTGCAAAAGATAGTGGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128702378 15:69813848-69813870 TGTTATCTGCAAAATATGGGGGG + Intergenic
1130986476 15:88847894-88847916 GGGTATCTGCAAAGGAGAGTGGG - Exonic
1131294040 15:91131494-91131516 AGTAATGGGCAAAAGAAAGTGGG + Intronic
1131645003 15:94331958-94331980 CCTTATCTGCAAAAGAAAGATGG + Intronic
1131714069 15:95089576-95089598 AGTTGTGTGAAAATGATAGTAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202976837 15_KI270727v1_random:304462-304484 ATTTATCTGTAAAAGAGAGTAGG - Intergenic
1134317944 16:13136943-13136965 AGGTTTCTGCAAAAGCTTGTAGG + Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138833055 16:60399253-60399275 AGCTATGTGCAAAAAATAGCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1138990356 16:62383604-62383626 AGTAATATGAAAAAGATACTTGG + Intergenic
1140956267 16:79869338-79869360 AGTTTCCTGCATTAGATAGTGGG + Intergenic
1141318599 16:82985501-82985523 ATTTATCTGCAAGAGAAAGGAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148792256 17:50180046-50180068 TTTTCTCTGCAAAAGACAGTGGG - Intergenic
1150766531 17:68006731-68006753 AGTCATATGAAAAAGATACTTGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155386837 18:25286910-25286932 TGTAATTTGCAAAAGATATTTGG - Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157959447 18:52136082-52136104 AGGTAACTACAAAAGATACTTGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159545699 18:69838299-69838321 ATTTATCAGCATAAGATAGCTGG - Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160356858 18:78235398-78235420 ATTTATCAGCAAAAGCTGGTTGG - Intergenic
1160665968 19:328376-328398 AGTTATCTGAAAAAGGCATTTGG + Intronic
1160960426 19:1718460-1718482 AGTTCTCTGTAAAGGACAGTGGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165604330 19:37087465-37087487 AGATTTCTGCAAGAGATACTTGG - Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925376740 2:3391452-3391474 AGTTATCTGAAAAAATTAATTGG - Intronic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
930953379 2:57172841-57172863 CGTCCACTGCAAAAGATAGTGGG + Intergenic
931510132 2:62982376-62982398 ATTTACCTTCAAAAGACAGTAGG + Intronic
931600527 2:63998620-63998642 TGTTATCTGCATAAAACAGTGGG - Intronic
931987157 2:67753412-67753434 AGTTGTCAGCAAATGATGGTAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933467428 2:82672308-82672330 AGTCATCAGCAAAAGACAGGTGG + Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935473362 2:103486665-103486687 AGATACCTGCAAAAGCAAGTTGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939762516 2:146200165-146200187 AGATATGTGCAAAAGAAAGTAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG + Intergenic
940216466 2:151308699-151308721 AGAGATGTGCAAAAGATGGTTGG + Intergenic
940776498 2:157889988-157890010 AGTTTTTTCCAAAAGGTAGTCGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942055407 2:172177804-172177826 AGTTATCTGCAAAATCTGCTAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943730381 2:191296983-191297005 AAATATCTGAAAAAGAAAGTTGG + Intronic
943955397 2:194182349-194182371 AGATATCTGCAAAATATAGTAGG - Intergenic
944351587 2:198734008-198734030 AGTCATGTAGAAAAGATAGTAGG + Intergenic
945353444 2:208809931-208809953 TGTTATCTGGAAAAGCCAGTGGG - Intronic
945425119 2:209691563-209691585 AGTTATCTGGAAAAGATTTGGGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946551727 2:220808740-220808762 AGTTATCTCAAAAAAATAGCAGG - Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947461525 2:230307924-230307946 AGTTATATGAAAAAGACACTTGG + Intronic
1170321721 20:15106829-15106851 AGTGATCTGCCATAGATATTTGG + Intronic
1171742335 20:28913848-28913870 TGCAATCTGCAAAAGATATTTGG + Intergenic
1174691404 20:52510209-52510231 AGTGATCTGCAAATGATAAGAGG + Intergenic
1175296895 20:57914771-57914793 AGTTTGCTGCAAAACATGGTTGG - Intergenic
1175558298 20:59891420-59891442 ATTAATCTGAAAAAGAAAGTGGG + Intronic
1176325131 21:5388650-5388672 AATCATCTGCAAAAGATATTTGG - Intergenic
1176482687 21:7319066-7319088 AATCATCTGCAAAAGATATTTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176991289 21:15499802-15499824 AGTCATCTGCAAAAAATAGTAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177409502 21:20711349-20711371 TGTTATCTGAAGGAGATAGTAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177546412 21:22563920-22563942 ATTTAACTGCAAAGGATTGTGGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180457754 22:15525955-15525977 ATTTATCTGCAAAAGAGAGTAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182004830 22:26951151-26951173 AATTATCTGGATAAGATGGTGGG + Intergenic
1183125726 22:35779422-35779444 AGTTTTTTGATAAAGATAGTAGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949415833 3:3813433-3813455 ACTTATCAGAAAAAGATAGTGGG + Intronic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949905871 3:8858028-8858050 AGTTATCTGCAAATGACAGCAGG - Intronic
950160796 3:10759232-10759254 AGTTATGTGATAAAGATGGTGGG - Intergenic
950776178 3:15352288-15352310 AGTTACTTGCAAGATATAGTGGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG + Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954508945 3:51104990-51105012 AGTTTTCTGGAAGAGATAATGGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG + Intronic
955836113 3:63057064-63057086 AGCTATCAGCAAAACATAATGGG + Intergenic
955861859 3:63339509-63339531 AGAAATCTGAAAAAGATAGGTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956898761 3:73691505-73691527 AGTTTTCTGAAAAAGATTATGGG + Intergenic
957070575 3:75564762-75564784 AGTTAGGTGCATAAGAGAGTGGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960525993 3:118710451-118710473 AGTTATCATAAAAAGTTAGTTGG + Intergenic
960595882 3:119407597-119407619 AGTTATCTATAAGAGACAGTGGG + Intronic
961080325 3:124021395-124021417 AGTCATCTGAAGAAAATAGTGGG + Intergenic
961111585 3:124288460-124288482 ATTTGGCTGCAAAAGATACTTGG + Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962083765 3:132168626-132168648 AGGCAACTGCAAAATATAGTGGG + Intronic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964146134 3:153466075-153466097 AGTCATCTGGAAAATATAGTTGG + Intergenic
964290600 3:155175944-155175966 AGTTATCAGCTAAAGATTGGAGG - Intronic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964904622 3:161704680-161704702 AGTCATTTGCAAAACATAGGTGG + Intergenic
964928896 3:161991472-161991494 AGTTATCTCAAAAACTTAGTAGG - Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965273304 3:166647323-166647345 AATTATATGCAAATCATAGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
967726612 3:192868232-192868254 AGTCATATCCAAAAGATAGAAGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
978985382 4:115005736-115005758 AGTTAGCTGGATAAGATGGTGGG + Intronic
979002631 4:115244054-115244076 AGTTATGTGGAAAAAATAATAGG - Intergenic
979504993 4:121485457-121485479 TGTTATCTGCACAAGAGGGTGGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
979870328 4:125811582-125811604 AGTTATTTGGAAAAAATATTTGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
982167130 4:152624255-152624277 TGTTATTTAGAAAAGATAGTAGG + Exonic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983679180 4:170332493-170332515 AGTTATCTCCAATATATTGTGGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984544300 4:181081893-181081915 AGTTATTTGGTAAAGATAATGGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
987721767 5:21644133-21644155 AGATATCTGCTAAGTATAGTTGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990177886 5:53127843-53127865 AATAATCTGGAAAGGATAGTGGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991248210 5:64530291-64530313 GTTTATCTGAAAAAGAAAGTAGG + Intronic
991559804 5:67938372-67938394 AGTTTGCTCCAAAAGAAAGTAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993087523 5:83381870-83381892 ACTTACCTGCAAAAGAGGGTGGG - Intergenic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995019317 5:107349054-107349076 AGTTACCTGAGAAAGGTAGTGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996488667 5:124066629-124066651 ATTTATCTGCAAAAGGTAGCAGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
999441296 5:151602849-151602871 ACTTAATTGCAAAAGAGAGTGGG + Intergenic
999660612 5:153859009-153859031 AGTTATCTGACTAACATAGTAGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003240905 6:4344844-4344866 GGGTATCTGCAAAAGAAACTAGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1004445162 6:15691322-15691344 AGTTAACTGAAAAAGAAACTAGG - Intergenic
1004611268 6:17242300-17242322 AGCTATTTGCAAAAGAAAGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005859875 6:29892127-29892149 AGTGACCTGCAAAAGATAGAGGG + Intergenic
1005865140 6:29931823-29931845 AGTGACCTGAAAAAGATAGAGGG + Intergenic
1005867459 6:29946911-29946933 AGTGACCTGCAAAAGATAGAGGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007780547 6:44251294-44251316 AGTTTTCTGCAATACATAGTAGG + Intronic
1007887286 6:45244528-45244550 AGTTTTCAGGAAAAGGTAGTGGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008135988 6:47777576-47777598 AATTATCTTCAAAAAATATTTGG - Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008333459 6:50271119-50271141 TGTTTTCTACCAAAGATAGTGGG - Intergenic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012001905 6:93664421-93664443 AGATATTTGCAGAAGATAGTAGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012420573 6:99060258-99060280 ACTTATCTGCAGAAGTTAGGAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012917183 6:105182667-105182689 TGTTGTCTGGAAAAGAAAGTTGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013055794 6:106581714-106581736 AGTTATCTGCCAAATGTAATAGG + Intronic
1013373687 6:109493314-109493336 AGTTATCTGAAAGTGATAGAGGG - Exonic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014676594 6:124374960-124374982 AGGAATCTGCAAGGGATAGTGGG - Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015856601 6:137631720-137631742 ATTTATTTGTAAAAGATAGATGG - Intergenic
1015959680 6:138633994-138634016 AGTTATCTGCTCAAAATAATGGG + Intronic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016281210 6:142421123-142421145 AGTTATCTGCAGGGGAGAGTTGG + Intronic
1016306164 6:142685879-142685901 AATTATGTGCAAGAGATACTCGG + Intergenic
1016463087 6:144298975-144298997 ATTTATATGCAAAAGATTTTTGG + Intronic
1017008496 6:150045413-150045435 AGCTATCTGCAATAGAGACTGGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018243405 6:161800301-161800323 AGAAATCTGCAAATGGTAGTAGG - Intronic
1018273751 6:162107922-162107944 ATTTATTTGCAAAAGAAAGGAGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019130780 6:169872160-169872182 AATTATATGCAAAAGAAACTAGG - Intergenic
1019145399 6:169972491-169972513 AGCTATGTGCCAAAGACAGTGGG - Intergenic
1020597623 7:10228612-10228634 AGTTGTCAGAAAAAGATTGTTGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028488619 7:91386713-91386735 AGTTGTCTTCAAAAGAGATTAGG + Intergenic
1028693231 7:93677611-93677633 AGTTTTCTGCTAAAGCAAGTAGG - Intronic
1028931557 7:96419019-96419041 AGTCATCGGCAAAAGTTAGCAGG + Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031761416 7:125717088-125717110 AGTTATCTGAAAATAATGGTAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1034088068 7:148338499-148338521 AGGAATTTGCAAAGGATAGTGGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037964897 8:23126523-23126545 AGGTGTCTGTAAAAGACAGTGGG - Intergenic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1040789842 8:51215400-51215422 CTTTATCTGCAAAAAATATTTGG - Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047142938 8:122162489-122162511 AGTTGTAGGCAAAAGAAAGTTGG + Intergenic
1047828512 8:128605741-128605763 ATTTATCTTCAAAAGTGAGTGGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052797230 9:32934165-32934187 AGTTACATGAAAAAGATAATTGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185923812 X:4124362-4124384 AGTTCTCTGCAAAAGTAAGGAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186479762 X:9887724-9887746 AGTTATCTGCACATGATAGAAGG + Intronic
1187053916 X:15722822-15722844 AGTTATTTACAAAATATATTTGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189600395 X:42618348-42618370 AGTTATTTGTAAAAGTTATTTGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192282040 X:69697899-69697921 AGTTATTAGCAGAAGAGAGTGGG - Intronic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193642652 X:84030059-84030081 TGTTATCTGCCCAAAATAGTGGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194043255 X:88970059-88970081 AGTTATTTCCAAAATACAGTGGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198265811 X:135007540-135007562 AGTATTCTCCTAAAGATAGTAGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199003374 X:142667308-142667330 ACTTATATGCAACACATAGTTGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200914530 Y:8559837-8559859 AGCTATCAGCAAAAGATGGTTGG - Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic