ID: 1143060492

View in Genome Browser
Species Human (GRCh38)
Location 17:4196543-4196565
Sequence CCCCTTTCCAGAAATAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143060492_1143060495 16 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060495 17:4196582-4196604 AATATTGTTAAATATGCAAAGGG 0: 1
1: 1
2: 6
3: 74
4: 806
1143060492_1143060494 15 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060494 17:4196581-4196603 AAATATTGTTAAATATGCAAAGG 0: 1
1: 1
2: 9
3: 112
4: 934
1143060492_1143060496 27 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143060492 Original CRISPR CCCCTTTCCAGAAATAGTTG AGG (reversed) Intronic
902440590 1:16427131-16427153 CCTATTTCCAGAAATGGGTGAGG + Intronic
904562888 1:31410676-31410698 CCCCTTCCCGGAAATAGGTAGGG - Intronic
907583440 1:55592704-55592726 CCACTTTCCAGAAAAGGTTATGG - Intergenic
908085225 1:60625207-60625229 ATCCTTTCCAGAAAGGGTTGGGG + Intergenic
908139490 1:61169495-61169517 CCCCTTTCCACATTTGGTTGGGG - Intronic
909158370 1:72111836-72111858 CCAATTTCCTGAAATATTTGTGG + Intronic
909804247 1:79855041-79855063 CACCCTTTCAAAAATAGTTGTGG - Intergenic
911550065 1:99267753-99267775 CCAATTTCTAGAAATAGTTTGGG + Intronic
912102478 1:106228054-106228076 CCTCTTTCTATAAATAGTTTAGG - Intergenic
912648076 1:111414214-111414236 CCTCTTTCCAAAAATAGCAGTGG + Intergenic
912821461 1:112871151-112871173 CTCCTTTCCAGGGAGAGTTGAGG - Intergenic
913177046 1:116284138-116284160 CCCCATTACAATAATAGTTGGGG - Intergenic
914392766 1:147236990-147237012 CCCCTTTGCACAAACAGTTTGGG - Intronic
916145972 1:161739707-161739729 CCCCTATCCAAAAAAAGTTAAGG - Intergenic
920002993 1:202812039-202812061 TCCCTTTCAACAAATATTTGTGG - Intergenic
921751886 1:218804221-218804243 CCTTTTGCCAGAAATAGTTTAGG + Intergenic
922250424 1:223845151-223845173 CCCCTTTCCACAAAGAGGTAAGG + Intronic
923775260 1:236972520-236972542 CCCCTTTTCAAATACAGTTGAGG - Intergenic
924618194 1:245632943-245632965 CCCCAATGCAGTAATAGTTGAGG - Intronic
1065360538 10:24885147-24885169 ACCCTTTGCTGAAATAGTTAAGG - Intronic
1065766567 10:29035705-29035727 CCCCTTTCCAGAGTTGTTTGTGG - Intergenic
1066528295 10:36306997-36307019 GCCCTTTCCACAAATATCTGTGG - Intergenic
1067199765 10:44157017-44157039 CTCCCTGCCAGAAATAGCTGTGG + Intergenic
1068474096 10:57503249-57503271 CCCATATCCAGAAATATTTTTGG - Intergenic
1068816909 10:61326411-61326433 CCTCTTTGCAGAAAAAGATGTGG + Intergenic
1069559338 10:69418578-69418600 CCCCTTTACATAAACAGTGGAGG - Intergenic
1070031671 10:72683007-72683029 CCCCTTCTCAGAAATAGTCCTGG - Intergenic
1072879927 10:99216575-99216597 AACCTTACCTGAAATAGTTGAGG - Intronic
1073329485 10:102661174-102661196 CCCCTTTCCGGGAAGGGTTGGGG + Intergenic
1073527583 10:104199127-104199149 AGCCTTTGTAGAAATAGTTGAGG + Intronic
1073959990 10:108914445-108914467 CCCCATTTAAGAAATAATTGGGG - Intergenic
1076301171 10:129427486-129427508 TCACTTTCCAGAAACATTTGAGG - Intergenic
1086001281 11:81988448-81988470 CCCCTTTCCAGAGATATGAGGGG + Intergenic
1089735787 11:120549531-120549553 CCCCTTTCCTGTAAGAGGTGAGG + Intronic
1090543260 11:127732305-127732327 CCATTTTCCAGAAATATTTATGG + Intergenic
1092163556 12:6329236-6329258 CTCCTTTCCAGAAAAAAGTGGGG + Exonic
1095858790 12:46891527-46891549 CCCCTTTCCACAAATAGAGCTGG - Intergenic
1096647834 12:53047944-53047966 CCCCTTTCTGGAAATAGCTGTGG - Intronic
1097902470 12:64887020-64887042 CAAATTTCTAGAAATAGTTGGGG + Intergenic
1097924437 12:65111647-65111669 CCACTTTCCAGGAATTGTTAAGG + Intronic
1099421419 12:82466698-82466720 CCTCAATCCAGTAATAGTTGGGG - Intronic
1099846815 12:88037273-88037295 CCCCTACCCAGAAATTGTAGAGG + Intronic
1100584227 12:95964500-95964522 CCCCCTTCCATAAATACTTAGGG - Intronic
1102478542 12:113204618-113204640 GCCCTTTGTAGAAAAAGTTGGGG + Intronic
1114337943 14:21712375-21712397 CACCCTTCCAGAGAGAGTTGAGG - Intergenic
1114691768 14:24589295-24589317 CCCTTTTCCACAAATAGTGCTGG - Intergenic
1115231777 14:31168212-31168234 CCCTTTTCCAGAAGTATTTGAGG - Intronic
1117902013 14:60544155-60544177 CCACTTTCCAGAGATTGATGTGG - Intergenic
1119679446 14:76581026-76581048 GCCCTTTACAGAAAAAGTTTGGG - Intergenic
1123166559 14:106330722-106330744 CCCTTCTCCAGCACTAGTTGTGG + Intergenic
1128326429 15:66726829-66726851 CCCCATTCCAAAAATGGTTGGGG + Intronic
1131364947 15:91831015-91831037 CCCCCTTCCTGAAACAGTTTAGG - Intergenic
1132518136 16:375424-375446 TCCCTTTCCAGACAGAGATGCGG - Exonic
1137753506 16:50884045-50884067 CTCCTTTCCAAAGATACTTGAGG - Intergenic
1138367755 16:56495828-56495850 CCCTTTGTCTGAAATAGTTGTGG + Intronic
1138886668 16:61088287-61088309 TCCCTTTTAAGAAATAGTTCTGG + Intergenic
1140044624 16:71432301-71432323 CCCCATTCCAGATGAAGTTGTGG - Intergenic
1140518240 16:75560047-75560069 CCCCTTTCCAGTAACACTTTGGG + Intergenic
1142606554 17:1084627-1084649 AGCCTTTCCATAAATATTTGGGG - Intronic
1143060492 17:4196543-4196565 CCCCTTTCCAGAAATAGTTGAGG - Intronic
1144776890 17:17789285-17789307 CCCCTTTACAGAAAAAAGTGAGG - Intronic
1145199257 17:20926667-20926689 CCACTTCCCTGAAATATTTGTGG + Intergenic
1145259283 17:21345200-21345222 CCCCTTCCCAGAGGTAGGTGAGG + Intergenic
1145317332 17:21742749-21742771 CCCCTTCCCAGAGGTAGGTGAGG - Intergenic
1145775428 17:27524577-27524599 CCCCTTTGCAGAGATACTGGAGG - Intronic
1146284990 17:31568387-31568409 ATCCTTTCCACAAAGAGTTGTGG + Intergenic
1146988349 17:37243709-37243731 CCCATGTATAGAAATAGTTGTGG + Intronic
1151003172 17:70401841-70401863 CCCCTTTCCAGGGGAAGTTGAGG + Intergenic
1152360566 17:79831435-79831457 CACCTTTCCAGGAATGGTAGTGG + Intergenic
1157110237 18:44813829-44813851 CCCATGTCCAGAAACAGATGTGG - Intronic
1164647527 19:29870580-29870602 CACATGTCAAGAAATAGTTGAGG - Intergenic
926775479 2:16418140-16418162 CCCCTTTCCAAAAAAACCTGAGG + Intergenic
928700686 2:33895750-33895772 CCCCTTTCCAGTAATACTTGTGG + Intergenic
933134369 2:78713292-78713314 CTGCTTTCCAGAACTAGTGGAGG + Intergenic
934737477 2:96697153-96697175 CCACTTTAGAGCAATAGTTGGGG - Intergenic
941700218 2:168596392-168596414 CCTCCTTCCAGAAATTGTTCAGG + Intronic
944206543 2:197163926-197163948 CACCTTTTAAGAAATAGTGGTGG - Intronic
948903963 2:240969078-240969100 CCTCTTTCCAGAATGGGTTGAGG - Intronic
1170091544 20:12594343-12594365 CCCCTTTCCTCAAATATTTAAGG - Intergenic
1172643317 20:36454928-36454950 CCACATTCCAGAAATAGCTCTGG + Intronic
1174642932 20:52060916-52060938 CTGCTCTCCAGAAGTAGTTGGGG - Intronic
1174741449 20:53018405-53018427 CCCCTTTCCAGGACTAGCAGTGG - Intronic
1177901553 21:26923526-26923548 TCCGTTTCCAGAAAGAGCTGTGG - Exonic
1179274404 21:39878905-39878927 AACATTTCCAGAAATATTTGAGG - Intronic
1181963849 22:26642929-26642951 CTCCTTTCCACAAATGGCTGTGG - Intergenic
1183562015 22:38582618-38582640 ACCCTTTCCAGAAATGACTGAGG - Intronic
951604567 3:24418900-24418922 AGTCTTTCCAGAAATATTTGTGG - Intronic
953047095 3:39303683-39303705 CCCCAATACAAAAATAGTTGGGG + Intergenic
954900068 3:54011641-54011663 ACTTTTTCCAGAAATAATTGAGG - Intergenic
955816074 3:62844798-62844820 CCCATTTTCAGAGAAAGTTGTGG + Intronic
956087505 3:65628183-65628205 TGCCTTTCCATAAATAGTTTTGG + Intronic
956371822 3:68571293-68571315 CACCTGCCCAAAAATAGTTGTGG + Intergenic
959628764 3:108484283-108484305 CTGCTTACCAGAAATATTTGAGG - Intronic
961093760 3:124137692-124137714 ACCCTTTCCAGAAATACTGGAGG + Intronic
961241584 3:125416361-125416383 CCCCCATCCAGAAATCCTTGGGG + Intergenic
963617940 3:147567336-147567358 CCCTTTTCAATAAATAGTTTTGG + Intergenic
970013218 4:11483297-11483319 CCTCTTTCCTGATAGAGTTGAGG - Intergenic
970403857 4:15743615-15743637 GCCCTTGCCAGAAATAGGAGGGG - Intergenic
971250556 4:24970268-24970290 CACCTTTCCAGCAACAGCTGTGG + Intronic
973897784 4:55432847-55432869 CCCATCTCCACAAATAGTCGGGG - Exonic
974376949 4:61090493-61090515 CCCCTTTCCAGCAAAAGATGAGG + Intergenic
974516484 4:62919849-62919871 CCCCTTTTCTGAAATATGTGTGG - Intergenic
976413678 4:84746830-84746852 CCCCATTTTAGAAATAATTGAGG + Intronic
977366909 4:96081744-96081766 CAACTTTCAAGAAATACTTGTGG + Intergenic
982577578 4:157134736-157134758 CCCTATTTCAGAAAGAGTTGAGG + Intronic
983741401 4:171139066-171139088 CCCAGTTCCTGAAATAGTTCTGG + Intergenic
987582117 5:19807492-19807514 CCCCTTTAAGGAAATAATTGGGG - Intronic
993295901 5:86139640-86139662 CCTCTTATCAGAAATAATTGAGG + Intergenic
994659397 5:102635461-102635483 CCCTTTTCAACAAATAGTTCTGG + Intergenic
996056148 5:118984855-118984877 CCTCATTCCAGAAATATTTTAGG - Intronic
997803123 5:136886968-136886990 ACACTTTCCTGACATAGTTGGGG - Intergenic
999936295 5:156489267-156489289 CTCCTATACAGTAATAGTTGGGG + Intronic
1003567112 6:7230916-7230938 CCCCTTTCCTGAAGTTCTTGGGG - Exonic
1004256638 6:14070538-14070560 CTCCATTCCAGAAATGGCTGGGG - Intergenic
1004555059 6:16688681-16688703 CCCCTTTCCAGAAAATATTCTGG + Intronic
1005615541 6:27568888-27568910 CCCCTTTCCAGCAAAAGTCATGG + Intergenic
1008242974 6:49135259-49135281 CCCCTTACCAGGAATATTTTTGG - Intergenic
1011340466 6:86307753-86307775 CCCCTTTCCTGAAATGGCTCAGG - Intergenic
1011950933 6:92963131-92963153 CCTCTTCCCAGAAATTTTTGAGG + Intergenic
1014870086 6:126583774-126583796 TCCCTTCTCAGAAATAGTAGTGG + Intergenic
1016358400 6:143242435-143242457 CCCCCTTCCCCATATAGTTGTGG - Intronic
1016838156 6:148500234-148500256 CTCCTTTCAAGATACAGTTGAGG + Intronic
1019344089 7:521173-521195 CCCCTTCCCCCAAATATTTGGGG + Intergenic
1020675201 7:11175133-11175155 CCCCTTTCAAAAAATATTAGAGG - Intergenic
1022403208 7:30061336-30061358 CCCATTTCCAGTGGTAGTTGTGG + Intronic
1023132938 7:37021241-37021263 CCCCTGTCCTGAAATAGCAGGGG - Intronic
1023493635 7:40770530-40770552 ACCTTCTCCCGAAATAGTTGGGG - Intronic
1024607103 7:51030966-51030988 CTCCTTTCCAGGAATATCTGAGG + Intronic
1026086893 7:67270240-67270262 ACCCTTTCCAGAAAAGGTTTGGG + Intergenic
1026556084 7:71409832-71409854 CCCCAGCCCAGAAATCGTTGGGG - Intronic
1026626003 7:71993068-71993090 CCCCATTCCAAATATAGTTCTGG + Intronic
1026690219 7:72544481-72544503 ACCCTTTCCAGAAAAGGTTTGGG - Intergenic
1028856331 7:95597515-95597537 CCCCTTTCCTGAAAGAGATCAGG + Intergenic
1033202540 7:139385904-139385926 CCTTTTTCAACAAATAGTTGCGG - Intronic
1034534865 7:151720378-151720400 GCCCTTTCCAGAAAGGGTGGAGG + Intronic
1038171159 8:25133871-25133893 CTCCTTTCCAGAGTTAGGTGTGG - Intergenic
1042788750 8:72580056-72580078 GCCCTTTACAGAAAAAGTTGTGG - Intronic
1043750700 8:83929890-83929912 ACCCTTTTCAGAAATACTAGAGG + Intergenic
1047054277 8:121146693-121146715 CCCTTTTCTAGCAATAGTTGTGG + Intergenic
1050624537 9:7488818-7488840 TCCCTCTCCAGAAAAAGTGGAGG + Intergenic
1052068525 9:24052979-24053001 GCCTTTTGCAGAAAGAGTTGTGG + Intergenic
1052088718 9:24299701-24299723 GTCATTTCCAGAAATAATTGGGG - Intergenic
1055968251 9:81886368-81886390 CCTCTTTCCACAAATGGTGGTGG - Intergenic
1056347365 9:85711738-85711760 GCCCTTTACAGAAAAAGTTTAGG - Intronic
1056501713 9:87216079-87216101 ACCCTTTCCATAAAGAGTAGGGG + Intergenic
1060095024 9:120781128-120781150 GCCCTTTACAGAAAAAGTTTTGG - Intronic
1060360211 9:122948960-122948982 CCCCTGTCCACAAGTAGTTTGGG + Intronic
1061605597 9:131708271-131708293 CCTCTTGCCAGAAGAAGTTGCGG - Intronic
1187333272 X:18360102-18360124 ACACTTTACAGAAATATTTGAGG - Intergenic
1188746892 X:33856031-33856053 GGCCTTTTCAGAAATTGTTGAGG - Intergenic
1189527446 X:41839138-41839160 TTCCTTTCCAGAAATATTTTAGG + Intronic
1189663829 X:43331930-43331952 CTTCTTTCCAAAAACAGTTGTGG - Intergenic
1191150570 X:57217515-57217537 CCCTTTTCAACAAATAGTTCTGG - Intergenic
1193794415 X:85855616-85855638 CTCCTTTTCAGAAATAGTGGAGG + Intergenic
1198032025 X:132762462-132762484 ATCCTTTTCAGAAATAGGTGGGG + Intronic
1199394921 X:147324198-147324220 CCCCTTTCCAGTAACAGCTGGGG + Intergenic