ID: 1143060496

View in Genome Browser
Species Human (GRCh38)
Location 17:4196593-4196615
Sequence ATATGCAAAGGGCCGTGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143060492_1143060496 27 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143060496 Original CRISPR ATATGCAAAGGGCCGTGCTA TGG Intronic