ID: 1143057157

View in Genome Browser
Species Human (GRCh38)
Location 17:4170943-4170965
Sequence GGGCAGAACAGACCGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143057142_1143057157 22 Left 1143057142 17:4170898-4170920 CCGGCCCAGCCCGGCAGCCACAG 0: 1
1: 2
2: 12
3: 90
4: 629
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057148_1143057157 13 Left 1143057148 17:4170907-4170929 CCCGGCAGCCACAGACGGAGGGC 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057149_1143057157 12 Left 1143057149 17:4170908-4170930 CCGGCAGCCACAGACGGAGGGCG 0: 1
1: 0
2: 2
3: 24
4: 366
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057145_1143057157 17 Left 1143057145 17:4170903-4170925 CCAGCCCGGCAGCCACAGACGGA 0: 1
1: 0
2: 1
3: 19
4: 160
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057152_1143057157 5 Left 1143057152 17:4170915-4170937 CCACAGACGGAGGGCGGAGGACA 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057143_1143057157 18 Left 1143057143 17:4170902-4170924 CCCAGCCCGGCAGCCACAGACGG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057141_1143057157 23 Left 1143057141 17:4170897-4170919 CCCGGCCCAGCCCGGCAGCCACA 0: 1
1: 0
2: 7
3: 70
4: 659
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057139_1143057157 27 Left 1143057139 17:4170893-4170915 CCCACCCGGCCCAGCCCGGCAGC 0: 1
1: 1
2: 7
3: 62
4: 608
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145
1143057140_1143057157 26 Left 1143057140 17:4170894-4170916 CCACCCGGCCCAGCCCGGCAGCC 0: 1
1: 0
2: 13
3: 127
4: 922
Right 1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143057157 Original CRISPR GGGCAGAACAGACCGCTGGC AGG Intronic
900959184 1:5908576-5908598 GCTCAGCTCAGACCGCTGGCGGG + Intronic
903642699 1:24870846-24870868 AGGCAGAAAAGAGTGCTGGCGGG + Intergenic
904576593 1:31509021-31509043 GGTCAGAAAAGACAGCAGGCTGG - Intergenic
904684106 1:32248383-32248405 GCGCAGGACAGGCAGCTGGCAGG + Exonic
908572210 1:65421198-65421220 GGGCAGAGTTGACCGCGGGCGGG + Intronic
911504770 1:98735074-98735096 GGGGAGAATAGCCCACTGGCAGG - Intronic
915274379 1:154777814-154777836 GGCCAGAACAGACCACTTGAGGG - Intronic
917294240 1:173502444-173502466 GGCCAGAGCAGACTGCTGGGTGG - Intronic
919455982 1:197819500-197819522 GGGAAGAACAGAAGCCTGGCTGG + Intergenic
922668520 1:227492137-227492159 GGGCAGGACAGACCCCTGCATGG + Intergenic
1063379604 10:5576018-5576040 GGGCAGAACAGGCCTCGGTCTGG - Intergenic
1063598814 10:7461728-7461750 AGGCAGAACAGACAGCAGGCGGG + Intergenic
1064458887 10:15514314-15514336 GGGCAGAACGGATTGCTGGAAGG + Exonic
1066065899 10:31760499-31760521 GGGCAGAACAGGCCCTCGGCAGG + Intergenic
1067431649 10:46249536-46249558 AGGCAGTGCAGGCCGCTGGCAGG + Intergenic
1067441771 10:46312638-46312660 AGGCAGTGCAGGCCGCTGGCAGG - Intronic
1069526883 10:69180351-69180373 GGGCAGAGCAGATGGCTGCCCGG - Exonic
1070378096 10:75853959-75853981 CTGCAGCACAGACCACTGGCAGG - Intronic
1070595939 10:77833308-77833330 AAGCAGAACAGACTGCTGGATGG + Intronic
1070608777 10:77918880-77918902 GGGCAGAACATACAGGTGGTTGG + Intronic
1070913746 10:80139477-80139499 GGGCAGCAAAGACAGATGGCTGG - Intronic
1071613720 10:87055479-87055501 GGGGTGAACAGCCCTCTGGCAGG + Intronic
1072869014 10:99096858-99096880 GGGCACAAGAGGCAGCTGGCTGG + Intronic
1074029837 10:109676211-109676233 GGGCAGAGCTGCCCACTGGCAGG - Intergenic
1075494512 10:122908341-122908363 GGGCAGAACACACCTGTGGCTGG + Intergenic
1075668168 10:124245303-124245325 AGGAAGAGAAGACCGCTGGCTGG - Intergenic
1075851867 10:125595576-125595598 GGGCAGGACAGAAAGGTGGCTGG - Intronic
1076002117 10:126920498-126920520 GAGCAGAAAAGACTGGTGGCAGG - Intronic
1076531941 10:131150647-131150669 GGGCAGAACAGAGCTCTTGCTGG - Intronic
1077220885 11:1415675-1415697 GGGCAGAGCAGGCCCCGGGCAGG - Intronic
1077327617 11:1970525-1970547 GGGCTGAACGGACCACGGGCGGG - Intronic
1079746752 11:24141986-24142008 GAGCAAAACAGCCAGCTGGCAGG + Intergenic
1081858031 11:46316256-46316278 GGGCACAGCAGTCAGCTGGCAGG - Intronic
1082848815 11:57747142-57747164 GCTCAGAACAGACCACTGCCTGG - Intronic
1083333303 11:61909086-61909108 TGGCACAAAACACCGCTGGCCGG - Intronic
1085417254 11:76327742-76327764 GGGGAGAACACAGGGCTGGCAGG - Intergenic
1089355611 11:117850283-117850305 GGGCAGAACAGACCTGAAGCTGG + Intronic
1090778309 11:129984402-129984424 GGGAAGAGCAGACAGATGGCAGG - Intronic
1202810599 11_KI270721v1_random:25705-25727 GGGCTGAACGGACCACGGGCGGG - Intergenic
1094380674 12:29840186-29840208 GGGGAGAACACAACCCTGGCTGG - Intergenic
1096699138 12:53370984-53371006 GGGGAGCGCAGAGCGCTGGCAGG + Intergenic
1098029999 12:66243647-66243669 GAGGAGAACAGAACTCTGGCAGG - Intronic
1101815173 12:108140692-108140714 GGGCAGGAAAGGCCCCTGGCTGG - Intronic
1102159715 12:110758588-110758610 GGGCAGAACAGGCCTCTCTCTGG + Intergenic
1102173037 12:110856491-110856513 GGGCAGAAGAGTCCCCAGGCTGG + Intronic
1104846723 12:131850745-131850767 GGTCAGACCAGACGGCTGGTGGG - Intronic
1105273969 13:18904150-18904172 GGGCAGAAAAGACAGATGGTGGG - Intergenic
1105983052 13:25538416-25538438 CTGCAGGACAGACTGCTGGCAGG - Intronic
1112433667 13:99375214-99375236 GAGCAGCCCAGAACGCTGGCAGG + Intronic
1114298220 14:21349726-21349748 GGGTAGAAGAAACCGGTGGCAGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115433845 14:33351201-33351223 GGGCACAACAGACTGCTGACTGG - Intronic
1116605611 14:46989763-46989785 TGGCAGAGGAGACAGCTGGCAGG + Intronic
1118837173 14:69485374-69485396 GGGCAGAAGAGACCGTGGTCGGG + Intronic
1121001538 14:90454858-90454880 TGGCAGACCAGACCCCTGGCCGG - Intergenic
1122138677 14:99649287-99649309 GGGCAGAACAGACATCTGGAAGG - Intronic
1122344998 14:101053070-101053092 GGGCAGGACACAGCTCTGGCAGG - Intergenic
1122540766 14:102496582-102496604 GGGCAGCACAGGCAGGTGGCAGG + Intronic
1122814157 14:104304066-104304088 GGGCAGAGCAGACCTTGGGCAGG - Intergenic
1124708616 15:31986087-31986109 GGGCAGAACAGACAGGAAGCGGG + Intergenic
1127035484 15:54912103-54912125 GGGCAGAACAGACCAATAACAGG + Intergenic
1127096071 15:55513417-55513439 GGTCATAACACACAGCTGGCCGG + Intergenic
1128525658 15:68410660-68410682 GGGCAGAAGGGAAGGCTGGCTGG - Intronic
1131310974 15:91289671-91289693 GGGAAGAACTGACCTCTGGTTGG - Exonic
1132914778 16:2338048-2338070 AGGCAGAACAGCTAGCTGGCTGG - Intronic
1133536740 16:6709819-6709841 GGCCAGATCAGAACGCTGGCTGG + Intronic
1136549701 16:30976436-30976458 GGGGAGAAGAGGCTGCTGGCTGG + Intronic
1138106610 16:54290433-54290455 GCGCGGAAGAGGCCGCTGGCCGG + Intergenic
1141307770 16:82882456-82882478 AGGCAGACCTGGCCGCTGGCAGG + Intronic
1141827606 16:86492154-86492176 GGGCTGGACAGACTGCTGGGTGG - Intergenic
1141859506 16:86706820-86706842 GGGCTGAACAGACCTGTGGGAGG + Intergenic
1142025374 16:87810149-87810171 AGAAAGAACAGAGCGCTGGCCGG - Intergenic
1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG + Intronic
1145392898 17:22469705-22469727 GGGAAGAACACAGCCCTGGCAGG + Intergenic
1145694493 17:26775627-26775649 GGGCAGAAAGGAGCGGTGGCGGG - Intergenic
1147610867 17:41801227-41801249 GGGCAGAACTGTCACCTGGCTGG + Intergenic
1147980330 17:44270026-44270048 GGGAAGGACTGACAGCTGGCTGG + Intergenic
1150908199 17:69361220-69361242 TGCCAGAAAAGACAGCTGGCTGG - Intergenic
1151297850 17:73198669-73198691 GCCCAGAACAGATCGCTGGGAGG + Intronic
1151804484 17:76397048-76397070 GGCTGGAACAGACCACTGGCTGG - Intronic
1151811878 17:76448725-76448747 GGGCAGAACAGCCCCCTGCGAGG - Intronic
1152199803 17:78938738-78938760 GGGCAGAAAACACAGCTGGCGGG + Intergenic
1152431088 17:80248605-80248627 GGGAAGGACAGGCCGCTGGCCGG - Exonic
1159053442 18:63443004-63443026 AGGCACAATAGACCCCTGGCAGG + Intergenic
1161076047 19:2286294-2286316 GGGCAGAACAGAGGCCTGTCAGG - Intronic
1161089975 19:2354866-2354888 GAGCAGAACTGAGAGCTGGCAGG + Intergenic
1161220736 19:3116921-3116943 GGGGAGAACAGGCAGATGGCAGG - Intronic
1161543945 19:4868476-4868498 GGGCAGATCAGGCCGGAGGCTGG - Intergenic
1161567520 19:5011894-5011916 CGGAAGAAGAGACCACTGGCGGG - Intronic
1162744227 19:12789981-12790003 GGGCAGGACTGAGCGCGGGCCGG - Intronic
1163142807 19:15361926-15361948 GGGCAGCACAGCACGATGGCTGG + Intronic
1164714135 19:30379313-30379335 GGGCAGCACAGAGCTCAGGCTGG - Intronic
1168078287 19:53992151-53992173 GAGAAGAACAGAGCCCTGGCTGG - Intergenic
925230237 2:2226536-2226558 TGGGAGAACAGACAGATGGCAGG - Intronic
925539421 2:4951055-4951077 GAACAGAACAGACCCCAGGCAGG - Intergenic
926220397 2:10932322-10932344 GGGCTCTACAGACCGGTGGCTGG + Intergenic
926369717 2:12167707-12167729 GGGCAGCAGAGACCACTGGCAGG + Intergenic
927517323 2:23680009-23680031 GGGCAGCACAGCCCTCTGGGAGG - Intronic
928178476 2:29051094-29051116 TGGCAGACAAGACAGCTGGCAGG - Intronic
929044950 2:37780182-37780204 GGGAAGAAAAGACCCATGGCTGG - Intergenic
931942772 2:67271356-67271378 GTGCAGAACAAACAGCTGGAGGG + Intergenic
934078519 2:88448406-88448428 GGGGAGAACACGCCGCTGGAGGG + Exonic
942361911 2:175181498-175181520 GGGAAGAACAGGCCCCTGGAGGG - Intronic
946405089 2:219488267-219488289 GTGCAGGGCAGGCCGCTGGCAGG - Exonic
946427401 2:219606575-219606597 GGAGAGAACAGAGGGCTGGCTGG + Intronic
948913782 2:241019825-241019847 TGGCAGACCAGACCGCAGACTGG + Intronic
1171254063 20:23673016-23673038 GGGCAGCACAGACATCTGCCTGG + Intergenic
1174767996 20:53271836-53271858 AGGCTGAACAGACAGGTGGCTGG + Intronic
1179243349 21:39610564-39610586 GGACAGAGCAGACCACTGCCTGG + Intronic
1179556093 21:42177402-42177424 GGGCAGAACAGAGCCCTGGATGG + Intergenic
1183740674 22:39666911-39666933 GGGCACAAAAGGCCGCTGGCTGG - Intronic
1184094656 22:42310021-42310043 GGGCAGAACAGCCAACTGCCCGG + Intronic
950287447 3:11755883-11755905 GGGACGAACAGACAGCAGGCAGG - Intergenic
950294419 3:11816465-11816487 TGGAAGAACAGACAGCAGGCTGG + Intronic
950695553 3:14698830-14698852 GGGAAGAACAGAAACCTGGCTGG - Intronic
953256617 3:41296897-41296919 GGGCAGAAGTGACAGATGGCAGG + Intronic
953969780 3:47338104-47338126 TGGCAGAACAGACAGCTGTGTGG - Intronic
968531343 4:1093578-1093600 AGGCAGAGCAGACAGGTGGCTGG + Intronic
978809373 4:112833310-112833332 GGATTGAACAGACAGCTGGCTGG + Intronic
980927046 4:139148134-139148156 GGCCAGAACAGACAGCTCTCTGG - Intronic
981821323 4:148890367-148890389 AGGGAGACCAGACCCCTGGCAGG - Intergenic
985869289 5:2541089-2541111 CTGCAGACCAGACCGCTGTCTGG - Intergenic
987147721 5:15008744-15008766 GGCCAGAACACACCGCCTGCAGG - Intergenic
997612940 5:135227840-135227862 GAGCAGAGCAGACAGCTGGCAGG - Intronic
998790444 5:145760843-145760865 GGCAAGAACAGACAGCTGTCAGG + Intronic
999262593 5:150246967-150246989 GGGGAGCGCAGGCCGCTGGCAGG - Intronic
1001166658 5:169374679-169374701 GGGAGGAACAGACAGTTGGCAGG - Intergenic
1001287592 5:170435181-170435203 GGGCAGCACAGGCCACAGGCTGG + Intronic
1002929019 6:1620688-1620710 GGGCCGTGCAGACCGCTGGGCGG + Intergenic
1006418239 6:33917992-33918014 GGCCAGAACAGCACTCTGGCTGG - Intergenic
1006911896 6:37568776-37568798 GGGCAAAACTGAGCCCTGGCTGG + Intergenic
1007632665 6:43281520-43281542 GGAGAGAACAGGCCGGTGGCTGG + Intronic
1013225680 6:108118233-108118255 GGGCAGAGCAGGTCGCTGGGCGG - Intronic
1019024855 6:168950957-168950979 GGGCAGAAAAGCGCGCAGGCCGG - Intergenic
1019136541 6:169912059-169912081 GGGCAGAAGAGCACGCTGCCAGG + Intergenic
1019396492 7:822666-822688 GGGGAGAACAGAGCGCTAGAAGG + Intronic
1019668285 7:2263682-2263704 GGGAAGAACAGACCATGGGCTGG - Intronic
1021740517 7:23681060-23681082 GGGGAGAACAGTCAGCTGGGGGG - Intronic
1025177711 7:56810386-56810408 GGCCAGAAGAGGCCACTGGCAGG + Intergenic
1025181862 7:56827441-56827463 GGGCTGAAGAGGCCACTGGCAGG + Intergenic
1025182008 7:56828063-56828085 GGCCTGAAGAGACCACTGGCAGG + Intergenic
1025211512 7:57021551-57021573 GGGCAGCACTGACCCCGGGCAGG + Intergenic
1025660443 7:63555296-63555318 GGGCAGCACTGACCCCGGGCAGG - Intergenic
1025689919 7:63748932-63748954 GGCCTGAAGAGACCACTGGCAGG - Intergenic
1031010849 7:116524897-116524919 GAGCAGAACAAACCTTTGGCGGG + Exonic
1034976378 7:155451123-155451145 GGGCTGAACTGACTGCAGGCTGG - Intergenic
1037613699 8:20497936-20497958 GGGGAAAACAGACAGATGGCAGG - Intergenic
1039214942 8:35259366-35259388 GGGCAGAAGTGAATGCTGGCTGG + Intronic
1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG + Intergenic
1040559916 8:48514799-48514821 GAGCAGACCAGGCCGGTGGCGGG - Intergenic
1046587257 8:116162685-116162707 GGGCAGGACAGCCAGGTGGCTGG - Intergenic
1047883368 8:129220642-129220664 GGGCAGAAAAGACCTCTTGCAGG - Intergenic
1048376088 8:133823462-133823484 TGGCAGAACAGACCTATGGATGG + Intergenic
1060224458 9:121782717-121782739 GGGCAGAAGAGACTGCACGCTGG + Intronic
1060275881 9:122182142-122182164 GGGCAGAAGAGACAGCAGGATGG - Intronic
1061950953 9:133935548-133935570 GGGCAGACCAGGCCGCAGGGAGG + Intronic
1062606910 9:137352576-137352598 GGGCGGAACCCACCCCTGGCTGG + Intronic
1192875157 X:75222395-75222417 GGGAAGAACAGAAGCCTGGCTGG - Intergenic
1192891005 X:75390301-75390323 GGGAAGAACAGAAACCTGGCTGG + Intronic
1200083997 X:153593943-153593965 GGGCAGCTCAGAAGGCTGGCCGG - Intronic