ID: 1143053620

View in Genome Browser
Species Human (GRCh38)
Location 17:4146183-4146205
Sequence ACAAGAATATTGAACCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 3, 2: 6, 3: 33, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143053620_1143053629 9 Left 1143053620 17:4146183-4146205 CCTCCCGGGTTCAATATTCTTGT 0: 1
1: 3
2: 6
3: 33
4: 189
Right 1143053629 17:4146215-4146237 TCCCGAGGAGCTAGGATTACAGG 0: 24
1: 2251
2: 57843
3: 262126
4: 594087
1143053620_1143053632 28 Left 1143053620 17:4146183-4146205 CCTCCCGGGTTCAATATTCTTGT 0: 1
1: 3
2: 6
3: 33
4: 189
Right 1143053632 17:4146234-4146256 CAGGCGTGTGCCACCATGTCTGG 0: 71
1: 2148
2: 22363
3: 82628
4: 180719
1143053620_1143053625 1 Left 1143053620 17:4146183-4146205 CCTCCCGGGTTCAATATTCTTGT 0: 1
1: 3
2: 6
3: 33
4: 189
Right 1143053625 17:4146207-4146229 CCCCAGCCTCCCGAGGAGCTAGG 0: 17
1: 1877
2: 110558
3: 304716
4: 331069
1143053620_1143053623 -6 Left 1143053620 17:4146183-4146205 CCTCCCGGGTTCAATATTCTTGT 0: 1
1: 3
2: 6
3: 33
4: 189
Right 1143053623 17:4146200-4146222 TCTTGTGCCCCAGCCTCCCGAGG 0: 2
1: 16
2: 168
3: 1121
4: 2629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143053620 Original CRISPR ACAAGAATATTGAACCCGGG AGG (reversed) Intronic
901256840 1:7836267-7836289 AGGAGAATCTTGAACCTGGGAGG - Intronic
901399774 1:9007826-9007848 AGGGGAATCTTGAACCCGGGAGG - Intronic
902912919 1:19614163-19614185 ACTTGATTCTTGAACCCGGGAGG - Intronic
904261591 1:29290842-29290864 CCCAGAAGATGGAACCCGGGAGG - Intronic
904394496 1:30209678-30209700 AGAATCATTTTGAACCCGGGAGG - Intergenic
904412418 1:30332531-30332553 CCCAGAAGATGGAACCCGGGAGG - Intergenic
906127137 1:43433688-43433710 AGAAGAATCTTGAACCTGGGAGG + Intronic
906500113 1:46335729-46335751 ACAAGAATCTCGAACCTGGGAGG + Intergenic
910423699 1:87098869-87098891 AGAAGAATTGTGAACCCAGGAGG - Intronic
910836497 1:91518002-91518024 GCAGGAGAATTGAACCCGGGAGG + Intronic
911105851 1:94130768-94130790 AGGAGAATGGTGAACCCGGGAGG + Intergenic
911601418 1:99852041-99852063 ACAAGAATATGCAACAGGGGAGG - Intronic
912589298 1:110798734-110798756 ACAAGAATATTGGTCCCTGAGGG + Intergenic
912926199 1:113915441-113915463 GCAAGAGAATTGAACCCAGGAGG - Intergenic
913212223 1:116591051-116591073 ACAAAAAAGATGAACCCGGGAGG - Intronic
913689294 1:121263339-121263361 AAAAAAAACTTGAACCCGGGAGG + Intronic
914148305 1:145016936-145016958 AAAAAAAACTTGAACCCGGGAGG - Intronic
914689893 1:150016542-150016564 AGGAGAAGTTTGAACCCGGGAGG - Intergenic
914697349 1:150097175-150097197 AGGAGAATCTTGAACCCAGGAGG - Intronic
914771272 1:150687483-150687505 ACAGGAGAATTGAACGCGGGAGG + Intronic
916900193 1:169214361-169214383 ACATGACTATAGAACCCGTGTGG + Intronic
917818504 1:178736251-178736273 AGGAGAATCTTGAACCCAGGAGG - Intronic
919323571 1:196075906-196075928 AGGAGAATAGTGAACCCAGGAGG - Intergenic
919723004 1:200861350-200861372 ATAAAAATATTTAACCCGGCCGG + Intergenic
920287276 1:204889675-204889697 ACAAGGATATTGCACACTGGGGG - Intronic
920319198 1:205104747-205104769 AGGAGAATCTTGAACCCAGGAGG + Intronic
920476617 1:206281822-206281844 AAAAAAAACTTGAACCCGGGAGG + Intronic
921383510 1:214548631-214548653 ACAAGAATATGGAACCCAGGGGG + Intronic
922519352 1:226234979-226235001 ATAAGTATATTGAACCTGGGAGG - Intronic
924852975 1:247849326-247849348 GCAGGAGAATTGAACCCGGGAGG - Intergenic
1066682255 10:37945574-37945596 AGAATCACATTGAACCCGGGAGG - Intergenic
1068572476 10:58645315-58645337 AGGAGAATGGTGAACCCGGGAGG + Intronic
1069018115 10:63454347-63454369 ATGAGAATCTTGAACCAGGGTGG - Intronic
1069179571 10:65341328-65341350 ATAAGACTATTAAACCTGGGAGG - Intergenic
1070121934 10:73585919-73585941 AGGAGAATCTTGAACCCGGGAGG + Intronic
1072740180 10:97904509-97904531 ACAGGAATCTTGAGCCCAGGAGG - Intronic
1073807690 10:107117345-107117367 ACAAGAACAATGACCCCGGAAGG + Intronic
1074093663 10:110287980-110288002 AGGAGAATCTTGAACCTGGGAGG + Intergenic
1074519113 10:114200943-114200965 AGGAGAATCTCGAACCCGGGAGG - Intronic
1075769778 10:124923500-124923522 AGGAGAATCTTGAACCCAGGAGG + Intergenic
1078370388 11:10739817-10739839 ACAAGAATCTTGAACCCGGGAGG + Intergenic
1081974444 11:47223391-47223413 ATGAGAATCTTGAACCTGGGAGG + Intronic
1082134735 11:48534071-48534093 ACAAGAAAAATGAAACAGGGGGG - Intergenic
1083477732 11:62924986-62925008 ATAAGAATATAGAGGCCGGGCGG - Intergenic
1083578585 11:63810484-63810506 AGGAGAATCTTGAACCTGGGAGG + Intergenic
1084377324 11:68786618-68786640 AGGAGAAGCTTGAACCCGGGAGG - Intronic
1084377429 11:68787342-68787364 AGGAGAAGCTTGAACCCGGGAGG + Intronic
1084954775 11:72685391-72685413 ACAAGGACAGTGAACCCGGTGGG + Exonic
1085498411 11:76994219-76994241 ATAAGAATAACGAACCTGGGAGG - Intronic
1086947879 11:92861320-92861342 ACAAAAATATTGAACCTGAATGG + Intronic
1087308714 11:96514777-96514799 TCAAGAATATTAACCCTGGGAGG - Intergenic
1089509485 11:118987291-118987313 AGGAGAAGCTTGAACCCGGGAGG - Intergenic
1089971086 11:122693779-122693801 AAGAGAATCTTGAACCCGGGAGG + Intronic
1090216624 11:124972498-124972520 ACAAAAACATAGAACCCAGGGGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090744335 11:129694429-129694451 ATAAGAATACTGAACCAGAGCGG - Intergenic
1090836370 11:130457139-130457161 ACGAGATGCTTGAACCCGGGAGG + Intronic
1091501863 12:1025886-1025908 ATAAGAAGCTTGAACCCAGGCGG - Intronic
1092733525 12:11557383-11557405 ACAAGAAAATTGTAACTGGGTGG - Intergenic
1093300382 12:17446101-17446123 AGGAGAATCTTGAACCTGGGAGG + Intergenic
1093411241 12:18870032-18870054 TAAAGAATATTGAACCTGGCTGG + Intergenic
1094569848 12:31632146-31632168 AGGAGAATCTTGAACCCGGGAGG - Intergenic
1095473708 12:42564164-42564186 AGGAGAATCGTGAACCCGGGAGG + Intronic
1095538748 12:43283311-43283333 ACAAGAATATGAAACACTGGTGG - Intergenic
1096156644 12:49345086-49345108 TCAGGAATATCGACCCCGGGCGG - Intergenic
1096785194 12:54013269-54013291 ACTAGAATAATGAACCGGGTGGG + Intronic
1097024055 12:56041302-56041324 AGGAGAATCTTGAACCTGGGAGG - Intergenic
1100814410 12:98372417-98372439 ACAAGAAAACTGAAGCAGGGAGG + Intergenic
1102094477 12:110225874-110225896 AGGAGAATCTTGAACCCAGGAGG + Intergenic
1105215470 13:18281674-18281696 ACAAAAAAGATGAACCCGGGAGG - Intergenic
1109859318 13:68176893-68176915 ACAAGAAAATTGAACTCAGTGGG + Intergenic
1110214944 13:73014876-73014898 ACAGGAGAATTGAACCTGGGAGG - Intronic
1112522972 13:100114506-100114528 GCAAGAAGCTTGAACCTGGGAGG + Intronic
1114320642 14:21544471-21544493 AGGAGAATCTGGAACCCGGGAGG + Intergenic
1117591469 14:57273029-57273051 AGGAGAATCTTGAACCCGGGAGG - Intronic
1119775740 14:77247587-77247609 ATAAGAATATTAAACTAGGGGGG + Intronic
1123702004 15:22921674-22921696 AGAAGTAGCTTGAACCCGGGAGG + Intronic
1124108286 15:26761922-26761944 ACAAGAATCTTGAACCCGGGAGG - Intronic
1125101638 15:35919835-35919857 ACATGGATATTGAAGCCAGGGGG - Intergenic
1125818877 15:42610636-42610658 AGGAGAAGCTTGAACCCGGGCGG - Intronic
1125923515 15:43541632-43541654 ACTTGAACCTTGAACCCGGGAGG + Intronic
1126019684 15:44388182-44388204 ACAATAATCTTGAACCTGGGAGG + Intronic
1126050153 15:44677927-44677949 AGGAGAATCTTGAACCCGGGAGG - Intronic
1129146160 15:73649256-73649278 AAAAAGATCTTGAACCCGGGTGG + Intergenic
1131087741 15:89591213-89591235 AGGAGAAGCTTGAACCCGGGAGG - Intronic
1132649923 16:1015953-1015975 AGGAGAATATTGAAACCAGGAGG + Intergenic
1133177910 16:4029653-4029675 AAAAGAATGTTGAACCCGGGAGG + Intronic
1133397159 16:5457224-5457246 AGGAGGATCTTGAACCCGGGAGG - Intergenic
1133811192 16:9162273-9162295 AGGAGAATCTTGAACCCGGGAGG - Intergenic
1133811952 16:9167573-9167595 AGGAGAATCTTGAACCTGGGAGG - Intergenic
1134895196 16:17880061-17880083 ACAAGAAATTTGAAACCAGGAGG - Intergenic
1135034375 16:19064749-19064771 AGGAGAATGGTGAACCCGGGAGG - Intergenic
1136460041 16:30404587-30404609 GCAGGAGAATTGAACCCGGGAGG + Intergenic
1140667798 16:77243813-77243835 AAGAGGATCTTGAACCCGGGAGG - Intergenic
1142045333 16:87921666-87921688 ACAGGAATGTTGGACCCAGGAGG + Intronic
1142298808 16:89244332-89244354 ATGAGAATCTTGAACCTGGGAGG + Intergenic
1142654219 17:1380201-1380223 AGGAGACTCTTGAACCCGGGAGG - Intronic
1142993816 17:3749342-3749364 AGGAGAATGGTGAACCCGGGAGG - Intronic
1143053620 17:4146183-4146205 ACAAGAATATTGAACCCGGGAGG - Intronic
1144569377 17:16386455-16386477 ACAAGCATTTTGAACCCAGGAGG + Intergenic
1144653230 17:17019810-17019832 AGAAGGAAATTGAACCAGGGAGG + Intergenic
1144822032 17:18082037-18082059 AGGAGAAGCTTGAACCCGGGAGG - Intergenic
1145361631 17:22216922-22216944 GCAAGCATTTTGAACCCGGGAGG + Intergenic
1148570956 17:48668689-48668711 AGGAGAATGGTGAACCCGGGAGG - Intergenic
1149562955 17:57622105-57622127 AGAAGAATCTTGAACCCGGGAGG + Intronic
1149708412 17:58716858-58716880 AGGAGAATGGTGAACCCGGGAGG - Intronic
1150105797 17:62461673-62461695 AGGAGAATCTTGAACCTGGGAGG - Intronic
1151754602 17:76066358-76066380 AGGAGAAGCTTGAACCCGGGAGG + Intronic
1153047411 18:869733-869755 AGGAGAATCTTGAACCCAGGAGG - Intergenic
1155010515 18:21773172-21773194 AGGAGAAGCTTGAACCCGGGAGG + Intronic
1155950507 18:31906247-31906269 ACAAGAATCTTGAACCCGGGAGG + Intronic
1157887888 18:51385899-51385921 ACATGAATATTGCCTCCGGGGGG + Intergenic
1159622603 18:70655868-70655890 AGGAGAATGGTGAACCCGGGAGG - Intergenic
1160724617 19:612503-612525 ACGAGTCTCTTGAACCCGGGAGG - Intronic
1161387429 19:4003439-4003461 ACAAAAAGCTTGAACCCAGGAGG - Intergenic
1162591504 19:11595350-11595372 AAAAAATTATTGAACCTGGGAGG - Intronic
1163009246 19:14414440-14414462 AGGAGAATCTTGAACCCTGGAGG - Intronic
1163325582 19:16600998-16601020 GCACGAAAATTGAACCCAGGAGG + Intronic
1163843080 19:19623394-19623416 ACAAGAATCTGGAACCTGGGAGG + Intergenic
1164991135 19:32685056-32685078 ATGGGAATGTTGAACCCGGGAGG - Intergenic
1166142513 19:40812611-40812633 AGGAGAATCTTGAACCTGGGAGG - Intronic
1166568040 19:43776990-43777012 ACCAGAATCTTGAACCCAGGAGG + Intronic
1167281329 19:48570812-48570834 AGGAGAATCTTGAACCTGGGAGG - Intronic
1167993214 19:53378363-53378385 AGGAGAATCTTGAACCCGGGAGG + Intronic
1168279621 19:55297902-55297924 AGGAGAATCTTGAACCTGGGAGG - Intronic
925492544 2:4411115-4411137 AAAAGAATACTGATCCCGGCCGG + Intergenic
926017733 2:9469440-9469462 ACAAGAATAGAAAACCCGTGTGG + Intronic
927608690 2:24514194-24514216 GGGAGAATCTTGAACCCGGGAGG + Intronic
928716539 2:34067695-34067717 AGGAGAATCGTGAACCCGGGAGG + Intergenic
929998337 2:46843869-46843891 ATGACAATCTTGAACCCGGGAGG - Intronic
930311091 2:49740522-49740544 ACAAGAATATTAACCTCGGCCGG + Intergenic
930767983 2:55104440-55104462 ACGAGAATCATGAACCCAGGAGG - Intronic
931360401 2:61573123-61573145 GGAAGAGAATTGAACCCGGGAGG - Intergenic
932588555 2:73048305-73048327 ACAAGAATTTTGAACTCGGGAGG - Intronic
934298860 2:91765053-91765075 ACAAAAAAGATGAACCCGGGAGG + Intergenic
935143545 2:100377405-100377427 ACAAGCATGTTGAACCCGTATGG - Intergenic
935650435 2:105377537-105377559 AGGAGAATCTTGAACCCGGGAGG + Intronic
936072645 2:109381556-109381578 ACAAGAACATGGAAGCCCGGGGG - Intronic
936944044 2:117914686-117914708 ACAAGAATATGGAAGCAGGTGGG + Intergenic
939215163 2:139227895-139227917 ACGAGAATCTTGAACCTGGAAGG - Intergenic
941369325 2:164644777-164644799 ACAAAAATATTGAATCCCGGAGG + Intergenic
944067162 2:195631094-195631116 AGGAGAATCTTGAACCCAGGGGG + Intronic
944133891 2:196376840-196376862 AGGAGAATCTCGAACCCGGGAGG + Intronic
945084440 2:206116927-206116949 GCAGGAAAACTGAACCCGGGAGG + Intronic
945227567 2:207548022-207548044 ACAAGAATGCTGTACCCGGGAGG - Intronic
1169345597 20:4825735-4825757 AGGAGAATCTTGAACCTGGGAGG - Intergenic
1172015943 20:31872937-31872959 ACAGGAAAATTTAACCTGGGAGG + Intronic
1172462278 20:35128474-35128496 ACAGGAGAATTGAACCTGGGAGG + Intronic
1172671985 20:36640982-36641004 ACCAGAATATTAAACCAGGAGGG - Intronic
1172725034 20:37033273-37033295 GCAGGAGAATTGAACCCGGGAGG - Intronic
1178575206 21:33781668-33781690 AAGAGAATCTTGAACCCGGGAGG - Intronic
949121146 3:385736-385758 AAAAATATCTTGAACCCGGGAGG + Intronic
950961040 3:17108143-17108165 ACAAGAATCGTGAACCTGGGAGG - Intergenic
953639179 3:44689428-44689450 AGAAGAATCTTGAACCTGGGAGG + Intergenic
953826342 3:46254465-46254487 AAAAGAACTTTGAACCCAGGGGG - Intronic
955020160 3:55112350-55112372 AGGAGAATCTTGAACCTGGGAGG + Intergenic
956822454 3:72966068-72966090 ACGAGAATCTAGAACCCGGAAGG - Intronic
958703374 3:97621576-97621598 AGAAGAAAGTTGAACCAGGGTGG + Intronic
960445103 3:117738509-117738531 ATAAGAATTTTGAACCCCAGAGG - Intergenic
962664592 3:137641471-137641493 AGGAGAATCTTGAACCTGGGAGG - Intergenic
964663202 3:159143742-159143764 ACAAGAATATTGGAGCCAGGAGG + Intronic
965503703 3:169487199-169487221 AGAATAATATTGAACCCGGAAGG + Intronic
966296149 3:178426147-178426169 TCAAGAAAGTTGAACCTGGGAGG - Intronic
966812676 3:183861863-183861885 AGGAGAATTTTGAACCTGGGAGG - Intronic
967408567 3:189144227-189144249 ACAACCATATTGAATCCAGGAGG - Intronic
967756294 3:193173360-193173382 GCAGGAGAATTGAACCCGGGAGG + Intergenic
968072644 3:195796172-195796194 AGGAGAATCTTGAACCTGGGAGG - Intronic
968678415 4:1898568-1898590 GCAGGAGAATTGAACCCGGGAGG + Intronic
970345771 4:15150667-15150689 TCAAGAAGAGTGAACCTGGGTGG - Intergenic
971063999 4:23006704-23006726 ATAAGAATTTTGAACCAAGGGGG + Intergenic
972459745 4:39290281-39290303 ATGAGAATCTTGAACCCAGGAGG + Intronic
972490533 4:39582882-39582904 ACGAGAATTTTGGACCCGGGAGG - Intronic
973252063 4:48070986-48071008 AGAAGAATCTTGAACCTGGGAGG - Intronic
974108132 4:57494619-57494641 AGGAGAAATTTGAACCCGGGAGG - Intergenic
974340699 4:60611735-60611757 AGGAGAAACTTGAACCCGGGAGG - Intergenic
975294668 4:72719472-72719494 AGGAGAATCTTGAACCCAGGGGG + Intergenic
976577750 4:86694486-86694508 AGGAGAATCTTGAACCGGGGAGG + Intronic
977886415 4:102257242-102257264 GCAGGAGAATTGAACCCGGGAGG - Intronic
982254070 4:153435408-153435430 AGGAGAAGCTTGAACCCGGGAGG - Intergenic
984717423 4:182938754-182938776 GGGAGAATCTTGAACCCGGGAGG - Intergenic
985973819 5:3399034-3399056 AGAAGAATTGCGAACCCGGGAGG - Intergenic
986022232 5:3815123-3815145 GACAGAATATTGAACCAGGGAGG - Intergenic
987600125 5:20056979-20057001 TCAAGAATATAGAACTCGGCCGG - Intronic
988236215 5:28548690-28548712 ACAATAATATTGAACCAGTGTGG - Intergenic
988824648 5:34923367-34923389 AGCAGAAGCTTGAACCCGGGAGG - Intronic
991426947 5:66501933-66501955 ACAAGGAAATTGAACCCAGAAGG - Intergenic
993665316 5:90688445-90688467 AGGAGAATCTTGAACCCGGGAGG - Intronic
994377197 5:99028333-99028355 ACAAGAATCTTGAACCCCGGTGG - Intergenic
994727010 5:103448151-103448173 AGAAGAATTATGAACCCAGGAGG - Intergenic
997491683 5:134282733-134282755 TCAGTAATACTGAACCCGGGAGG - Intergenic
1002213639 5:177612728-177612750 AGGAGAATCTTGAACCCGGGAGG - Intergenic
1003947005 6:11085019-11085041 AGGAGAATCTTGAACCTGGGAGG + Intergenic
1004127705 6:12889710-12889732 AGAAGAAAATTGAACCTTGGAGG - Intronic
1005795352 6:29355206-29355228 ATAAGATTATTGAACCTGTGAGG + Intergenic
1010701140 6:79048921-79048943 ACAAGAATATGTAACTCGGAAGG + Intronic
1012614872 6:101264730-101264752 GCATGAACCTTGAACCCGGGAGG - Intergenic
1016046270 6:139483716-139483738 AGGAGAATCTTGAACCTGGGAGG + Intergenic
1016960672 6:149669667-149669689 GGGAGAATCTTGAACCCGGGAGG + Intronic
1017148029 6:151252285-151252307 ATGAGAATCTTGAACCCGGGAGG - Intronic
1020148151 7:5661029-5661051 ATGAGAATCTTGAACCCTGGAGG - Intronic
1023431831 7:40101415-40101437 AGGAGAATCTTGAACCTGGGAGG - Intergenic
1024619475 7:51145468-51145490 AGGAGAAGCTTGAACCCGGGAGG - Intronic
1025189982 7:56888876-56888898 GCAAGAGAATTGAACCTGGGAGG + Intergenic
1025681957 7:63688045-63688067 GCAAGAGAATTGAACCTGGGAGG - Intergenic
1025947827 7:66118067-66118089 AGGAGAATCTTGAACCCTGGAGG - Intronic
1028904101 7:96134116-96134138 AACAGAATCGTGAACCCGGGAGG - Intronic
1029647358 7:101866377-101866399 ACTAGAATCTCGAACCTGGGAGG + Intronic
1032034961 7:128514875-128514897 AGGAGAATCTTGAACCTGGGAGG - Intergenic
1032066200 7:128773445-128773467 ACGAGAAAATAGAACCCCGGAGG - Intronic
1033218947 7:139515213-139515235 ACAAATATATTGAACCCAGGAGG - Intergenic
1033666854 7:143449019-143449041 AAAAAAATATTGATCCCCGGCGG - Intergenic
1034113253 7:148558723-148558745 AGAAGAATAATGAATCCAGGGGG - Intergenic
1034914867 7:155028959-155028981 AGAAGAATCTTGAACCTGGGAGG + Intergenic
1038381785 8:27102426-27102448 AGAAGAATCACGAACCCGGGAGG - Intergenic
1038799381 8:30735461-30735483 ACATGAGTCTTGAACCCTGGAGG + Intronic
1043918258 8:85950305-85950327 AGGAGAATCGTGAACCCGGGAGG - Intergenic
1045025692 8:98084470-98084492 AGGAGAAAATTGAACCCGGGCGG - Intronic
1045374925 8:101562481-101562503 ATATGCATATTGAACCCGTGTGG + Intronic
1045868624 8:106899564-106899586 ATAAGAATATTGAGCCCTAGAGG + Intergenic
1049760156 8:144328531-144328553 ACAAGAATATGTCACCAGGGGGG - Intergenic
1050452363 9:5796844-5796866 ACACGAAGAATGAACCCGAGTGG + Intronic
1052102939 9:24472865-24472887 ATAAGAATATTGAACCCGCTCGG - Intergenic
1057559427 9:96115672-96115694 AGGAGAATGGTGAACCCGGGAGG + Intronic
1058632111 9:107000020-107000042 ACAAGGATATCGAACACAGGAGG + Intronic
1060363148 9:122980457-122980479 ACATGAATATAGAACCATGGTGG - Intronic
1186245866 X:7616292-7616314 GGGAGAATCTTGAACCCGGGAGG + Intergenic
1187141647 X:16599868-16599890 ACAAGAATCTTGAACCTGGGAGG - Intronic
1187704017 X:21991509-21991531 ACAAGACTACTGAATCCAGGTGG - Intronic
1191605555 X:63058282-63058304 ATAAGAATATGGAACTCGAGGGG + Intergenic
1193960860 X:87923614-87923636 GCGAGAATCTTGAACCCAGGAGG + Intergenic
1199004701 X:142682008-142682030 ATAAGAATATTGAACTGGGCTGG - Intergenic
1200613013 Y:5346586-5346608 AGGAGAAGCTTGAACCCGGGAGG - Intronic