ID: 1143060496 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:4196593-4196615 |
Sequence | ATATGCAAAGGGCCGTGCTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 65 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 59} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1143060492_1143060496 | 27 | Left | 1143060492 | 17:4196543-4196565 | CCTCAACTATTTCTGGAAAGGGG | 0: 1 1: 0 2: 1 3: 9 4: 145 |
||
Right | 1143060496 | 17:4196593-4196615 | ATATGCAAAGGGCCGTGCTATGG | 0: 1 1: 0 2: 0 3: 5 4: 59 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1143060496 | Original CRISPR | ATATGCAAAGGGCCGTGCTA TGG | Intronic | ||