ID: 1143060492

View in Genome Browser
Species Human (GRCh38)
Location 17:4196543-4196565
Sequence CCCCTTTCCAGAAATAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143060492_1143060494 15 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060494 17:4196581-4196603 AAATATTGTTAAATATGCAAAGG 0: 1
1: 1
2: 9
3: 112
4: 934
1143060492_1143060496 27 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 59
1143060492_1143060495 16 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060495 17:4196582-4196604 AATATTGTTAAATATGCAAAGGG 0: 1
1: 1
2: 6
3: 74
4: 806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143060492 Original CRISPR CCCCTTTCCAGAAATAGTTG AGG (reversed) Intronic