ID: 1143053076

View in Genome Browser
Species Human (GRCh38)
Location 17:4142772-4142794
Sequence GAGCCGCGACGCCCGGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143053065_1143053076 13 Left 1143053065 17:4142736-4142758 CCGGCTCCAGCAGCGCCGCGGCG 0: 1
1: 0
2: 3
3: 27
4: 223
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053062_1143053076 28 Left 1143053062 17:4142721-4142743 CCTCTCGCAGCCTGGCCGGCTCC 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053069_1143053076 7 Left 1143053069 17:4142742-4142764 CCAGCAGCGCCGCGGCGGGTGGT 0: 1
1: 1
2: 0
3: 3
4: 100
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053063_1143053076 18 Left 1143053063 17:4142731-4142753 CCTGGCCGGCTCCAGCAGCGCCG 0: 1
1: 1
2: 0
3: 26
4: 263
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053071_1143053076 -2 Left 1143053071 17:4142751-4142773 CCGCGGCGGGTGGTAGCGCTGGA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143053076 Original CRISPR GAGCCGCGACGCCCGGGCCG GGG Exonic