ID: 1143053076

View in Genome Browser
Species Human (GRCh38)
Location 17:4142772-4142794
Sequence GAGCCGCGACGCCCGGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143053062_1143053076 28 Left 1143053062 17:4142721-4142743 CCTCTCGCAGCCTGGCCGGCTCC 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053069_1143053076 7 Left 1143053069 17:4142742-4142764 CCAGCAGCGCCGCGGCGGGTGGT 0: 1
1: 1
2: 0
3: 3
4: 100
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053065_1143053076 13 Left 1143053065 17:4142736-4142758 CCGGCTCCAGCAGCGCCGCGGCG 0: 1
1: 0
2: 3
3: 27
4: 223
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053063_1143053076 18 Left 1143053063 17:4142731-4142753 CCTGGCCGGCTCCAGCAGCGCCG 0: 1
1: 1
2: 0
3: 26
4: 263
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398
1143053071_1143053076 -2 Left 1143053071 17:4142751-4142773 CCGCGGCGGGTGGTAGCGCTGGA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143053076 Original CRISPR GAGCCGCGACGCCCGGGCCG GGG Exonic
900125504 1:1067357-1067379 GAGCCGCGAGCCGCGAGCCGCGG - Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
900513030 1:3069346-3069368 GGGCCGGGGCGCCCGGGCCAGGG + Intronic
900513367 1:3070416-3070438 GAGCCGCGCTGGCCGGGCCGCGG - Intronic
901426019 1:9182750-9182772 TCGCCGCGACGCCCAGTCCGAGG + Intergenic
902322019 1:15674576-15674598 GAGCCACCACGCCCGGCCAGGGG + Intergenic
903466418 1:23555058-23555080 GCGCTGCGGCGCCCGGGCTGGGG - Intergenic
903628226 1:24745978-24746000 GGGCCCCGGCGCCCGGGCGGGGG - Intronic
904236668 1:29121521-29121543 GAGCTGCGACGCGAGGGTCGCGG - Exonic
904528809 1:31155026-31155048 GAGGGGCGGAGCCCGGGCCGGGG + Intergenic
905214199 1:36395492-36395514 GAGCCACCACGCCCGGCCTGTGG - Intronic
905764098 1:40585930-40585952 GAGCCACCACGCCCGGCCAGGGG - Intergenic
906252950 1:44325357-44325379 GAGCCACCACGCCCGGCCCCTGG + Intronic
907767393 1:57424231-57424253 GAGCCGCGAGGCCGGGGCGAGGG - Intronic
910449099 1:87328922-87328944 AAGCCGCGCCGCGCGGGCCGAGG + Exonic
912642558 1:111361281-111361303 GAGCCACCACGCCCGGCCTGGGG + Intergenic
914371217 1:147025949-147025971 GAGCCACCACGCCCGGCCCACGG + Intergenic
914835646 1:151204459-151204481 GAGCCGCCACGCCCGGCCTGTGG + Intronic
914937452 1:151993542-151993564 GGGCGGCCGCGCCCGGGCCGGGG + Intronic
915919238 1:159961872-159961894 GAGCCGCCACGCCCGGCCAAAGG - Intergenic
915978662 1:160407010-160407032 GAGCCACCACGCCCGGCCCAGGG + Intronic
918349855 1:183643573-183643595 GAGCCACCGCGCCCGGCCCGAGG + Intronic
919738999 1:200971433-200971455 GAGCTCCCACCCCCGGGCCGGGG - Intronic
920561791 1:206944188-206944210 GAGCCACTACGCCCGGCCCCAGG - Intronic
921131087 1:212220622-212220644 GAGCCACCACGCCCGGCCTGAGG - Intergenic
923491955 1:234492032-234492054 GAGCCACCACGCCCGGCCAGTGG + Intergenic
923684134 1:236142385-236142407 GGGCCGGGGCGCGCGGGCCGGGG + Intergenic
923969457 1:239183253-239183275 GAGCCACCACGCCCGGCCTGAGG + Intergenic
924362825 1:243259114-243259136 GAGCCACCACGCCCGGCCCCAGG - Intronic
924753064 1:246915045-246915067 GAGCCACCACGCCCGGCCAGTGG - Intronic
1062916546 10:1244630-1244652 GAGACGCGAAGCCTGGACCGAGG + Intronic
1063296069 10:4807762-4807784 GAGCCACCATGCCCGGGCCCCGG + Intronic
1064061222 10:12139244-12139266 GAGCCACCACGCCCGGCCCTCGG + Intronic
1065015780 10:21461714-21461736 GAGCCACCACGCCCGGCCCCCGG - Intergenic
1065696918 10:28388541-28388563 GAGCCACCGCGCCCGGCCCGGGG + Intergenic
1069607150 10:69746765-69746787 GAGCCACCACGCCCGGCCCAGGG + Intergenic
1069767052 10:70870211-70870233 GAGCCACCATGCCCGGGCCATGG - Intronic
1071823411 10:89300700-89300722 GAGCCACCACGCCCGGCCAGGGG - Intronic
1072021793 10:91410163-91410185 GACCCGCGACGCGCGAGCCCCGG + Intergenic
1072040330 10:91600658-91600680 GAGCCTAGACGCCCAGGCCAAGG - Intergenic
1072089390 10:92112427-92112449 GAGCCACCACGCCCGGCCCCAGG + Intronic
1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG + Intergenic
1072846540 10:98837588-98837610 GAGCCACCACGCCCGGCCGGAGG - Intronic
1073770562 10:106731023-106731045 GAGCCACCACGCCCGGCCCAGGG - Intronic
1075195747 10:120357524-120357546 GAGCCACCGCGCCCGGCCCGAGG + Intergenic
1075524645 10:123173285-123173307 GAGCCACCACGCCCGGCCCAGGG + Intergenic
1076907572 10:133370991-133371013 GAGCCACCGCGCCCGGCCCGGGG - Intronic
1076948698 10:133667400-133667422 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
1076949682 10:133670699-133670721 GGGCCGCGTCTCCCGGGCCAGGG - Intronic
1076950666 10:133673998-133674020 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076951656 10:133677308-133677330 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076952646 10:133680618-133680640 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076953629 10:133683917-133683939 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076955602 10:133743579-133743601 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076956592 10:133746889-133746911 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076957580 10:133750198-133750220 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076958564 10:133753497-133753519 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076959553 10:133756807-133756829 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1076960537 10:133760106-133760128 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1077088049 11:764480-764502 GAACCCCGACGCCCAGGCCCGGG - Intronic
1077270766 11:1678630-1678652 GAGCCACCACGCCCGGCCCCAGG + Intergenic
1078179994 11:9003683-9003705 AAGCCGCAACGGCCGGGCCTCGG + Intronic
1078246098 11:9574144-9574166 GAGCGGCGGCGCTCGGGCCCGGG - Exonic
1078987055 11:16607059-16607081 GAGCCGCGGCTGCCGGGCCGGGG - Intronic
1079243751 11:18738687-18738709 GAGCCACCGCGCCCGGGCAGAGG - Intronic
1081209469 11:40313895-40313917 GAGCCGCCGCGCCCGGCCCGTGG + Intronic
1081898737 11:46609597-46609619 GAGCCACCACGCCCGGCCTGAGG + Intronic
1083168388 11:60906274-60906296 CCGCTGCGGCGCCCGGGCCGGGG - Intronic
1083227758 11:61295310-61295332 GAGGCGCGGAGCCCGGGGCGGGG + Exonic
1083757328 11:64798717-64798739 GAGCCACCACGCCCGGTCAGAGG + Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1084081052 11:66825188-66825210 GAGCCACCACGCCCGGCCTGGGG - Intronic
1084646862 11:70463918-70463940 CAGCCGCGCCGGCCGGGCCCAGG - Intergenic
1084758408 11:71252823-71252845 GAGCCACGCAGCCCGGGGCGGGG - Intergenic
1085011244 11:73142710-73142732 GAGCGGAGACGCGCGCGCCGGGG - Intergenic
1085515147 11:77107336-77107358 GAGCCACGCCGCCAGGGCTGTGG - Intronic
1085995977 11:81914415-81914437 GAGCCACCACGCCCGGCCCAAGG + Intergenic
1088259945 11:107934640-107934662 GAGCCACCACGCCCGGCCTGAGG - Intronic
1089865611 11:121628569-121628591 GATCCCCAATGCCCGGGCCGAGG - Intronic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1090822542 11:130356743-130356765 GAGCCACCACGCCCGGCCCCAGG - Intergenic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1091493227 12:950285-950307 GAGCCACCACGCCCGGCCCCAGG - Intronic
1092843365 12:12562999-12563021 CGGCCCCGACCCCCGGGCCGGGG + Intergenic
1092860817 12:12717632-12717654 GAGACTCGGCGGCCGGGCCGGGG + Exonic
1094040232 12:26114357-26114379 GAGCCGAGGCGGCCGGGCCCGGG - Intergenic
1095752289 12:45727098-45727120 GAGCGGTGCCGACCGGGCCGTGG + Intergenic
1096310764 12:50518491-50518513 GAGCCACAACGCCCGGCCCTTGG + Intronic
1097097806 12:56563651-56563673 GAGCCACCACGCCCGGCCCAAGG - Intronic
1097990258 12:65825587-65825609 GAGCCGCGGCGGGCGGCCCGGGG + Intronic
1098104320 12:67053553-67053575 GAGCCACCACGCCCGGCCCAAGG - Intergenic
1098975986 12:76902694-76902716 GAGCCGCCGCGCCCGGCCCAGGG + Intergenic
1100422012 12:94444112-94444134 GAGCCACCACGCCCGGCCTGAGG - Intronic
1102046554 12:109833317-109833339 GAGCCGCCCCTCCCGGGCCCGGG + Intronic
1102822133 12:115917117-115917139 GAGTCGGGGCCCCCGGGCCGCGG - Intergenic
1103494395 12:121350395-121350417 GAGCCACCGCGCCCGGCCCGAGG - Intronic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104865448 12:131950538-131950560 GTTCCGGGACGCCCGGGACGCGG - Intronic
1105007677 12:132731730-132731752 GAGCCGCCACGCCCGGCCGCTGG + Intronic
1105034374 12:132908298-132908320 GAGCAGGGAAACCCGGGCCGGGG + Intronic
1105388911 13:19958305-19958327 GAGCCCGGGCGCCCAGGCCGCGG - Intergenic
1105653101 13:22402421-22402443 GAGCCGCTGCGCCCGGCCCAAGG + Intergenic
1105919659 13:24950170-24950192 GAGCCACCACGCCCAGTCCGTGG - Intergenic
1105967717 13:25399684-25399706 GAGCCACCGCGCCCGGCCCGTGG + Intronic
1107468173 13:40667266-40667288 GAGCCGCGGCGCCGGGGGTGGGG - Intergenic
1107469193 13:40676467-40676489 GAGCCACCACGCCCGGCCCCAGG - Intergenic
1108342097 13:49507187-49507209 GAGCCACCACGCCCGGGCCTGGG + Intronic
1108345444 13:49541929-49541951 GAGCCACCACGCCCGGCCCAAGG - Intronic
1108662600 13:52600302-52600324 GAGCTGCCACGCACGTGCCGCGG - Intergenic
1108678070 13:52755391-52755413 GAGCCACGGCGCCCGGCCTGGGG - Intergenic
1109165183 13:59025519-59025541 GAGCCACAGCGCCCGGGCAGGGG + Intergenic
1110207041 13:72927219-72927241 GAGCCACCACGCCCGGACAGTGG - Intronic
1113374662 13:109753243-109753265 GAGCCACCACGCCCGGCCGGAGG + Exonic
1113656681 13:112072316-112072338 GAGCCGCTGCCCCCGGGCCCAGG - Intergenic
1113921724 13:113917179-113917201 GAGACACAACGCCAGGGCCGGGG + Intergenic
1117119519 14:52552933-52552955 GAGCCGAGACCCCCGGGGGGTGG + Intergenic
1117909064 14:60619075-60619097 GAGCCACCACGCCCAGGCAGAGG + Intergenic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119519700 14:75277102-75277124 GAGCGGCCGCGGCCGGGCCGGGG + Intergenic
1119756685 14:77124842-77124864 GATGCGCGGGGCCCGGGCCGTGG + Intronic
1119787079 14:77321597-77321619 GAGCCACCGCGCCCGGCCCGGGG - Intronic
1120983142 14:90308956-90308978 GAGCCACCACGCCCGGCCTGTGG - Intronic
1122445028 14:101761807-101761829 GGGGCGCGACGGCCGGGGCGGGG + Exonic
1122712928 14:103673637-103673659 GAGCCACCACGCCCGGCCTGTGG - Intronic
1122770386 14:104095167-104095189 GAGCCTCGAAGCCCAGACCGCGG - Intronic
1122975341 14:105168581-105168603 GCGCCGCGGCGCGCGGGCCTGGG + Exonic
1123033531 14:105462284-105462306 GAGCCACTGCGCCCGGGCTGTGG - Intronic
1202852484 14_GL000225v1_random:30317-30339 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
1202858293 14_GL000225v1_random:64671-64693 GGGCCGCGTCTCCCGGGCCAGGG + Intergenic
1124362132 15:29045372-29045394 GAGCCACCACGCCCGGCCTGGGG + Intronic
1124568214 15:30835412-30835434 GAGCCACCACACCCGGTCCGAGG - Intergenic
1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG + Exonic
1126120613 15:45248081-45248103 GAGCCACCACACCCGGCCCGTGG + Intergenic
1126647111 15:50885574-50885596 GAGCCACCACGCCCGGCCGGTGG - Intergenic
1126746426 15:51830094-51830116 GAACCCGGGCGCCCGGGCCGCGG - Intronic
1127693362 15:61419451-61419473 GAGCCACCACGCCCGGCCAGAGG - Intergenic
1129116778 15:73368990-73369012 GGGCAGCGGCGCACGGGCCGGGG + Exonic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1131165981 15:90142423-90142445 GAGCCGCGGCGCCCAGCCGGTGG - Intergenic
1132594111 16:740524-740546 GGGCGGCGGGGCCCGGGCCGGGG - Intronic
1132616495 16:843459-843481 GAGCCACCACGCCCGGCCCCAGG - Intergenic
1132637309 16:957856-957878 GAGCCACCACGCCCGGCCCAAGG - Intronic
1132805044 16:1771464-1771486 GAGCCGCGCGGCGCGGGCCGGGG - Intronic
1133188534 16:4116627-4116649 AAGCGGCGCCGCCCGGGGCGGGG - Intergenic
1133522751 16:6574752-6574774 GAGCCACCACGCCCAGCCCGTGG - Intronic
1134539944 16:15056052-15056074 GAGGCGGGACGCGCGGCCCGAGG - Exonic
1134849814 16:17470667-17470689 CAGCCTCGACTCCGGGGCCGGGG - Exonic
1136023509 16:27455307-27455329 GAGCCACCACGCCCGGCCAGAGG + Intergenic
1138814506 16:60188731-60188753 GAGCCGTCACGCCCGGCCAGAGG - Intergenic
1140440637 16:74985020-74985042 GGGCCGCGGCGGCCGGGCGGGGG - Exonic
1141715356 16:85723901-85723923 CAGCCGCGATGCCCTGGCCCAGG + Intronic
1141972286 16:87492328-87492350 GACCGGGGACGCGCGGGCCGGGG + Intergenic
1142070889 16:88090863-88090885 GGGCCGCGCCGCCCAGGCCTGGG + Intronic
1142187376 16:88701005-88701027 GAGCCGCCTAGCCCGGGCCAGGG - Intronic
1142191244 16:88719131-88719153 GAGCCGCTGTGCCCGGCCCGGGG + Intronic
1142379159 16:89721852-89721874 AACCCGCCACGCCCGGGCCGCGG - Intronic
1142586869 17:979472-979494 GGGACGCGGCGGCCGGGCCGGGG - Exonic
1142643187 17:1296477-1296499 GAGCCGCCACGCCCAGCCCAGGG + Intronic
1142646466 17:1316756-1316778 GAGCCGCCGCGCCCGGCCCCTGG + Intergenic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143070773 17:4291074-4291096 GAGCCACCACGCCCGGCCCTCGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143781722 17:9232740-9232762 GGGCCGCCACACCCGGGACGGGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144070068 17:11663037-11663059 GAGCCACCGCGCCCGGCCCGAGG + Intronic
1144368552 17:14568572-14568594 GAGCCGCCACGCCCGGCCACTGG - Intergenic
1145320176 17:21762006-21762028 GAGCCACCACGCCCAGGCTGTGG - Intergenic
1145828233 17:27893292-27893314 GAGCCGCGCTGCGCAGGCCGAGG - Intronic
1146018666 17:29254827-29254849 GAGCCACCACGCCCGGCCTGTGG + Intergenic
1147000636 17:37359458-37359480 GGGCCGCGAAGGCCGGGCCAGGG - Intronic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1148726014 17:49790479-49790501 GAGCCACCACGCCCGGCCGGTGG + Intronic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1151209141 17:72531011-72531033 GAGCCACCACGCCCGGGCTGGGG - Intergenic
1151304583 17:73254924-73254946 GAGCCACCACGCCCGGACCCAGG + Intronic
1151942658 17:77302393-77302415 GAGCCACCACGCCCGGCCAGGGG - Intronic
1152034909 17:77866207-77866229 GAGCCGCTGCGCCCGGCCCACGG - Intergenic
1152073437 17:78145257-78145279 GAGCCCCGAGGCCAGGGCTGGGG - Intergenic
1152250308 17:79209101-79209123 GAGCCACCACGCCCGGCCCCTGG + Intronic
1152355372 17:79804256-79804278 GAGCCGCCGCGCTCTGGCCGCGG - Intergenic
1153208711 18:2734783-2734805 GAGCCACCACGCCTGGCCCGTGG - Intronic
1154954352 18:21241172-21241194 CAGCCGCGGCGCCCAGGCCCGGG - Intergenic
1160024883 18:75209106-75209128 GAGCCGAGCGGCCCGGGCGGGGG - Exonic
1160453040 18:78978803-78978825 GCGCGGCGACGACGGGGCCGGGG + Intergenic
1160581007 18:79884553-79884575 GAGCTGCCACGCCCAGGCCCAGG - Intronic
1160668388 19:344391-344413 GCGCCGCGGGGCCCGGGCCGGGG + Intronic
1160719535 19:591095-591117 GAGCCGCTCCACCCGAGCCGCGG + Intronic
1161078109 19:2296288-2296310 GAGCCGCCACACCTGGGCTGTGG - Intronic
1161443440 19:4305050-4305072 GGGCCGGGACGCCTGGTCCGCGG - Intronic
1161607524 19:5223046-5223068 GAGCCGCGGCGGCCTGGGCGAGG - Exonic
1163307292 19:16488690-16488712 GAGCCGCGACACCCGGCCTGAGG + Intronic
1163362750 19:16858159-16858181 GAGCCACGGCGCCCAGGCCCTGG + Intronic
1163437320 19:17303250-17303272 GGGCCGCGGGGCCCGGGTCGGGG + Exonic
1163828855 19:19538342-19538364 CAGCAGCGACGCCATGGCCGGGG - Exonic
1165447354 19:35863734-35863756 GAGCCTCCACGCCCGGCCTGAGG + Intronic
1165702828 19:37951612-37951634 GAGCCGCTGCGCCTGGCCCGGGG - Intronic
1166374278 19:42318399-42318421 GAGCCACCACGCCCGGCCTGAGG - Intronic
1167934460 19:52895178-52895200 GAGCCACCACGCCCGGCCCCAGG - Intronic
1168251913 19:55146513-55146535 GAGCGGCCACGCCCGGGCGCGGG + Intronic
1168415769 19:56167224-56167246 GAGCCACCACGCCTGGCCCGGGG + Intergenic
1168544217 19:57237071-57237093 GAGCCACTACGCCCGGCCTGGGG - Intergenic
925143867 2:1568363-1568385 CAGCCGCGACGCAGGGGACGTGG + Intergenic
925725212 2:6865415-6865437 CAGCCGCGCCGCCCGGACCCGGG + Exonic
925789045 2:7464766-7464788 GAGCCACCACGCCCGGCCCTTGG - Intergenic
926090010 2:10043548-10043570 GCGCCGCGAGGGCCGCGCCGGGG + Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
929763265 2:44823698-44823720 GAGCCACCACGCCCGGCCTGTGG - Intergenic
929779725 2:44949819-44949841 GAGCTGAGATGCCCGGCCCGCGG + Intergenic
930788969 2:55303663-55303685 GAGCCACCACGCCCGGCCTGAGG + Intronic
932722155 2:74146275-74146297 GAGCCACCACGCCCGGCCAGGGG + Intronic
932791077 2:74654728-74654750 GAGGCGCGAGGCCCGGGCTGGGG - Intronic
933206317 2:79512603-79512625 GAGTCGCGAGGCCCGGGGAGAGG - Intronic
933776147 2:85772391-85772413 GGGCCGCGGCGGCCGGGCGGGGG - Intronic
933810477 2:86029882-86029904 GAACCACCACGCCCGGCCCGAGG + Intronic
933909233 2:86924437-86924459 GAGCCACCATGCCCGGCCCGTGG + Intronic
934023491 2:87978948-87978970 GAGCCACCATGCCCGGCCCGTGG - Intergenic
936600565 2:113890470-113890492 GACCCGCGAGGCCCTGGCTGCGG - Intronic
937284523 2:120741704-120741726 GAGCGGCGCCGACCGTGCCGCGG + Intronic
938961252 2:136343570-136343592 GAGCCACCACGCCCGGCCTGGGG - Intergenic
940316876 2:152335759-152335781 CAGCTGCGCCGCCCGGCCCGGGG - Intronic
941049686 2:160718680-160718702 GAGCCACCACGCCCAGGCTGTGG + Intergenic
942179538 2:173366828-173366850 GAGCCACCACGCCCGGCCCAGGG + Intronic
944221855 2:197310926-197310948 GAGCCGCGCAGCCCGGCCCCCGG + Intronic
946431001 2:219627471-219627493 GGGCCGCGCCGGCCGGGGCGGGG + Intronic
946431779 2:219630164-219630186 GAGTCGGGAGGCCCGGGCCCGGG - Exonic
947292940 2:228597828-228597850 GAGCCGCTGCGCCCGGCCCCAGG - Intergenic
947650709 2:231784195-231784217 GAGCCACCACGCCCAGGCAGTGG - Intronic
947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG + Intergenic
948118195 2:235509515-235509537 GAGCCACCACGCCCGGCCAGAGG + Intronic
948913217 2:241016478-241016500 GAGCCACCACGCCCGGCCCATGG + Intronic
948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG + Exonic
1169065489 20:2692630-2692652 GAGCGGCCGGGCCCGGGCCGCGG - Intergenic
1171034703 20:21705839-21705861 GAGCCGCGGCGGCCCAGCCGCGG - Exonic
1171469834 20:25361669-25361691 GAGCCACCACGCCCGGTCCCAGG - Intronic
1171780333 20:29411329-29411351 GGGCCGCGTCTCCCGGGCCAGGG + Intergenic
1172015432 20:31870262-31870284 GGGCCGCGGCGGCCGGGGCGGGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172703038 20:36864006-36864028 GAGCCGGGACTCCCGGGCCGAGG + Intergenic
1173611240 20:44369895-44369917 GAGCCGCCGCGCCCGGCCCTGGG + Intronic
1173741727 20:45406641-45406663 GAGCCGCGCCGGCCGGGGTGGGG - Intronic
1174898723 20:54476313-54476335 GAGCTGAGAAGCCCGGGCGGGGG + Intronic
1175877793 20:62238643-62238665 GAGCTGCGGGGCCTGGGCCGCGG + Intronic
1176155394 20:63617598-63617620 GAGCCGTGACTCCGTGGCCGCGG - Intronic
1176155408 20:63617652-63617674 GAGCCGTGACTCCGTGGCCGCGG - Intronic
1176155422 20:63617706-63617728 GAGCCGTGACACCGTGGCCGCGG - Intronic
1176207191 20:63895429-63895451 TGGCGGCGACCCCCGGGCCGGGG + Intronic
1176511391 21:7751176-7751198 GAGCCACCACGCCCGGCCTGCGG - Intronic
1178645505 21:34381705-34381727 GAGCCACCACGCCCGGCCTGCGG - Intronic
1178685909 21:34710527-34710549 GAGCCGCCATGCCTGGCCCGGGG - Intronic
1178939586 21:36893798-36893820 GATCCCCGACCCCCGGGCTGTGG - Intronic
1179324106 21:40322807-40322829 GAGCCACCACGCCCGGCCAGTGG + Intronic
1179529921 21:42011073-42011095 GAGCCCGGACGCCCTGGCCGCGG - Intergenic
1179815225 21:43901496-43901518 GAGCCATGACGCCCGGCCCTAGG - Intronic
1180559139 22:16601729-16601751 GGGCCGCGGGGCCCGGGCGGCGG - Intergenic
1180652466 22:17389593-17389615 GAGCCGCCACGCCCAGCTCGGGG + Intronic
1180960533 22:19760583-19760605 GAGCCGCGGCGGGCGGGCTGGGG + Intronic
1183437735 22:37805062-37805084 GAGCAGGAAGGCCCGGGCCGGGG + Intergenic
1184364120 22:44038494-44038516 GAGCCACCACGCCCGGCCCCAGG - Intronic
1185037962 22:48489568-48489590 AAGCCGCGGCGCCCGCGCGGGGG - Exonic
1185426426 22:50774177-50774199 GAGCCACCGCGCCCGGCCCGTGG + Intronic
950284459 3:11733777-11733799 GAGCCACCACGCCCGGCCAGGGG + Intergenic
950421516 3:12902393-12902415 GAGCCGGGTGGCCCGGGCGGGGG + Intronic
953617784 3:44507596-44507618 GAGCCACCACGCCCGGCCTGGGG + Intronic
955690794 3:61588728-61588750 GAGCCGCCGCGCCCGGCCCTAGG + Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
957270938 3:78029813-78029835 GACCCGAGACGCCGAGGCCGAGG - Intergenic
960120904 3:113947978-113948000 CGGGCGCGCCGCCCGGGCCGCGG + Exonic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
962211797 3:133485914-133485936 GAGCCACGGCGCCCGGCCAGGGG - Intergenic
962644507 3:137423214-137423236 GAGCCACCACGCCCGGCCCTGGG - Intergenic
963038333 3:141051244-141051266 GAGCTGGGACGGCCGGGGCGCGG + Intergenic
964116317 3:153139744-153139766 GAGCCACCACGCCCGGCCCAAGG - Intergenic
964282231 3:155079651-155079673 GCGCCGAGACGCGCGGGGCGCGG + Exonic
966181902 3:177196555-177196577 GGGTCGCCGCGCCCGGGCCGGGG + Intronic
966605735 3:181820043-181820065 GAGCCACCACGCCCGGCCCAAGG + Intergenic
968092809 3:195909102-195909124 GCGCGGCGAGGCCCGGGCCGGGG - Intronic
968104340 3:195990364-195990386 ACCACGCGACGCCCGGGCCGGGG + Intergenic
968132844 3:196202032-196202054 GAGCCACCACGCCCGGCCCCTGG - Intronic
968164345 3:196452529-196452551 GAGCCACCACGCCCGGTCCCAGG + Intergenic
968230795 3:197003474-197003496 AGGCCCCGAAGCCCGGGCCGCGG + Intronic
968521814 4:1037611-1037633 CAGCCCTGAGGCCCGGGCCGCGG + Intergenic
968564389 4:1303102-1303124 GAGCCACCACACCCGGCCCGAGG - Intronic
968674652 4:1871158-1871180 GCGCCGGGAGGGCCGGGCCGCGG - Intergenic
968811460 4:2801338-2801360 GAGCCTCGGGGCCCGGGCAGGGG - Intronic
969074087 4:4563549-4563571 GAGCCACCACGCCCGGCCCGAGG - Intergenic
971338921 4:25749947-25749969 GAGCCACGGCGCCCGGCCTGTGG - Intronic
972225383 4:37005682-37005704 GAGCCACCGCGCCCGGCCCGGGG - Intergenic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
972473738 4:39431533-39431555 GAGCCACCATGCCCGGCCCGAGG + Intronic
974009331 4:56592791-56592813 GAGGCGCGAGGCCCCAGCCGCGG - Intronic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
976742782 4:88374300-88374322 GAGCCACCACGCCCGGCCAGGGG - Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
980130362 4:128811616-128811638 CAGCTGCGCCGCCCGGGCCGGGG + Intronic
981581434 4:146252156-146252178 GAGCCACCACGCCCGGCCTGGGG - Intergenic
985446220 4:190022394-190022416 GGGCCGCGTCTCCCGGGCCAGGG + Intergenic
985452152 4:190068184-190068206 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
985453136 4:190071481-190071503 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985454126 4:190074774-190074796 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985455114 4:190078067-190078089 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985456102 4:190081367-190081389 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985457086 4:190084661-190084683 GGGCCGCGTCTCCCGGGCCAGGG - Intergenic
985458073 4:190087954-190087976 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985459062 4:190091254-190091276 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985463315 4:190174023-190174045 GGGCCGCGTCTCCCGGGCCAGGG - Exonic
985995397 5:3594760-3594782 GAGCCGCACGGCCAGGGCCGCGG + Intergenic
986315303 5:6583031-6583053 GAGCCCCGACGCCCGAGAAGCGG - Intergenic
986330816 5:6714633-6714655 GGGCCGCGGCGCCTGGGCCCCGG - Exonic
987453170 5:18111403-18111425 GAGCCACCACGCCCGGCCCTGGG - Intergenic
988780372 5:34515786-34515808 GAGCCACCACACCTGGGCCGAGG - Intergenic
988796214 5:34656067-34656089 CAGCCGGGACGCGCGGGCCGGGG + Intergenic
988940717 5:36143007-36143029 GAGCCACCACGCCCGGCCCTTGG + Intronic
989321904 5:40144544-40144566 GAGCCACCACGCCCGGCCCCAGG + Intergenic
990282825 5:54269927-54269949 GAGCCACCACGCCCGGCCTGAGG + Intronic
991334338 5:65530085-65530107 GAGCCACCACGCCCGGCCCCAGG + Intronic
992475714 5:77099892-77099914 GAACCACAACGCCCGGCCCGGGG + Intergenic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
997265008 5:132490371-132490393 GAGCTGCGAGCCGCGGGCCGCGG - Intronic
998463273 5:142324652-142324674 GCGCCGTGCCGGCCGGGCCGAGG + Intronic
999130834 5:149282034-149282056 GAGCCGGGAGGGCCCGGCCGGGG + Intronic
999317489 5:150593742-150593764 GAGCCACCACGCCCGGGGTGTGG + Intergenic
1001472572 5:172025293-172025315 GAGCCACCACGCCCGGCCTGTGG - Intergenic
1001653278 5:173329842-173329864 GGGCCGCGTCGCCTGGGCAGTGG - Intergenic
1002501032 5:179647813-179647835 GAGCCACCACGCCCGGCCCTTGG - Intergenic
1003139152 6:3456742-3456764 GGGCCGCAGCGCCCGGGGCGCGG - Intronic
1005523796 6:26625781-26625803 GAGCCACCACGCCCGGGCAATGG - Intergenic
1005641078 6:27797002-27797024 GAGCCACCACGCCCGGCCTGAGG - Intergenic
1006194565 6:32230751-32230773 GAGCCACCACGCCCGGCCTGAGG - Intergenic
1006776421 6:36596205-36596227 GAGCCGCCGCGCCCGGTCCATGG + Intronic
1007424020 6:41735372-41735394 GAGCCGCGGGGCGCGGGCGGCGG - Intronic
1007431486 6:41779822-41779844 GCCCGGCGCCGCCCGGGCCGCGG - Exonic
1010703296 6:79077755-79077777 GAGCCCCGCGCCCCGGGCCGCGG + Intronic
1011607362 6:89118066-89118088 CAGCCTGGACGCACGGGCCGGGG + Exonic
1014678430 6:124397967-124397989 GAGCCACCACGCCCGGCCCCGGG - Intronic
1015390881 6:132680447-132680469 GAGCCACCATGCCCGGCCCGTGG - Intergenic
1016049731 6:139518352-139518374 GAGCCACCACGCCCGGCCCTGGG - Intergenic
1016570973 6:145512428-145512450 GAGCCACCACGCCCGGCCTGGGG - Intronic
1016990331 6:149923917-149923939 GAGCCACCACGCCTGGCCCGGGG + Intergenic
1017460285 6:154643038-154643060 GAGCCACCACGCCCGGCCCCAGG - Intergenic
1017895239 6:158673797-158673819 GAGCCACCACGCCCGGCCCGAGG - Intronic
1019171838 6:170137144-170137166 GAGCCCCGACGCCTGGACCACGG - Intergenic
1019440587 7:1044445-1044467 TAGCCGCGAGGGCGGGGCCGGGG + Intronic
1019536163 7:1530912-1530934 GGGCAGCGGGGCCCGGGCCGCGG + Intronic
1019554103 7:1620015-1620037 GAGCCCTGAGGCCCGGGCGGGGG - Intergenic
1020010735 7:4804500-4804522 GAGCCGCCACCCCCGGCCAGGGG - Intronic
1021455351 7:20824125-20824147 GAGCCACCACGCCCGGTCAGCGG + Intergenic
1021969225 7:25950930-25950952 GGGCTGCGTCCCCCGGGCCGGGG + Intergenic
1022321734 7:29294148-29294170 GAGCCACGGCGCCCGGCCTGAGG + Intronic
1024520911 7:50303920-50303942 GAGCCGGGCTGCCCGGCCCGCGG + Intergenic
1025078707 7:55964567-55964589 CAGCGGCGGCGCCCGGGCGGTGG + Exonic
1026257089 7:68721761-68721783 GAGCCACCATGCCCGGCCCGAGG - Intergenic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1026840562 7:73668168-73668190 GGGCCGCGCGGGCCGGGCCGCGG + Intronic
1026957592 7:74387533-74387555 GAGCCACCACGCCCGGCCCCTGG + Intronic
1029082542 7:97986195-97986217 GAGCCACCACGCCCAGCCCGTGG + Intronic
1029228678 7:99048101-99048123 GAGCCACCACGCCCGGCCTGGGG - Intronic
1029671757 7:102037634-102037656 GAGCCACCACGCCCGGCCCTGGG + Intronic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032351188 7:131165467-131165489 GAGCCACCACGCCCGGCCCAAGG + Intronic
1034052558 7:147998393-147998415 GAGCCACGGCGCCCGGCCCATGG + Intronic
1034223086 7:149460451-149460473 GAGGGGCGGCGCGCGGGCCGGGG - Intronic
1034337823 7:150334731-150334753 GAGCCACCACACCCGGCCCGGGG - Intronic
1034425483 7:151011806-151011828 GAGCCACCGCGCCCGGACCGAGG + Intronic
1034911502 7:155002473-155002495 GAGCCGAGACGCCCGGCGCGGGG + Intronic
1035029359 7:155847410-155847432 GAGCCGTGACTGCAGGGCCGAGG + Intergenic
1035355161 7:158272250-158272272 GAGCCGCGTCTCCGGGGCCCGGG + Intronic
1035552905 8:544273-544295 GGCCCACGACGCCCGCGCCGCGG + Intronic
1036574984 8:10019096-10019118 GAGCCGCCATGCCCGGTCCTGGG + Intergenic
1037811479 8:22089411-22089433 GGGCAGGGACCCCCGGGCCGCGG + Intronic
1037903826 8:22703770-22703792 GCCCCCCGCCGCCCGGGCCGCGG + Intergenic
1038540410 8:28386040-28386062 GAGCCGAGCCGTCCGAGCCGGGG - Intronic
1038765867 8:30427113-30427135 GAGCCACGAGGCCCAGGCTGAGG - Intronic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1039606578 8:38885585-38885607 GAGCCACCGCGCCCGGCCCGAGG + Intergenic
1039936597 8:42051641-42051663 GGGCGGCGGCGCGCGGGCCGCGG + Intronic
1040881130 8:52205850-52205872 GAGCCACTACGCCCGGCCAGTGG + Intronic
1041552604 8:59118809-59118831 GAGCGGCGGTGGCCGGGCCGCGG - Intronic
1043127121 8:76413057-76413079 GAGCCACCGCGCCCGGGCCATGG - Intergenic
1044958378 8:97505186-97505208 GAGCCACCACGCCCGGCCAGTGG + Intergenic
1047247182 8:123156154-123156176 GAGCCACCACGCCCGGCCCCTGG - Intergenic
1048281421 8:133108268-133108290 GAGCCACCACGCCCGGCCTGGGG + Intronic
1049585223 8:143429887-143429909 CGCCCGCGAAGCCCGGGCCGCGG + Exonic
1049866944 8:144945555-144945577 GAGCCACCACACCCGGGCCAAGG + Intronic
1050537752 9:6645344-6645366 GAGGCGCGAGGCCCCAGCCGCGG + Exonic
1050617705 9:7419864-7419886 GAGCCACAATGCCCGGCCCGGGG - Intergenic
1051297999 9:15617658-15617680 GAGCCACCACGCCCGGCCTGTGG + Intronic
1052925254 9:34010089-34010111 GAGCCACCACGCCCAGCCCGAGG + Intronic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053215716 9:36268843-36268865 GAGCCACCACGCCCGGCCTGTGG - Intronic
1053381189 9:37650826-37650848 GCGCCGCGACCCCCGCCCCGGGG - Intronic
1054781987 9:69174168-69174190 GAGGCGCCACGCTCGGGTCGGGG + Intronic
1055997345 9:82174572-82174594 GAGCCGCCGCGCCCGGCCCAAGG - Intergenic
1058033521 9:100225330-100225352 GAGCCACCACGCCCGGCCCTGGG + Intronic
1059109130 9:111538228-111538250 GAGCCGCCATGCCCAGCCCGTGG - Intronic
1060125211 9:121037593-121037615 GAGCCACCACGCCCGGCCAGTGG + Intronic
1060215495 9:121736288-121736310 GCGCCGCGAGAGCCGGGCCGCGG + Intronic
1060598363 9:124861723-124861745 GAGGCGCGCGGCCCGGGCCTGGG - Intronic
1060811740 9:126614285-126614307 GAGCGGCGACGCGCTGGCCCCGG - Intergenic
1060918527 9:127405037-127405059 GAGCCGCCACAGCAGGGCCGGGG - Intronic
1060943494 9:127556788-127556810 GAGCCACCACGCCCAGCCCGTGG - Intronic
1061248047 9:129411506-129411528 GAGCCACCACGCCCGGCCCAGGG + Intergenic
1061365936 9:130172508-130172530 GCGCCGGGGCGCCCGGGGCGTGG - Intergenic
1061966560 9:134017698-134017720 GAGCCACCACGCCCGGCCAGGGG - Intergenic
1062458856 9:136654437-136654459 GAGCCACCACGCCCGGCCAGCGG - Intergenic
1062656246 9:137605655-137605677 GAGCCGGGACTCGCGGGCGGCGG + Exonic
1203781621 EBV:104180-104202 GGGCTGCCACCCCCGGGCCGTGG + Intergenic
1185773463 X:2783688-2783710 GAGCCCCCACGCCCGGCCTGAGG - Intronic
1185933755 X:4232502-4232524 GAGCCACCACGCCCAGGCCCTGG - Intergenic
1186392462 X:9174706-9174728 GAGCCACCACGCCCGGCCCCTGG - Intergenic
1186417407 X:9395606-9395628 GAGCCACTACGCCCGGCCCCTGG + Intergenic
1187234098 X:17450589-17450611 GAGCCACCACGCCCGGCCCAGGG - Intronic
1187821619 X:23293727-23293749 GAGCCACCACGCCCAGCCCGTGG - Intergenic
1188551432 X:31368928-31368950 GAGCCACCATGCCCGGCCCGAGG + Intronic
1189747477 X:44184436-44184458 GAGCCACCACGCCCGGCCAGAGG - Intronic
1190093375 X:47459456-47459478 GAGCCTCCACGCCCAGGCCCTGG - Intronic
1190265576 X:48825873-48825895 GAGCCACCACTCCCGGGCCAGGG + Intergenic
1191118845 X:56881577-56881599 GAGCCACCATGCCCGGCCCGAGG - Intergenic
1195138344 X:101932704-101932726 GAGCCACCACGCCCGGCCCCTGG + Intergenic
1195625110 X:106999572-106999594 GAGCCGCGCGGGGCGGGCCGGGG - Intronic
1195716987 X:107826828-107826850 AAGGGGCGACGCCTGGGCCGAGG - Intronic
1195944236 X:110192070-110192092 GATCCCCAACCCCCGGGCCGTGG - Intergenic
1196886516 X:120251148-120251170 GAGCCGCGAGGGCCGCGGCGCGG + Intronic
1198375423 X:136034109-136034131 GATCCCCAACTCCCGGGCCGCGG + Intronic
1199500296 X:148500387-148500409 GACCCGGGACGCAGGGGCCGTGG - Intergenic
1199772646 X:150984161-150984183 GAGCCGCCCGCCCCGGGCCGCGG - Intronic
1200284305 X:154805577-154805599 GAGCCGCGGAGTCCGGGGCGTGG - Intronic