ID: 1143058072

View in Genome Browser
Species Human (GRCh38)
Location 17:4177350-4177372
Sequence GCTTGCAGATGAAGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143058072_1143058078 27 Left 1143058072 17:4177350-4177372 CCTCCTGAGCTTCATCTGCAAGC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1143058078 17:4177400-4177422 GGAGACCTTCCCTCAGTCTTAGG 0: 1
1: 0
2: 0
3: 12
4: 128
1143058072_1143058074 -8 Left 1143058072 17:4177350-4177372 CCTCCTGAGCTTCATCTGCAAGC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1143058074 17:4177365-4177387 CTGCAAGCTGAACTGACCACTGG 0: 1
1: 0
2: 2
3: 15
4: 136
1143058072_1143058075 -3 Left 1143058072 17:4177350-4177372 CCTCCTGAGCTTCATCTGCAAGC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1143058075 17:4177370-4177392 AGCTGAACTGACCACTGGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 120
1143058072_1143058076 6 Left 1143058072 17:4177350-4177372 CCTCCTGAGCTTCATCTGCAAGC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1143058076 17:4177379-4177401 GACCACTGGAGAGGTCACGATGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143058072 Original CRISPR GCTTGCAGATGAAGCTCAGG AGG (reversed) Intronic
900604452 1:3517552-3517574 GCTGGGATATGCAGCTCAGGAGG + Intronic
901413258 1:9099772-9099794 GCCTGCAGATGCAGCTGCGGCGG + Intergenic
902357316 1:15914136-15914158 ACTTTCACATGAAACTCAGGTGG - Intronic
904874596 1:33644318-33644340 GACTGGAGAGGAAGCTCAGGGGG + Intronic
907189112 1:52633759-52633781 GCTTGCTGCTGATGTTCAGGTGG - Intronic
909355047 1:74698384-74698406 GCTTGCAAATAAAGCTGAGAAGG + Intergenic
909417527 1:75424246-75424268 ACTTGGAGAGGAAGCTCAAGGGG - Intronic
912455209 1:109792449-109792471 GGGTGGAGATGAAGCTGAGGTGG - Intergenic
913690448 1:121274948-121274970 ATGGGCAGATGAAGCTCAGGAGG - Intronic
914147093 1:145005011-145005033 ATGGGCAGATGAAGCTCAGGAGG + Intronic
918709174 1:187705430-187705452 GCTTGTTGAAGGAGCTCAGGTGG + Intergenic
919108358 1:193184509-193184531 GCTTGTGGATGAAGTTCATGGGG + Intronic
919539091 1:198827257-198827279 GTTTGCAGCTGAAGCTCTAGTGG + Intergenic
919547695 1:198944070-198944092 GCCAGCAGATGAAGATCAAGGGG - Intergenic
920477766 1:206293436-206293458 ATGGGCAGATGAAGCTCAGGAGG - Intronic
922769688 1:228175252-228175274 GCTTGCGGATGACGCCCATGTGG - Exonic
923277419 1:232409730-232409752 GCATGCAGCTGCAGCTCAGCTGG - Intronic
923855311 1:237839242-237839264 CATTGCAGATGAAGCTTTGGTGG + Intergenic
924044285 1:240011708-240011730 GCTTCCAAATGAAGCTCTCGAGG + Intergenic
924382643 1:243478470-243478492 GCCTGCAGAGGAAGAACAGGGGG - Intronic
924559843 1:245148892-245148914 GCTTGCCGATGACTCTCTGGTGG + Intergenic
1066321847 10:34310585-34310607 GAATGCAGAGGAAGCTGAGGAGG - Intronic
1067081486 10:43215027-43215049 GCCTGCACTTGATGCTCAGGGGG - Intronic
1067945050 10:50683841-50683863 GCTTGTCAATGTAGCTCAGGAGG - Intergenic
1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG + Intronic
1070866555 10:79710713-79710735 GCTTGTCAATGTAGCTCAGGAGG - Exonic
1070880345 10:79848844-79848866 GCTTGTCAATGTAGCTCAGGAGG - Exonic
1074123525 10:110510566-110510588 GCTTGCAAATGAACTTCAGACGG + Exonic
1075082411 10:119392795-119392817 TCTTGCAGATGGAGGTCACGAGG + Intronic
1075593830 10:123712835-123712857 GCTTGAAGATGCAGGTCATGTGG + Intronic
1076276915 10:129207915-129207937 GCTTGCAAATGAAGCTCTGAAGG + Intergenic
1076412397 10:130261628-130261650 GCTTGCAGAGGGTGCCCAGGAGG + Intergenic
1077269196 11:1667184-1667206 GCTCTCAGAGGAAGCTGAGGAGG - Intergenic
1077271349 11:1683522-1683544 GCTCTCAGAGGAAGCTGAGGAGG + Intergenic
1077317248 11:1925091-1925113 GCTCTCAGAGGAAGCCCAGGAGG + Exonic
1078055303 11:8004225-8004247 GCAAGCAGATTAATCTCAGGTGG + Intergenic
1079505303 11:21146563-21146585 GCTTCCAGATAAAGGGCAGGAGG - Intronic
1079588750 11:22156936-22156958 GCTTCCAGATGTAGCTGAGAAGG + Intergenic
1081619645 11:44611734-44611756 GCTTGGAGCTGATGCTCAGGAGG - Intronic
1083261367 11:61524765-61524787 TCTTACAGATGAGGCTCAGACGG + Intronic
1085349943 11:75791921-75791943 TTTTGCAGATGAGGCTCAGCAGG - Intronic
1087115923 11:94524235-94524257 ACTTGAAGCTGAGGCTCAGGGGG + Intergenic
1089295235 11:117463459-117463481 GCTTGAAGCAGAAGCTCTGGGGG + Intronic
1089747952 11:120630078-120630100 ACTTGCAGAAGGAGCTCAGAAGG - Intronic
1091555445 12:1569948-1569970 CCTTGCAGAAGGAGCTCAGTGGG - Intronic
1092064639 12:5579737-5579759 GCTAGGAGATGAAGCTAGGGAGG - Intronic
1092962610 12:13610506-13610528 GCTTCTGGATGAAGCACAGGTGG + Intronic
1095168511 12:39004700-39004722 GCTTGCATATGAAGGCCACGAGG + Intergenic
1096087799 12:48877796-48877818 ACTTGCAGAGGCAGCACAGGTGG + Intergenic
1096234386 12:49916177-49916199 ACTTCCGGACGAAGCTCAGGTGG + Intergenic
1097158143 12:57027457-57027479 GCCTGCAGATGGAAGTCAGGTGG + Intronic
1097829117 12:64205505-64205527 GCTTGCTGCTGTAGCTTAGGTGG - Intronic
1104068719 12:125327013-125327035 GCCTGCAGAGAAGGCTCAGGGGG - Intronic
1105620570 13:22061911-22061933 GCCTGCAGCTGAAGCACAGCTGG - Intergenic
1105896763 13:24723245-24723267 GCTTGCAGATGAAGCAAAGAGGG - Intergenic
1108093669 13:46878282-46878304 GCTTGCATGTGGAGCTTAGGAGG + Intronic
1111732831 13:92098656-92098678 GCTTTCAGATGAAATTAAGGTGG + Intronic
1113297416 13:108974868-108974890 GCCTGAAGATGGAGCTAAGGAGG + Intronic
1116366918 14:44077966-44077988 GCTTGCAAACCAAGCTCACGGGG - Intergenic
1118888977 14:69891560-69891582 GCCAGCAGATGCAGTTCAGGGGG - Intronic
1120964671 14:90156834-90156856 GCTTGCAGAAGGAGAGCAGGTGG - Intronic
1122385308 14:101341103-101341125 GCTTGCAGAGGCAGATCATGGGG + Intergenic
1122993017 14:105247770-105247792 GCGTGCAGACGAAGCTCCAGAGG - Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1125686832 15:41568491-41568513 GCTTGCAGAGGAGGGTGAGGAGG - Intronic
1125844848 15:42842512-42842534 GCTTGAAGATGAAGATTTGGTGG + Intronic
1126779221 15:52124372-52124394 GCTATCAGAGTAAGCTCAGGTGG - Intronic
1127550845 15:60036931-60036953 GATAGGAGATGGAGCTCAGGCGG + Intronic
1127646411 15:60963641-60963663 GGCTTCAGATGAAGCTGAGGGGG - Intronic
1128880457 15:71237538-71237560 GCTCCCAGATGAAGCTGATGTGG - Intronic
1130804452 15:87304218-87304240 GCTTGCTCAGGAAGCTCATGGGG - Intergenic
1131403809 15:92147195-92147217 GCCTGCAGATGAACACCAGGTGG - Intronic
1131744765 15:95435387-95435409 GCATGCACATTAAGCTCATGGGG + Intergenic
1133639540 16:7703380-7703402 GCTCTCAGATGAAGTTCAGAAGG - Intronic
1134074051 16:11278195-11278217 GCTTGCAGATGAAAATAAGAAGG + Intronic
1134669542 16:16044615-16044637 CCTTGAAGAAGAAGCTCATGAGG - Exonic
1137565394 16:49529697-49529719 TCCTGAAGGTGAAGCTCAGGTGG + Intronic
1138360421 16:56423878-56423900 GCTTCCTGATGAAGCACAGTGGG + Intronic
1138674255 16:58639564-58639586 GCTGGAATATGAACCTCAGGAGG - Intergenic
1138965463 16:62078723-62078745 GCTTGCAGATGAAGCCAACAAGG + Intergenic
1140726503 16:77817989-77818011 CCTTGCAGATGAGGTTCGGGAGG + Intronic
1141535017 16:84673170-84673192 GCTTTCAGATTAAGCACAGCCGG + Intergenic
1141621641 16:85239504-85239526 GCTTGCAGGTGGAGCCCAGGGGG - Intergenic
1142340636 16:89520031-89520053 GTGTGCATATGAGGCTCAGGAGG + Intronic
1143058072 17:4177350-4177372 GCTTGCAGATGAAGCTCAGGAGG - Intronic
1144314953 17:14050803-14050825 CCTTGCAGATGAAGCAGAGGCGG + Intergenic
1146749480 17:35365113-35365135 GGATGCAGAAGAAGGTCAGGAGG + Intronic
1149522907 17:57331552-57331574 GCTTTCAGATCTCGCTCAGGAGG - Intronic
1149543591 17:57487032-57487054 GCCTGCAAGTGAAGCTCAGATGG - Intronic
1152896091 17:82912211-82912233 GCGAGCACAGGAAGCTCAGGCGG + Intronic
1153758392 18:8306313-8306335 TTTTACAGATGAAGCTCAGCAGG + Intronic
1155142637 18:23056588-23056610 GCTGGCTGATGTAGCTCATGGGG + Intergenic
1157327811 18:46681485-46681507 CCTTCCAGATGAACCCCAGGAGG + Intronic
1159285360 18:66342754-66342776 GCCAGGAGATGGAGCTCAGGTGG + Intergenic
1159470210 18:68842985-68843007 GCTTGCAGATGAAGCGGACAGGG - Intronic
1159476568 18:68928401-68928423 GCTGGCAAACGAAGCTGAGGAGG + Intronic
1160027604 18:75231247-75231269 GCTGGCAGGGGCAGCTCAGGCGG + Intronic
1160082388 18:75740777-75740799 GCTTGCAGATGTGGTTCAGGAGG + Intergenic
1162361872 19:10225346-10225368 GCTTGTAGCTGAAGCTGAGGTGG - Intronic
1164207714 19:23071646-23071668 GCTTGGAGATGCATCTCAGCGGG + Intergenic
1166790380 19:45395658-45395680 GCTTGAAGATCATGCTGAGGGGG + Exonic
1168033566 19:53700989-53701011 TCTTGCAGACAAAACTCAGGAGG + Intergenic
925151835 2:1620255-1620277 GCTTGGAGAGGAGCCTCAGGAGG - Intergenic
927139693 2:20121371-20121393 ACTTGGTGATGAATCTCAGGTGG - Intergenic
928722908 2:34141107-34141129 GATTGCAGAGGAAGCCCAGAAGG - Intergenic
930916310 2:56693022-56693044 GCTTGAGGATGAAGGACAGGAGG + Intergenic
931802791 2:65774702-65774724 GTTTGCAGATGGAACTAAGGAGG - Intergenic
937283897 2:120737720-120737742 GTTTGCAGACGAGGCTCTGGGGG + Intronic
937869180 2:126775689-126775711 CTTTGCAGATGTAGCACAGGCGG + Intergenic
938730611 2:134144086-134144108 GGTTGAAGATGAAGCTCACTGGG + Intronic
947000276 2:225447171-225447193 CCTTGCATATGTAGCCCAGGTGG + Intronic
948601953 2:239112373-239112395 GGCTGCAGATGAAGCCCAGTTGG - Intronic
1170341736 20:15336241-15336263 GCTTTTAGATGAAGCTCAGTAGG + Intronic
1171820129 20:29828391-29828413 CCTAACAGATGAAGCTCAGGTGG + Intergenic
1171897704 20:30824766-30824788 CCTAACAGATGAAGCTCAGGTGG - Intergenic
1174118251 20:48242719-48242741 GCTTGCTGATGGATCTCAGGTGG - Intergenic
1175142926 20:56873989-56874011 GGCTGGAGGTGAAGCTCAGGCGG + Intergenic
1179145184 21:38761872-38761894 GCTTCCAGATGAATTCCAGGAGG - Intergenic
1179517476 21:41918612-41918634 GACTGCAGGTGCAGCTCAGGTGG + Intronic
1180324125 22:11353079-11353101 CTTAACAGATGAAGCTCAGGTGG + Intergenic
1180947659 22:19705509-19705531 GCCAGCAGATGGAGCTCAAGGGG + Intergenic
1183092133 22:35529743-35529765 GTTTGCAAATGAAGCTCAGCTGG + Intergenic
1183671814 22:39277625-39277647 GCCTGCAGTTCAAGCCCAGGAGG + Intergenic
1183700096 22:39446252-39446274 GCTTGCAGAAGAGGCCCAGGAGG + Intergenic
1184729210 22:46363862-46363884 GAGTGCAGAGGAAGCCCAGGCGG - Intronic
1184976359 22:48065244-48065266 GCTTGGAGATGCAGCTCAGATGG + Intergenic
1185138076 22:49084747-49084769 CCTTGAAGATGAAGCTGTGGTGG - Intergenic
949871908 3:8596251-8596273 GCATAGAGAAGAAGCTCAGGAGG + Intergenic
950545919 3:13637834-13637856 ACGTGGAGATGAAGCTCTGGAGG + Exonic
951745350 3:25971908-25971930 GGCTACAGATGCAGCTCAGGTGG - Intergenic
954214372 3:49116276-49116298 GTTGGCAGGTGAAGCTCAGGTGG - Exonic
954602774 3:51883580-51883602 ACTTCCAGCTGAAGTTCAGGTGG - Intergenic
957086799 3:75687441-75687463 CCTAACAGATGAAGCTCAGGTGG - Intergenic
959028645 3:101271867-101271889 ATTTACAGATGAGGCTCAGGAGG - Intronic
959394831 3:105824183-105824205 GACTGCAGAAGGAGCTCAGGTGG - Intronic
961387530 3:126530847-126530869 GCATGCAGAGGAGGCTGAGGAGG - Intronic
961455534 3:127022147-127022169 GCGTGCGGATGAAGGTCAGCAGG - Exonic
962868791 3:139470321-139470343 TTTTGCAGATAAAGCTCACGGGG - Intronic
966317083 3:178659680-178659702 GCTTGCTCATGAAGCCCATGTGG - Intronic
966760191 3:183410970-183410992 CCTTGCTGATGAGGCCCAGGGGG + Intronic
968635556 4:1676710-1676732 GCCAGCAGATGATGCTCAGAGGG - Intronic
971044907 4:22794799-22794821 ACTTGCAGATGAAGCTATTGTGG + Intergenic
973150906 4:46887328-46887350 GCATTCAGATGAAGGTCATGTGG - Intronic
976521772 4:86036129-86036151 TCTTGCAAATGAAGCACATGAGG + Intronic
977182239 4:93890632-93890654 GCCTGGAGTTGAAGCTCTGGGGG + Intergenic
977976185 4:103269282-103269304 GCTTGCAGCTCCAGCTCAGATGG - Intergenic
978202025 4:106033285-106033307 GCTTGCAGCTCCAGCTCAGATGG - Intergenic
978970030 4:114792433-114792455 GCTAGGAGATGAAGCTTAAGGGG - Intergenic
979439737 4:120737077-120737099 CCTGACAGATGAAGCTCAGGTGG - Intronic
980188262 4:129490350-129490372 GCTTACAAGTGAAGCTCAGCAGG - Intergenic
981167565 4:141580399-141580421 GCTTGCAGCTACAGCTCAGATGG + Intergenic
981728704 4:147874845-147874867 CTTTGCACATGAATCTCAGGAGG + Intronic
985561139 5:586670-586692 CCTTGCAGCAGAAGCCCAGGGGG - Intergenic
987434136 5:17872934-17872956 GTTTTCAGCTGAAGTTCAGGAGG - Intergenic
991228113 5:64296575-64296597 GCTTTCAGAAGAATCTCAGTAGG + Intronic
993674766 5:90803639-90803661 CCTTGGAGAAGATGCTCAGGCGG - Intronic
995847403 5:116508923-116508945 ACTTGCAGATGATGGTCAAGAGG - Intronic
997445230 5:133935436-133935458 GCGTGGAGAGGAAGCTCAGAGGG + Intergenic
998040490 5:138948249-138948271 GCTGGCAGAGGAAACTGAGGAGG + Intronic
999405794 5:151305550-151305572 GATTGCTTATGAAGCTCATGGGG + Intergenic
1000771671 5:165362483-165362505 ACTCGCAGATGAAGCTCAATGGG - Intergenic
1004127771 6:12890078-12890100 GGTAGGAGATGGAGCTCAGGCGG - Intronic
1005394523 6:25367580-25367602 GCTTGAAGAGGAAGGTAAGGAGG + Intronic
1005921375 6:30405006-30405028 GCAGGCAGATGAAGTGCAGGAGG - Intergenic
1006921052 6:37627387-37627409 GCTTTCAGATGAAGTTTGGGAGG - Intergenic
1007133250 6:39496570-39496592 GCTTGCAGATGGAGTTGGGGGGG - Intronic
1012559375 6:100560475-100560497 GCTTGTAAAACAAGCTCAGGTGG - Intronic
1018026998 6:159814416-159814438 GCTGGGAGTTGAAGCCCAGGGGG - Intronic
1018275400 6:162125003-162125025 GCTTGCATAGGAAGCTCTGCCGG + Intronic
1021096443 7:16540590-16540612 GATTTCAGATGAGACTCAGGTGG - Intronic
1021883208 7:25113569-25113591 GCCTGCAGATGAAGTTGAGAAGG + Intergenic
1022130043 7:27396680-27396702 ATGTGCAGAGGAAGCTCAGGGGG + Intergenic
1022873850 7:34507507-34507529 TTTTGCAGATGAGGCCCAGGGGG - Intergenic
1023187642 7:37548626-37548648 GCCAGGAGGTGAAGCTCAGGCGG - Intergenic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1030781408 7:113604851-113604873 TCTTGCAGAAGAAGATGAGGAGG + Intergenic
1037109951 8:15154057-15154079 GACAGGAGATGAAGCTCAGGAGG + Intronic
1041547177 8:59058715-59058737 GGTTCCAGAAGGAGCTCAGGAGG + Intronic
1043545052 8:81306225-81306247 GCTTGCAGCTGTTGCTCAGATGG + Intergenic
1044529326 8:93289926-93289948 TCATGCAGATGAAGCTCACTAGG - Intergenic
1047237438 8:123054248-123054270 GCATTCAGCTGAAGCTCAGCTGG - Intronic
1053750267 9:41246573-41246595 CATAACAGATGAAGCTCAGGTGG - Intergenic
1054255767 9:62810911-62810933 CATAACAGATGAAGCTCAGGTGG - Intergenic
1054335544 9:63804697-63804719 CATAACAGATGAAGCTCAGGTGG + Intergenic
1055824359 9:80305970-80305992 GATAGGAGGTGAAGCTCAGGTGG - Intergenic
1056199870 9:84265124-84265146 ACCTGCAGATTCAGCTCAGGTGG - Intergenic
1057353895 9:94320237-94320259 GCTTGTCAATGTAGCTCAGGAGG + Exonic
1057653855 9:96937353-96937375 GCTTGTCAATGTAGCTCAGGAGG - Exonic
1059399364 9:114059245-114059267 GCTGGCAGAAGAAACCCAGGCGG - Intergenic
1203371789 Un_KI270442v1:313657-313679 CCTAACAGATGAAGCTCAGGTGG + Intergenic
1186944359 X:14548899-14548921 GCTGGAAGATGAAGCTCAAGAGG - Intronic
1187996815 X:24935537-24935559 CTTTGCAGGTGCAGCTCAGGAGG - Intronic
1190158192 X:48010511-48010533 GCTTACACAGGAAGCTCAGTGGG + Intronic
1190173963 X:48133393-48133415 GCTTACACAGGAAGCTCAGTGGG + Intergenic
1191780145 X:64855991-64856013 GGTGGCACATGAGGCTCAGGAGG - Intergenic
1191791374 X:64975843-64975865 GGTTGCAGAGGAATCTCAGCGGG - Intronic
1200112933 X:153752080-153752102 GCCAGGAGATGGAGCTCAGGCGG - Intergenic
1200146997 X:153931506-153931528 GCTTGCAAGTGAAGCTGGGGTGG - Intronic
1201066551 Y:10101456-10101478 GATAACAGATGAAGCTCAGGTGG - Intergenic