ID: 1143053109

View in Genome Browser
Species Human (GRCh38)
Location 17:4142892-4142914
Sequence CGCCCAAGACGGAGACCCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143053109 Original CRISPR CGCCCAAGACGGAGACCCCA TGG (reversed) Exonic
922725726 1:227922202-227922224 TGCCCAAGACAGAGGCTCCAGGG + Intronic
924258731 1:242208440-242208462 TGCCTAAGACAGAGACCCTATGG - Intronic
1067089753 10:43260557-43260579 CTCCCCAGACCCAGACCCCACGG + Intronic
1073072740 10:100805329-100805351 AGCCCATGCCGGAGGCCCCAGGG - Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083890938 11:65595526-65595548 TGCCCAGGGTGGAGACCCCATGG + Exonic
1090472882 11:126995968-126995990 CACCCAAGAGGGGGACCCCATGG + Intronic
1092631430 12:10381945-10381967 AGCAAAAGACAGAGACCCCATGG + Intronic
1094870998 12:34599250-34599272 TGCCCAAGAGGGACAGCCCAAGG + Intergenic
1102298488 12:111755004-111755026 CGTCCAAAACAGAGGCCCCAAGG - Intronic
1104490890 12:129192193-129192215 CACCCAGGATGGAGGCCCCAGGG - Intronic
1104958332 12:132476632-132476654 TGCCCATGCCGGACACCCCACGG + Intergenic
1114634926 14:24182019-24182041 CGCCCAAGAGGCAGACCCCGAGG - Exonic
1117403765 14:55381779-55381801 CACCCCAGACAGAAACCCCATGG - Intronic
1121006177 14:90491951-90491973 AGCCCAGGAGGGAGACCCCAGGG - Intergenic
1123110558 14:105865068-105865090 AGCCCATGGCGGAGACCCCAGGG + Intergenic
1128240177 15:66096274-66096296 CGCCCTCGGCAGAGACCCCAGGG - Intronic
1129680607 15:77656550-77656572 AGCCCAAGCCCCAGACCCCAAGG - Intronic
1130900783 15:88205648-88205670 CCCCCAAAACGGTGACTCCAGGG + Intronic
1132028345 15:98421164-98421186 GCCCCAAGCCAGAGACCCCAAGG - Intergenic
1140332796 16:74073886-74073908 CGCTGAAGGCGGAGAACCCAGGG + Intergenic
1142178303 16:88655198-88655220 CGCCCACCACGGGGACACCAAGG - Exonic
1142200222 16:88757594-88757616 CACCCAGGAAGGAGAGCCCATGG + Intronic
1143053109 17:4142892-4142914 CGCCCAAGACGGAGACCCCATGG - Exonic
1146649426 17:34597611-34597633 AGCCCAAGGCTGACACCCCATGG + Intronic
1150703721 17:67469331-67469353 AGCTCAAAACGGAGACCACAGGG - Intronic
1158398291 18:57097022-57097044 CGCCCATGACTGAGACCCACTGG + Intergenic
1160566492 18:79789554-79789576 CTCCCAGGATGGAAACCCCACGG + Intergenic
1160900893 19:1427857-1427879 CTCTCCAGACTGAGACCCCAAGG + Intronic
1161684557 19:5696422-5696444 CGCCCAGTGGGGAGACCCCAGGG + Intronic
1163721435 19:18899974-18899996 AGCCGAACACGGGGACCCCACGG + Intronic
1166947502 19:46405918-46405940 CGGCCTTGACAGAGACCCCAGGG - Intergenic
1167239991 19:48338076-48338098 TGCCCAAGACATAGACCCCAGGG - Intronic
1168153569 19:54461416-54461438 CCCCAAACACGGAGGCCCCAAGG - Exonic
925319059 2:2948231-2948253 CACCTAAGACAGAGACCCCAGGG + Intergenic
931735100 2:65186658-65186680 AGCCCAATACAGAGCCCCCAAGG - Intergenic
940792099 2:158039874-158039896 GGCCCTAGACTGAGGCCCCAGGG + Intronic
946101279 2:217326615-217326637 GGCCCAAGTGAGAGACCCCAGGG + Intronic
1180385557 22:12175078-12175100 CCCCCAGCACGGACACCCCAAGG + Intergenic
1180844032 22:18971815-18971837 CGCCCGAGGCGGGGACCCCCAGG - Intergenic
1181438342 22:22923083-22923105 CACCCAACACTGAGAACCCAGGG - Intergenic
1183037477 22:35151098-35151120 CGCACAGGAGGGAGACCACATGG + Intergenic
1183546159 22:38455645-38455667 CGACGGAGACGGAGACCCCGCGG - Intergenic
1184861983 22:47177490-47177512 TGCCCAAGACTCAGACCCCTCGG + Intergenic
968708220 4:2093660-2093682 CCCCCAAGACAGAGGCCCCAGGG + Intronic
968909738 4:3471569-3471591 CGCGCAGGACGGGGGCCCCAGGG - Intronic
969720645 4:8891646-8891668 CGCCCAAAACCGAGAACCCGCGG + Intergenic
974652961 4:64778639-64778661 AGTTCAAGACAGAGACCCCAGGG + Intergenic
976325048 4:83761965-83761987 CTCACAAGACAGTGACCCCATGG - Intergenic
978238343 4:106487416-106487438 CTCCCTAGACAGAGCCCCCAGGG - Intergenic
979013106 4:115396233-115396255 CTCCCTAGACAGAGCCCCCAGGG - Intergenic
993102597 5:83559485-83559507 CGCCCAGGAGTGAGAACCCATGG - Intronic
998213348 5:140218379-140218401 CTCCCAAGACAGAGACCTGAAGG - Intronic
1002616768 5:180461064-180461086 CGGCCAAGACGGAGAATCCTGGG + Intergenic
1002932589 6:1644648-1644670 CGCCCAGGAAGGAGATCCCAAGG + Intronic
1003491978 6:6630715-6630737 CGACCAAGATGGAGACCCACTGG - Intronic
1008540059 6:52538465-52538487 CGCCCAAGACCCAGAGCCCAGGG - Intronic
1012948826 6:105495957-105495979 CCCCTATGACTGAGACCCCAAGG + Intergenic
1015902495 6:138082411-138082433 GGCCCACGTCTGAGACCCCATGG + Intergenic
1022778318 7:33551559-33551581 CAGCCAAGACTGAGACCCCAAGG + Intronic
1029193095 7:98785685-98785707 CTCCCAAGATGGAGCCCCCAGGG + Intergenic
1031555782 7:123174417-123174439 TGCCCAAGACAGAGACCTAAAGG + Intronic
1032165540 7:129541922-129541944 CGCCCAAGACAGAGAGACAAAGG + Intergenic
1044749443 8:95402067-95402089 AGAACAAGACAGAGACCCCAGGG - Intergenic
1048228461 8:132613551-132613573 CACCCCAGAAGGAAACCCCATGG - Intronic
1049637116 8:143694966-143694988 CGCCCAAGACAGAGACAAGAAGG - Exonic
1060872741 9:127055875-127055897 CACCCAAGACAGAGACCCAAAGG - Intronic
1061199221 9:129126930-129126952 CGCCTAAGACTGAGATCCCTGGG + Intronic
1061726907 9:132587102-132587124 CGCCCGAGGCCGAGACCCCCCGG - Intronic
1061930436 9:133829903-133829925 CTCCCAAGACCCAGGCCCCATGG - Intronic
1062534701 9:137016319-137016341 GGCCCAAGAAGGAGACCACCTGG + Exonic
1203699907 Un_GL000214v1:126140-126162 CCCCCAGCACGGACACCCCAAGG - Intergenic
1203479641 Un_GL000224v1:730-752 CCCCCAGCACGGACACCCCAAGG - Intergenic
1203480609 Un_GL000224v1:7026-7048 CCCCCAGCACGGACACCCCAAGG - Intergenic
1203481574 Un_GL000224v1:13354-13376 CCCCCAGCACGGACACCCCAAGG - Intergenic
1192254345 X:69443051-69443073 CTCCCAGGACAGAGCCCCCAGGG - Intergenic
1196842568 X:119871929-119871951 CGCCCATGACGGAGAGTCCGGGG - Exonic