ID: 1143051273

View in Genome Browser
Species Human (GRCh38)
Location 17:4127977-4127999
Sequence TGTCCACTCATTAAGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143051273_1143051278 -9 Left 1143051273 17:4127977-4127999 CCCCATTCCTTAATGAGTGGACA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1143051278 17:4127991-4128013 GAGTGGACAGCCCAGGCCACCGG 0: 1
1: 0
2: 4
3: 33
4: 297
1143051273_1143051279 -8 Left 1143051273 17:4127977-4127999 CCCCATTCCTTAATGAGTGGACA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1143051279 17:4127992-4128014 AGTGGACAGCCCAGGCCACCGGG 0: 1
1: 0
2: 2
3: 30
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143051273 Original CRISPR TGTCCACTCATTAAGGAATG GGG (reversed) Intronic
909622105 1:77680515-77680537 TGTCCACTCTTTGGGCAATGTGG - Intronic
911185056 1:94894868-94894890 CAAGCACTCATTAAGGAATGAGG + Exonic
921805617 1:219450892-219450914 TGTCATCTCATGAAGGAAAGTGG - Intergenic
1063079058 10:2747661-2747683 TGTCTAGTCAGTAAGGACTGTGG + Intergenic
1063820964 10:9835021-9835043 TGTCAACTCTTTATGAAATGAGG + Intergenic
1065724201 10:28654508-28654530 TGTCAACTCATTGAGGACTTTGG + Intergenic
1066113072 10:32214492-32214514 AGTCAACTCATTAATTAATGAGG + Intergenic
1067759487 10:49033197-49033219 TTTGCAGTCATTAAAGAATGAGG + Intronic
1071981812 10:91010820-91010842 TTTCCACTCATTTGTGAATGAGG + Intergenic
1073448519 10:103595434-103595456 TGTCCCTTCATTAGGGAAGGAGG - Exonic
1073583728 10:104689380-104689402 AGTCCACACATTGTGGAATGTGG - Intronic
1074500705 10:114021422-114021444 TGCCCACTCACTCAGCAATGGGG + Intergenic
1076099972 10:127769186-127769208 TGGCCACTCTTGCAGGAATGAGG - Intergenic
1083594941 11:63914727-63914749 TGTCCACTCGTCAGGGAATGGGG + Exonic
1083868059 11:65469140-65469162 TGTCAGCTCATAAAGGCATGGGG - Intergenic
1085750707 11:79158575-79158597 AGTACTCTCATGAAGGAATGGGG + Intronic
1086266729 11:85007850-85007872 TGTCCTTTCATTGAGGAATTAGG - Intronic
1088267527 11:108001958-108001980 TCTAAATTCATTAAGGAATGAGG - Intergenic
1090308546 11:125713612-125713634 TGTCCATTCAGTATGGACTGTGG + Intergenic
1091138049 11:133210536-133210558 TTTCCACTCAAAAAGGAAAGAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092599775 12:10047810-10047832 TTTCCACTCATTAAAGACTCAGG - Intronic
1094273825 12:28646139-28646161 TGTCCACTCTCTTGGGAATGAGG - Intergenic
1094667393 12:32534484-32534506 TGTCCACTGATCAAGGTAAGTGG + Intronic
1095622108 12:44269288-44269310 TGTGTAGTCATTAAGGAGTGTGG - Intronic
1100115057 12:91294316-91294338 TGTCCACTCCTGTAGGAAGGGGG + Intergenic
1100390092 12:94140417-94140439 TGTCCACTCCTCAGGGAATGGGG - Intergenic
1102105795 12:110321853-110321875 TGTACACACATCAAGGAAAGGGG + Intronic
1107824835 13:44319112-44319134 TGTTCTTTCAATAAGGAATGAGG - Intergenic
1109593326 13:64515879-64515901 TATCCACTCATTTTAGAATGTGG + Intergenic
1112261946 13:97885178-97885200 TGACCATCCATTAAGGACTGAGG + Intergenic
1112356171 13:98676295-98676317 TGTACACTCATTAGGGAAGATGG + Intergenic
1114574768 14:23701749-23701771 TGTCTACTCATTAAATACTGAGG - Intergenic
1119444509 14:74652250-74652272 TGTGCACTCTGCAAGGAATGAGG - Intergenic
1120242997 14:81971932-81971954 TGACCATTCATTGAAGAATGTGG - Intergenic
1128787546 15:70409382-70409404 TCTCCACTCCTTTAGAAATGGGG - Intergenic
1131336218 15:91551940-91551962 AGTCAACTCATTCTGGAATGTGG + Intergenic
1131570213 15:93527359-93527381 AGTCCACTGTTTAAGGAATTGGG - Intergenic
1131596100 15:93799865-93799887 TGTCCCCTCAGTGAGGCATGTGG + Intergenic
1139770364 16:69269886-69269908 TGTTCAGTTATTATGGAATGGGG + Intronic
1140252463 16:73306071-73306093 GGACCACACATTAAGGAATGAGG + Intergenic
1143051273 17:4127977-4127999 TGTCCACTCATTAAGGAATGGGG - Intronic
1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG + Intergenic
1146466464 17:33090472-33090494 TGTCCATTCATAAATGATTGAGG - Intronic
1146548816 17:33762609-33762631 TGTCCACTTAGTAAGGACTATGG - Intronic
1146837045 17:36119444-36119466 TATCCACTGATTAAGGGATGGGG - Intergenic
1149344747 17:55723368-55723390 TGTTAATTCATTTAGGAATGAGG + Intronic
1151372027 17:73653743-73653765 GGTACAGTCATTTAGGAATGGGG - Intergenic
1156625704 18:38905540-38905562 TGACCAAGCATTAAGGAATTGGG + Intergenic
1158827554 18:61240361-61240383 TGTCAATTCATTTAGGATTGGGG + Intergenic
1163438644 19:17310354-17310376 TGTCCCCTCATTATGAAGTGTGG + Intronic
1166695454 19:44849018-44849040 TCTCCTCTCATTAGGGAAGGGGG + Intronic
1168503798 19:56915997-56916019 TGTCCACTCAGAACAGAATGTGG - Intergenic
929544129 2:42844647-42844669 TGTCCACCCATTCAGGCACGAGG - Intergenic
930122398 2:47770531-47770553 TGTCCTCACATGAAGGAATGTGG - Intronic
931520711 2:63094037-63094059 TTCACACTCATTAAGGATTGGGG + Intergenic
935384910 2:102489763-102489785 TTTCCCCTCATTTAGGAGTGAGG + Intronic
941623017 2:167799789-167799811 TGTAATCTCATTAAGAAATGAGG + Intergenic
943197734 2:184776848-184776870 TTTCCACTCATTAATTAATGAGG - Intronic
1173448355 20:43139845-43139867 TGTCCCCTCATTCTGCAATGAGG - Intronic
1174663639 20:52237155-52237177 TATTCCCTCATTAATGAATGGGG + Intergenic
1174841321 20:53904045-53904067 TGTCCACTCAATGAGGCATCTGG + Intergenic
1175181569 20:57152078-57152100 TGGAGACTGATTAAGGAATGAGG - Intergenic
1175721832 20:61292376-61292398 TGCCCACTCAAAAAGGACTGGGG - Intronic
1176100772 20:63363491-63363513 TCTCCACTCACAAAAGAATGTGG - Intronic
1182930385 22:34167921-34167943 TGTCCACACATAAATGAATAAGG - Intergenic
1184337212 22:43861014-43861036 TGGCCACTCATTAAGTCCTGCGG - Intronic
950078968 3:10207678-10207700 TGTTCACTCACTAAGGGATTGGG + Intronic
957714238 3:83904409-83904431 TGTCAACTCAAAAAGGAATTGGG - Intergenic
963135559 3:141900400-141900422 TGTCCTCTCCTTGAGGAATCAGG - Intronic
963449103 3:145454744-145454766 TGACCATTGATTAAGGATTGGGG + Intergenic
970040353 4:11790315-11790337 TCTGCACGCATTGAGGAATGAGG + Intergenic
972947966 4:44281499-44281521 TGTACACTCATTAAATACTGGGG + Intronic
974080588 4:57208396-57208418 TGAACACTGAATAAGGAATGGGG + Intergenic
974277066 4:59735674-59735696 TGTCCTCTCATTACAGAATGTGG - Intergenic
978021593 4:103820623-103820645 AATCAACACATTAAGGAATGGGG - Intergenic
979135235 4:117103210-117103232 TCTCCACTCCTTAAGGAGTGTGG + Intergenic
979719490 4:123882357-123882379 TGTCCACCAGCTAAGGAATGTGG + Intergenic
981811458 4:148780418-148780440 TGCTCAGTCATTAAGAAATGAGG - Intergenic
983106883 4:163697451-163697473 TGTAAGCTCACTAAGGAATGGGG + Intronic
983848854 4:172554319-172554341 TGTCCACTTATAAAGGAAAAAGG - Intronic
986381439 5:7190261-7190283 TGTCCTCTTATCAAGGAATGTGG - Intergenic
987920537 5:24274316-24274338 TCTCCACTCATTCTGGAATTAGG - Intergenic
988152957 5:27411320-27411342 TGTCCACTCAATATGAAATATGG + Intergenic
988712738 5:33794381-33794403 TCTCCACTCTTGAAGTAATGAGG - Intronic
991180942 5:63750164-63750186 TGTCCAGTCAATAAAGAATGAGG - Intergenic
994081480 5:95712302-95712324 ACTCCTCTCATTAAGAAATGGGG + Intergenic
995111327 5:108431945-108431967 TGCCCAATCTTAAAGGAATGAGG - Intergenic
997176863 5:131787743-131787765 TGACTCCTCATTAAGCAATGAGG - Intronic
998210158 5:140190369-140190391 TGTCCATTCATTTATGTATGAGG + Intronic
998225373 5:140322712-140322734 TGTCTCCTCATTAATAAATGGGG - Intergenic
1000159719 5:158585875-158585897 TGTCTACACATTAAAGAATTAGG + Intergenic
1002186889 5:177458768-177458790 TGCCCACCCACTAAGGAGTGAGG + Intronic
1008367754 6:50702657-50702679 TGCCCAATCTTTAAGGAGTGAGG - Intergenic
1011480862 6:87792366-87792388 TGTCCACTTAATAAGGATTATGG - Intergenic
1012464482 6:99502223-99502245 TGTCCACTCCAGAGGGAATGAGG - Intronic
1013168561 6:107616060-107616082 TGCCTACTCATTGAGGAAGGGGG + Intronic
1014320489 6:119923297-119923319 TGTCCACTCATTGAAGGATTAGG + Intergenic
1020211859 7:6163796-6163818 TGTCTATTCATTAAGAAATCTGG + Exonic
1021128482 7:16881904-16881926 TGACCACTGATTAAGTAATCTGG + Intronic
1030709709 7:112735857-112735879 TGTGAACTCCTTGAGGAATGGGG + Intergenic
1030943629 7:115688024-115688046 TGTCAAGTCATTTTGGAATGTGG + Intergenic
1032503444 7:132417476-132417498 TGTCCAGTAGATAAGGAATGAGG + Intronic
1034232277 7:149540014-149540036 TTTCCACTCAGTATAGAATGAGG - Intergenic
1035168842 7:157006782-157006804 TGCCCACTCCCCAAGGAATGCGG + Intronic
1038777229 8:30542038-30542060 TCTCCCATCATGAAGGAATGTGG - Intronic
1043611385 8:82067561-82067583 TGGCCTCTCATTTGGGAATGAGG + Intergenic
1045124027 8:99069938-99069960 TGTCCACTCAGGCAGGAGTGTGG + Intronic
1045716572 8:105054033-105054055 TTTCTACTCATCAAAGAATGTGG + Intronic
1047410942 8:124624192-124624214 GGTCCACTCATTGAGGACGGGGG - Intronic
1048030309 8:130625467-130625489 TGTCAGCACATTAAGGAATTTGG - Intergenic
1050026413 9:1339001-1339023 TATCTACTCATTAAGGAACAAGG - Intergenic
1050656500 9:7834159-7834181 TGTCAACTCACTGAGGAAGGAGG - Intronic
1050739608 9:8804728-8804750 TGGCCACTCATCAAGGTCTGTGG - Intronic
1052699882 9:31924718-31924740 TGCCCACTCTTCATGGAATGAGG + Intergenic
1052731011 9:32285954-32285976 TATCCACTCATTGATTAATGGGG + Intergenic
1057484244 9:95469721-95469743 TGTGGACTTATAAAGGAATGTGG - Intronic
1059849289 9:118319211-118319233 TGTCAACTCACTATTGAATGTGG - Intergenic
1186570403 X:10709241-10709263 TGTCCAATCATTAAGTGATTGGG + Intronic
1188529152 X:31119036-31119058 TGTCTACTCATAGAGCAATGAGG + Intronic
1197706511 X:129638331-129638353 TCTCCAGGTATTAAGGAATGTGG + Intergenic
1197861447 X:130975194-130975216 TTTCCATTCATTATGGAAAGGGG + Intergenic
1197981368 X:132220590-132220612 TGTACTCTCATTAAGCAATGAGG + Intergenic
1198217974 X:134574207-134574229 GGTACAATAATTAAGGAATGGGG - Intronic
1198502822 X:137269540-137269562 TATCCACTCAACAAGCAATGTGG + Intergenic
1199041290 X:143118190-143118212 TTTCCACTCATTCAGGATGGAGG - Intergenic