ID: 1143058593

View in Genome Browser
Species Human (GRCh38)
Location 17:4180930-4180952
Sequence CTATGGCTGGGGAGACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143058593_1143058601 19 Left 1143058593 17:4180930-4180952 CCATCTGGTCTCCCCAGCCATAG 0: 1
1: 0
2: 1
3: 17
4: 235
Right 1143058601 17:4180972-4180994 AACTGGTCTGCCGTGACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1143058593_1143058599 2 Left 1143058593 17:4180930-4180952 CCATCTGGTCTCCCCAGCCATAG 0: 1
1: 0
2: 1
3: 17
4: 235
Right 1143058599 17:4180955-4180977 TCCTGCTTCACAGTCTGAACTGG 0: 1
1: 0
2: 0
3: 16
4: 182
1143058593_1143058602 27 Left 1143058593 17:4180930-4180952 CCATCTGGTCTCCCCAGCCATAG 0: 1
1: 0
2: 1
3: 17
4: 235
Right 1143058602 17:4180980-4181002 TGCCGTGACTACAGGAGCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143058593 Original CRISPR CTATGGCTGGGGAGACCAGA TGG (reversed) Intronic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900847286 1:5114062-5114084 ACATGGCTGGGGAGGCCACATGG + Intergenic
901079373 1:6575152-6575174 CTATGCCCGGGCAGACAAGAAGG + Exonic
901594148 1:10371534-10371556 TTATGACTGGGGAGACAAGCAGG - Intronic
903516148 1:23912332-23912354 TTATAGATGGGGAGACCACAAGG - Intronic
904265855 1:29318209-29318231 CTTTGGCTGGGGAGACCTCGAGG + Intronic
904279751 1:29410564-29410586 CAATGGATGGAGAGAACAGATGG + Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905927338 1:41760826-41760848 GGAAGGCTGGGGAGACCAGGTGG - Intronic
906151111 1:43588263-43588285 GCATGGCTGGGCAGAGCAGAAGG - Intronic
907595296 1:55714015-55714037 CCATTATTGGGGAGACCAGAAGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
914448681 1:147772018-147772040 TCATGGCTGGGGACACCAGCTGG - Intronic
920837984 1:209529679-209529701 CTGAGCCTGGGGAGAACAGATGG + Intergenic
921193027 1:212726530-212726552 CATTTGCTGTGGAGACCAGAGGG - Intronic
922862933 1:228834804-228834826 CTGGAGCTGGGCAGACCAGAAGG + Intergenic
924604549 1:245521575-245521597 CTGTGGCTGGGAAGACTGGAAGG + Intronic
1064007868 10:11712708-11712730 CTATGTCTGGGGAGACCCTTGGG + Intergenic
1064976859 10:21126051-21126073 AGCTGGTTGGGGAGACCAGAAGG - Exonic
1066247676 10:33599235-33599257 CTATGGCTGGGTAGACAAAGTGG + Intergenic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1071262721 10:83935391-83935413 GTATACCTGGAGAGACCAGAGGG + Intergenic
1071572113 10:86703035-86703057 CTCTGGCTGCGGAGAGCAGCAGG + Intronic
1071827724 10:89341758-89341780 CTATGTCTGTGAATACCAGAGGG - Intronic
1076130635 10:128011514-128011536 CTATGCCAGAGGTGACCAGAAGG - Intronic
1077530477 11:3092553-3092575 CTGTGGCTGGAGGGTCCAGAGGG + Exonic
1078396348 11:10985252-10985274 CTAGAGCTAGGGAGACCAGAGGG + Intergenic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1081910479 11:46696897-46696919 CTATGGCTGAGGGGCCCAGCTGG + Intronic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1084770431 11:71339591-71339613 GTCTGGATGGGGAGACCAGCAGG - Intergenic
1085796048 11:79540924-79540946 CTAACCCTGGGGAGACCAGCTGG + Intergenic
1086605905 11:88696107-88696129 AGATGGATGGGGAGGCCAGAAGG + Intronic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089751909 11:120657691-120657713 CCATGGCAGGGGTGAGCAGAGGG + Intronic
1092246290 12:6866224-6866246 GAATGGCTGGGCAGAGCAGAGGG + Exonic
1092637658 12:10469020-10469042 CTATGCCTGGCAAAACCAGAAGG + Intergenic
1096526666 12:52214099-52214121 CTGTGCCTGGGGACACCAGTGGG + Intergenic
1099646815 12:85367857-85367879 TTAAGGCTGTGGAGACCATAAGG + Intergenic
1100396920 12:94193770-94193792 ATCTGGCTGGGGTGACCAGATGG + Intronic
1103344770 12:120241859-120241881 CTCAGGCAGGGGAGATCAGAGGG + Intronic
1103454000 12:121050447-121050469 GTATCACTGGGGAGACCAGGAGG - Intergenic
1104667158 12:130655893-130655915 CCATGGCAGAGGAGACAAGAGGG + Intronic
1104864237 12:131943330-131943352 CAAGGGCTGGGGACACTAGAGGG - Intronic
1104980601 12:132571678-132571700 CTTGGGGTGGGGACACCAGAAGG - Intronic
1115739427 14:36372588-36372610 GGAGGGGTGGGGAGACCAGAAGG - Intergenic
1120972855 14:90222979-90223001 CAATGGCTGGGGAGGCCTGAGGG + Intergenic
1121270280 14:92633104-92633126 CAATGGCTAGGGGAACCAGAGGG + Intronic
1122302552 14:100739210-100739232 CCTTGGGTGGGGAGACCAGAGGG - Intergenic
1122348041 14:101072531-101072553 CCATGGCTCCGGGGACCAGAAGG - Intergenic
1122420737 14:101575571-101575593 CTGTGGCTGGAGAGTCCACATGG - Intergenic
1122734470 14:103829064-103829086 CTATGTCTGGGGAGACTTCATGG - Intronic
1129082243 15:73051958-73051980 CTCTGGCTGCAGAGACCTGAGGG - Exonic
1131273143 15:90958973-90958995 CTTGGGCTGGAGAGACCAGAGGG + Intronic
1132842981 16:1987261-1987283 CTCTGGCTGGGGAGGCCCAAAGG - Exonic
1132898910 16:2242995-2243017 ATGATGCTGGGGAGACCAGAAGG - Intronic
1135209523 16:20512372-20512394 CTCTTGCAGGGGAGGCCAGAGGG + Intergenic
1136412502 16:30085531-30085553 CTAGGGCTGGGGAAGCCAGCAGG - Intergenic
1136592034 16:31223351-31223373 CTGTGGCTGGGGAGGCCCAAGGG + Intronic
1139740326 16:69030158-69030180 ATATGGCTGGGGACAGCTGAAGG - Intronic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1141612887 16:85193053-85193075 CTAATGCTTGGGAGACCATAGGG + Intergenic
1142238006 16:88931721-88931743 CCAGGACTGGGGTGACCAGAGGG - Intronic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143118763 17:4594866-4594888 CAATGCCTGGGGAGGACAGAGGG - Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143557831 17:7673571-7673593 CTTTGGCTGGGGAGAGGAGCTGG + Exonic
1143720824 17:8807860-8807882 GTATTGCCGGGGAGACCAGCTGG + Intronic
1143925331 17:10364537-10364559 AGAGGGCTGGGAAGACCAGAGGG + Exonic
1144324914 17:14169586-14169608 ACATGGCTGGGGAGGCCATATGG + Intronic
1145262135 17:21360839-21360861 CTAAGGCTGGGGAGGGCAGTGGG - Intergenic
1146289210 17:31596162-31596184 CTATGGCAGGGCAGGGCAGAGGG - Intergenic
1147870054 17:43580932-43580954 GTAGGGCTGGGAAGAGCAGAGGG + Intergenic
1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG + Intronic
1153307507 18:3645628-3645650 CTCTGCCTGGGTAGATCAGAAGG - Intronic
1153809662 18:8740863-8740885 CTATGGCTGTGGATTCCACAAGG - Intronic
1155559220 18:27057730-27057752 CCAGGGCTGGGGAGTGCAGATGG - Intronic
1156481253 18:37437729-37437751 CTCTGGCTGTGGAGATCAGGAGG - Intronic
1158836450 18:61335139-61335161 CTCTGGCTGGGGAACCCTGAAGG + Intronic
1159905162 18:74083246-74083268 CTATGCCTGGGGAGAGTGGAAGG - Intronic
1160866717 19:1259482-1259504 CTGTGGCTGGGGAGAGCTGGTGG - Exonic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1165714759 19:38037203-38037225 CTCTGGCAGAGGAGCCCAGAGGG + Intronic
1166340693 19:42134989-42135011 CCATGGCTGGGGGGCCCTGAGGG - Intronic
1167096527 19:47377574-47377596 CTCTGCCTGGGGACACCAGGTGG - Intronic
1167212146 19:48139938-48139960 CTGTGGTTGGAGGGACCAGAAGG - Intronic
1167324087 19:48813343-48813365 CAGTGGCTGGGGAGAAAAGAGGG + Exonic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
926392101 2:12403838-12403860 CCATGGCTGGGGAGGCCTCATGG - Intergenic
926445874 2:12942370-12942392 CCATGGCTGGGGAGGCCTCATGG + Intergenic
926475347 2:13314797-13314819 CCAGTGCTGGGGAGACCAGGAGG - Intergenic
926957354 2:18316098-18316120 CTTAGACTTGGGAGACCAGAAGG + Intronic
928749233 2:34452828-34452850 ACATGGCTGGGGAGGCCTGAAGG + Intergenic
932656637 2:73616359-73616381 CCACTGCTGGGGACACCAGAGGG - Intergenic
932739453 2:74280601-74280623 AGATGGGTGGTGAGACCAGAGGG + Intronic
933467469 2:82673000-82673022 CTAGAGCTGAGGAGACTAGAAGG + Intergenic
934144027 2:89074361-89074383 ATATGGCTGGGGAGGCCTCACGG - Intergenic
934225217 2:90126197-90126219 ATATGGCTGGGGAGGCCTCACGG + Intergenic
936505662 2:113103751-113103773 AGATGGTTGGGGAGAGCAGAGGG + Intergenic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
938408165 2:131044213-131044235 CTATGGCTGGGGAGAGGAGGTGG + Intronic
939024310 2:136993992-136994014 TTATGGTTGGGGAGAACAGCAGG + Intronic
941924775 2:170884126-170884148 CCATGGCTGGGAAGAACAGCTGG - Intergenic
942364099 2:175204576-175204598 ATATGGCTGCTTAGACCAGAGGG + Intergenic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
942651732 2:178175934-178175956 CTTTGGCTGAGGAGAACTGAAGG - Intergenic
942968577 2:181928171-181928193 CTATTGTTGGGGAAATCAGACGG + Exonic
943928185 2:193815520-193815542 CTATTGCTGGGGAGACTAAAGGG + Intergenic
948170463 2:235897685-235897707 CTGTTGCTGAGGAAACCAGAGGG - Intronic
948891676 2:240909886-240909908 CTATAGCCTGGGAGACCATAGGG + Intergenic
1168944942 20:1745594-1745616 CAAGGGCTTGGGAGAGCAGAAGG - Intergenic
1170299992 20:14872824-14872846 GTATGGCTGGGGAGGCCTCAGGG + Intronic
1171367762 20:24637830-24637852 CTGGGGCTGGGGAGACTCGAAGG - Intronic
1172028676 20:31967141-31967163 CTGGGGCTGGTGAGACCAGAAGG - Intergenic
1172093643 20:32450274-32450296 CTGAGGCTGGGGAGGCCAGTGGG + Intronic
1172639505 20:36432280-36432302 CCAAGGCTGGGGAGCCCAAACGG + Exonic
1173783707 20:45776954-45776976 CTTTGGGTTGGGGGACCAGAGGG + Intronic
1174171238 20:48619473-48619495 CTGAGGCTGGGGAGACATGAGGG - Intergenic
1174455614 20:50646582-50646604 CAATACCTGGGGAGACCAGGAGG - Intronic
1174983413 20:55422502-55422524 ATATGGCTGGGAAGAATAGAAGG + Intergenic
1175251200 20:57611052-57611074 CTGTGGCTGCAGTGACCAGAGGG - Intronic
1175419884 20:58824688-58824710 TTCTGGCAGGGGAGACCACAAGG - Intergenic
1176025181 20:62982053-62982075 CTTGGGCTGGGGACAGCAGAGGG + Intergenic
1176297618 21:5082700-5082722 CTATGGCTGAGCAGACCATAAGG + Intergenic
1178589726 21:33899094-33899116 CTCTGGCTGGGGTGGCAAGAGGG + Exonic
1178728956 21:35081391-35081413 CTATAGATGGGGAGAAGAGAAGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179580010 21:42337155-42337177 TTGTGGCTGGGGAGACAAAATGG + Intergenic
1179804943 21:43831447-43831469 CCATGGGTGGGGACACCAAATGG + Intergenic
1179828569 21:43982009-43982031 CTTTGGCTGGTGGGAGCAGAAGG - Intronic
1179859411 21:44179249-44179271 CTATGGCTGAGCAGACCATAAGG - Intergenic
1180741842 22:18058973-18058995 CTATGCCTGGCCAGATCAGAGGG - Intergenic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183187653 22:36301129-36301151 CCATGGCTCGGGATCCCAGAGGG + Intronic
1183332624 22:37229567-37229589 CCAGGGCTGGGGAGTCCAGGTGG + Intronic
1183508453 22:38221893-38221915 CTTTGGCTGGGGAGCCCCAAGGG + Intronic
951278689 3:20720785-20720807 CTTTAGCTGGGGAGACTAAAAGG - Intergenic
952111081 3:30124507-30124529 ACATGGCTGGGGAGGCCTGAGGG + Intergenic
952204486 3:31166668-31166690 ATATGGCTGGGCAGGCCATAAGG + Intergenic
952506011 3:34007407-34007429 CTGTGGCAGGGGAGACCTGCAGG + Intergenic
954697208 3:52434249-52434271 CTCAGGCTGGGGAGCACAGAGGG - Exonic
956740803 3:72274274-72274296 CTATGAGTGGGGCGACCAGCAGG + Intergenic
959368406 3:105492058-105492080 GTATGGCTGGGGAGGCCTCAGGG + Intronic
959803472 3:110523960-110523982 ACATGGCTGGGGAGGCAAGAAGG - Intergenic
960660698 3:120054912-120054934 ATTTGTCTGGGAAGACCAGATGG - Intronic
960901442 3:122558168-122558190 CTATGGCTGAATTGACCAGATGG - Intronic
961040046 3:123671816-123671838 CTTTGGTGGGGGAGACCAGATGG + Intronic
961760402 3:129162951-129162973 CTATGCCTAGGGAGACTGGATGG - Intergenic
966816972 3:183897191-183897213 CTATCCCTGTAGAGACCAGAGGG + Intergenic
966904022 3:184508769-184508791 TTATGCCTGGGCAGAGCAGACGG - Intronic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
968768046 4:2484873-2484895 CTGTGTCTGGTGAGAACAGATGG - Intronic
972267564 4:37477377-37477399 CTAAGGCTGGGGAGAGCAAGGGG + Intronic
974499690 4:62684149-62684171 CTGTAGCTGGGGAGACTGGATGG + Intergenic
976016420 4:80560412-80560434 CTTTGGCTTGGGAAAGCAGAGGG + Intronic
979126215 4:116975626-116975648 CTATGCCCAGGGAGACCAGGAGG - Intergenic
979763531 4:124436576-124436598 CTATGGCTGTGGACACCTGCAGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
982351474 4:154420154-154420176 GATGGGCTGGGGAGACCAGATGG + Intronic
983905609 4:173178567-173178589 CCAAGGCTGGGAAGCCCAGAAGG - Intronic
987998549 5:25317467-25317489 CTATGGCTGTGGGGACTTGAAGG + Intergenic
988063643 5:26205870-26205892 CTATGGCTTGTTAAACCAGATGG - Intergenic
989224446 5:39010296-39010318 GCATGGCTGGGGAGACCTCAGGG - Intronic
991033944 5:62108973-62108995 CTATGGCAGGAAAGGCCAGAAGG + Intergenic
991704447 5:69344787-69344809 GCATGGCTGGGGAGGCCTGAGGG - Intergenic
992535986 5:77704055-77704077 ACATGGCTGGGGAGACCTCAGGG - Intronic
995245570 5:109931556-109931578 CTGTGGCTGGGGGCATCAGATGG + Intergenic
999295261 5:150455634-150455656 TTATGGCTGGAGGAACCAGAAGG + Intergenic
1002462304 5:179380468-179380490 CTGAGGCTGAGGACACCAGAGGG + Intergenic
1003173669 6:3739243-3739265 CTATGTCTGGGGAGCCCTGGTGG - Intronic
1004267969 6:14165801-14165823 TCATGGCTGGGGCAACCAGAAGG - Intergenic
1004746196 6:18511230-18511252 AGATGGATGGGGAGGCCAGAAGG - Intergenic
1004989887 6:21125337-21125359 TTATGGCTGGGGAGGCCTCAGGG - Intronic
1006946136 6:37785555-37785577 CTATGGCTGGAGTGCCCAGCTGG + Intergenic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010532714 6:76988773-76988795 AGATGGATGGGGAGAACAGAAGG - Intergenic
1013559875 6:111293381-111293403 TTATGGCTGGGAAAACCAGGTGG + Intergenic
1013974370 6:116060189-116060211 CTGTGACTGGGGAGAGCAAAGGG + Exonic
1015133785 6:129844699-129844721 CTATGCCTGGGGAAAGGAGAAGG - Intronic
1015803524 6:137085648-137085670 CTATGTCTGGGCAGCACAGAGGG - Intergenic
1016002217 6:139053234-139053256 CTATGGGTAGGGATACCAGTAGG - Intergenic
1016844676 6:148558880-148558902 CGATGGCTGGGGAGGCTAGGAGG - Intergenic
1016939103 6:149469911-149469933 CTAGGCCGGGGGAGAGCAGAAGG + Intronic
1017399291 6:154040383-154040405 CTATGGCAGGGGAGAAGAAAGGG - Intronic
1017527556 6:155255118-155255140 CTATGGTTGGGCAGAACACAAGG - Intronic
1018523425 6:164679189-164679211 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1019357156 7:586557-586579 CTCGGGCTGGGGGGATCAGAAGG - Intronic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1020214670 7:6180473-6180495 CCACGGCTGTGGAGACCAGGAGG + Intronic
1022293290 7:29023641-29023663 CTATGGATTGGGACACCAGGTGG - Intronic
1022799012 7:33757343-33757365 GTTTGGCTGGGGAGGCCAGCAGG + Intergenic
1023104352 7:36748802-36748824 CTAGGGCTGGGTAGTCAAGAAGG + Intergenic
1024715433 7:52074645-52074667 CTGTGGCACAGGAGACCAGAAGG + Intergenic
1025259113 7:57405258-57405280 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1025609739 7:63067896-63067918 CTCTGGCTGGAGAGAAAAGAGGG + Intergenic
1025710236 7:63901301-63901323 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1026265868 7:68795618-68795640 TAATGGATGGGGAGAGCAGATGG + Intergenic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1026302713 7:69111786-69111808 CTATGGCTGGGGAGGCCTCAGGG + Intergenic
1030630305 7:111888253-111888275 CTAGGGCTGGGGATAGGAGAGGG + Intronic
1032238300 7:130142402-130142424 CTAGGGCTGGGGGTCCCAGAGGG + Intergenic
1032501739 7:132404831-132404853 CTGTGGCCCAGGAGACCAGAAGG + Intronic
1032626949 7:133601715-133601737 CTGTGGCTGGTGAGAGCACAGGG - Intronic
1033505886 7:141999420-141999442 CCATGGCTGTGGAGTCCAAAGGG + Intronic
1035125251 7:156604470-156604492 CGAAGGCTGGGGAGACGAGGGGG - Intergenic
1035577248 8:715664-715686 CCTTGGCTGGGGAGTCCACAGGG + Intronic
1035650549 8:1260849-1260871 CTAAGGCTGGAGAGCCCTGATGG - Intergenic
1036824637 8:11966531-11966553 CTATGACTGGGAAGACAGGATGG + Intergenic
1036902867 8:12684697-12684719 CTATGACTGGGTAGTGCAGAGGG + Intergenic
1038331173 8:26610655-26610677 CTATGCCAGGGGAGAGCAGGGGG - Intronic
1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG + Intronic
1042616871 8:70659276-70659298 CTGTGGGTAGGGAGACCAAAAGG + Intronic
1043280483 8:78459651-78459673 CAAAGACTGGGGAGAACAGAAGG + Intergenic
1044900340 8:96937318-96937340 CTATGGCTGAGTGGGCCAGATGG + Intronic
1045505234 8:102773548-102773570 CTATTGCTGGGGAGACCACATGG - Intergenic
1045675093 8:104598712-104598734 GCAAGGCTGGGGAGAACAGAGGG - Intronic
1047181443 8:122592630-122592652 CTAAGGCTTGGGAGACTAAATGG + Intergenic
1047888179 8:129276576-129276598 CTATGGGAGGGGAGGCCATAAGG - Intergenic
1048146649 8:131851467-131851489 CTATGACTGGGGACTCAAGAGGG + Intergenic
1049358117 8:142198706-142198728 GTGTGGCTGGGGTGAGCAGAGGG + Intergenic
1049613725 8:143567483-143567505 CTCAGGCTGGGGAGCCCAGGAGG + Intronic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1051242569 9:15075362-15075384 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1053370983 9:37561441-37561463 CTGAGGCTGGGGACACCAGGTGG - Intronic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1054975626 9:71140888-71140910 CTCTGCCTGGGGAGACCCGGGGG + Intronic
1056245581 9:84691809-84691831 CTATGGCTGGGGAGGCCGTCTGG - Intronic
1056947516 9:91012236-91012258 CTATCTCTGGGGTGACCAAAGGG + Intergenic
1058596202 9:106618278-106618300 TTATGGCTGGAGAGACAACATGG - Intergenic
1059524743 9:114980233-114980255 CTATGGCTGAGGACTCCACAGGG + Intergenic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1061032177 9:128091972-128091994 CCCTGCCTGGAGAGACCAGATGG + Intronic
1062211377 9:135366095-135366117 CAAGCACTGGGGAGACCAGAGGG - Intergenic
1186489259 X:9958680-9958702 AACTGGCTGGGTAGACCAGAAGG - Intergenic
1186741029 X:12518037-12518059 CTGAGGCTGGGGAGACTGGATGG - Intronic
1187767687 X:22661354-22661376 CTATGTCTGGGGAGATTGGATGG - Intergenic
1189319613 X:40079807-40079829 CTAGGGCTGGGCAGACCACAAGG + Intronic
1189701813 X:43720295-43720317 CGGTGGCTGGGGAGACAAGAAGG + Intronic
1190483442 X:50900367-50900389 AAATGGCTACGGAGACCAGACGG + Intergenic
1191066989 X:56358758-56358780 ATATGCCTGGGGAGCCAAGATGG - Intergenic
1192469498 X:71385444-71385466 CTATGGCTGGGGACTGTAGATGG - Intronic
1192788061 X:74354106-74354128 CTAGGGCTGTGGTGACCAGTTGG - Intergenic
1195275224 X:103275090-103275112 CTATGGCTGGTGAGGATAGAGGG - Intronic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197799005 X:130329497-130329519 CCAGGGGTGGGGAGATCAGATGG - Intergenic
1198078419 X:133215957-133215979 GTGTGGCTGGGGACAGCAGAGGG - Intergenic
1201737704 Y:17287248-17287270 CTATGGATGGGGAAACAGGATGG + Intergenic
1201907183 Y:19097530-19097552 ACATGGCTGGGGAGACCTCAGGG + Intergenic