ID: 1143055540

View in Genome Browser
Species Human (GRCh38)
Location 17:4159261-4159283
Sequence GCATGCAATCCTGGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294865
Summary {0: 1, 1: 33, 2: 1686, 3: 26890, 4: 266255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143055540_1143055543 -5 Left 1143055540 17:4159261-4159283 CCCAAAGTGCCAGGATTGCATGC 0: 1
1: 33
2: 1686
3: 26890
4: 266255
Right 1143055543 17:4159279-4159301 CATGCGTGAGCCACCGCACCTGG 0: 36
1: 8445
2: 55615
3: 108937
4: 146704
1143055540_1143055548 23 Left 1143055540 17:4159261-4159283 CCCAAAGTGCCAGGATTGCATGC 0: 1
1: 33
2: 1686
3: 26890
4: 266255
Right 1143055548 17:4159307-4159329 CTCTTTCTTAAAGATGATCAAGG 0: 1
1: 0
2: 1
3: 23
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143055540 Original CRISPR GCATGCAATCCTGGCACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr