ID: 1143060496

View in Genome Browser
Species Human (GRCh38)
Location 17:4196593-4196615
Sequence ATATGCAAAGGGCCGTGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143060492_1143060496 27 Left 1143060492 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143060496 Original CRISPR ATATGCAAAGGGCCGTGCTA TGG Intronic
900710600 1:4111035-4111057 ATAGGCAAAGGGCTGTCCTGTGG + Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
914457006 1:147845654-147845676 GTGTGCAAAGGGCCCTTCTAGGG + Intergenic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG + Intergenic
921124582 1:212166146-212166168 ATATGGAAAGGGTCCTGCTGAGG - Intergenic
1072919709 10:99566008-99566030 ACTTGCAAAGGGCCCTGCTCTGG - Intergenic
1073846625 10:107563336-107563358 ATATATAAAAGGCTGTGCTATGG + Intergenic
1076262419 10:129078331-129078353 AGATGCCAAGGGCCCTGCCAGGG + Intergenic
1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG + Intergenic
1089690016 11:120181327-120181349 CAATGCAAAGTGCAGTGCTATGG - Intronic
1091970774 12:4785093-4785115 ATGTGCAGAGAGCTGTGCTAGGG - Intronic
1092648311 12:10604103-10604125 ATATGGAAAAGACTGTGCTAGGG + Intergenic
1097900435 12:64867625-64867647 ATATGCCAGGGTCTGTGCTAAGG - Intronic
1109813532 13:67547508-67547530 ATAGGAAAAGGGCCCTGCTGTGG - Intergenic
1111087331 13:83393555-83393577 ATAAGCAAATGACCTTGCTAAGG - Intergenic
1115410444 14:33068083-33068105 CTATGCAAAGCACCATGCTAGGG + Intronic
1124050452 15:26192340-26192362 AAATGCAAAAGGCCGTGAAAAGG - Intergenic
1125285162 15:38084699-38084721 ATATGCCAAGGTTTGTGCTAGGG - Intergenic
1135574359 16:23573852-23573874 GTGTGCCAAGGGCCGTGCAAGGG + Exonic
1137502207 16:49020064-49020086 ATATACACAGGGCCGGGCCAAGG + Intergenic
1140016628 16:71193044-71193066 ATATGCAAAGGACAGAGTTATGG - Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144049505 17:11486477-11486499 ATATGCAAAGTACTATGCTAAGG + Intronic
1144220183 17:13092673-13092695 AAATGCAATGGGAAGTGCTATGG + Intergenic
1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG + Intronic
1157596346 18:48866326-48866348 ATATACAAAGGGTGCTGCTATGG - Intergenic
1168710533 19:58497623-58497645 ATATGCAAAGGGCTGTCCGTGGG - Intronic
926079079 2:9969263-9969285 ATATGCTAGGTGCTGTGCTAAGG + Intronic
930340772 2:50111713-50111735 ATATTCAAAGGGCTGTGATTTGG - Intronic
930582099 2:53224130-53224152 ACATGCATAGGGCCATGCTTTGG + Intergenic
935452793 2:103229652-103229674 ATATTCAATGGGCTGTGCAAAGG - Intergenic
935914147 2:107931147-107931169 ATAAGCAATGGGCCTTGCTAGGG - Intergenic
937274052 2:120673010-120673032 TCATGCAGAGGGCCGTGCGAGGG - Intergenic
942631217 2:177951679-177951701 TCATGCAATGGGCAGTGCTATGG + Intronic
944179421 2:196872245-196872267 ATTTGCAAATGGCCCAGCTATGG + Intronic
947373454 2:229471723-229471745 ATTTGCAAAGCACAGTGCTAAGG + Intronic
948970095 2:241418792-241418814 ATATGCAAAGGGCCTGAATAAGG - Intronic
1170757232 20:19214790-19214812 ATGCGGAAAAGGCCGTGCTATGG - Intronic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1173347617 20:42215409-42215431 ATATGCCAAAGACCATGCTAGGG - Intronic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
956641320 3:71418353-71418375 ATATGCAAATGGCCTTTCTGTGG - Intronic
957141607 3:76366056-76366078 ATATGCAAAGGGCTGAGAAATGG - Intronic
959597918 3:108147851-108147873 ATATACAAAGGGCTGTGCCAGGG - Intergenic
961407422 3:126691222-126691244 ATATGGCAAAGGCAGTGCTAAGG + Intergenic
964090147 3:152866252-152866274 ACATGCAAAGGGCCTTTCTAAGG - Intergenic
967820402 3:193834383-193834405 AGATGCAAGGGACCGTTCTAAGG - Intergenic
969339271 4:6530145-6530167 ATATTCCATGGGCGGTGCTAAGG - Intronic
977714726 4:100169104-100169126 ATTTGCAAAGGTCCTTTCTAAGG + Intergenic
991566910 5:68014821-68014843 ATATGCCAGGGGCCTTGCTTGGG + Intergenic
1005500777 6:26427263-26427285 ATATGCAAAGGGCCTGGGGAAGG + Intergenic
1005505344 6:26464583-26464605 ATATGCAAAGGGCCTGGGGAAGG + Intronic
1007593468 6:43037494-43037516 ATATGCCAAGGGTCTTGTTAGGG - Intergenic
1020333125 7:7040424-7040446 ATATCCAATGGACAGTGCTATGG - Intergenic
1026148415 7:67768232-67768254 ATTTGCAAATGGCAGAGCTAGGG + Intergenic
1029897957 7:104006289-104006311 ATATGCCAAGCATCGTGCTAGGG + Intergenic
1032415546 7:131732791-131732813 ATTTGCACAGGGGCTTGCTATGG + Intergenic
1036504063 8:9339371-9339393 AGATGCAAAGGGCCAAGCTCAGG + Intergenic
1038039292 8:23710357-23710379 AGATGGAGACGGCCGTGCTAGGG + Intergenic
1038246788 8:25865563-25865585 ATATGCCAAGCACCGTGCTGAGG - Intronic
1042131163 8:65587901-65587923 ATATTCAATGGGGCCTGCTATGG - Intergenic
1058231773 9:102435280-102435302 ATATGAAAAGGTACGTGGTATGG - Intergenic
1059859376 9:118441491-118441513 AGATGCAAAGAGCAGTGTTAGGG - Intergenic
1188741102 X:33783132-33783154 ATATGCAGAGTACCATGCTAGGG - Intergenic