ID: 1143060995

View in Genome Browser
Species Human (GRCh38)
Location 17:4200958-4200980
Sequence CTGTATATTCAAATGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143060995_1143060999 -1 Left 1143060995 17:4200958-4200980 CCCATTTTCATTTGAATATACAG 0: 1
1: 0
2: 0
3: 34
4: 455
Right 1143060999 17:4200980-4201002 GGTTTCATCTGGTTCTCAGTAGG 0: 1
1: 0
2: 2
3: 21
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143060995 Original CRISPR CTGTATATTCAAATGAAAAT GGG (reversed) Intronic
904678535 1:32213197-32213219 CTCTATATTTAAAAGAAAAAAGG - Intronic
904949142 1:34222088-34222110 CTATAAATTCAAATTAAAAAAGG + Intergenic
907645322 1:56236582-56236604 CTGTTTCTCCATATGAAAATGGG + Intergenic
907764056 1:57390725-57390747 CTGAATAATGAAATGAAAACGGG - Intronic
908965239 1:69753648-69753670 CTGTATAAGCAAATGAATACGGG - Intronic
908977232 1:69912437-69912459 CAATATGTTCTAATGAAAATGGG + Intronic
909376861 1:74950949-74950971 CTGTAAAATCAAAAGAAAGTTGG - Intergenic
909767500 1:79375152-79375174 TGGTATTTTAAAATGAAAATTGG + Intergenic
909854611 1:80512725-80512747 ATGAATATTCAAATAAAATTTGG + Intergenic
911447347 1:98014097-98014119 CTGAATATTTAAATGAGGATGGG + Intergenic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
911779158 1:101853681-101853703 CTGTATATTCACACTAAAAATGG - Intronic
911819382 1:102397890-102397912 CTGAATATTCAAATGAGATGAGG + Intergenic
911926006 1:103833854-103833876 ATGTATAATGACATGAAAATTGG + Intergenic
912699102 1:111863005-111863027 CTTTCTATTCTAATCAAAATGGG - Intronic
913372856 1:118119823-118119845 ATGTATATTCAAACACAAATGGG + Intronic
913396277 1:118375966-118375988 CTGTAAAATCAAAAGCAAATTGG + Intergenic
913658573 1:120985296-120985318 CTGTTTCATCAAATGGAAATGGG - Intergenic
914009937 1:143768416-143768438 CTGTTTCATCAAATGGAAATGGG - Intergenic
914523185 1:148436540-148436562 CTGTTTCATCAAATGGAAATGGG - Intergenic
914648558 1:149677077-149677099 CTGTTTCATCAAATGGAAATGGG - Intergenic
916230701 1:162538512-162538534 TTTCATATTTAAATGAAAATGGG + Intergenic
917002705 1:170377218-170377240 CTGCTTCTTCAAATGAAGATTGG - Intergenic
918677934 1:187312880-187312902 CTGTAGAGCCAAATGAAAAGTGG + Intergenic
918729842 1:187979340-187979362 GTGAATATTTAAATGCAAATTGG + Intergenic
918746865 1:188213199-188213221 ATATATATTCTAATTAAAATGGG - Intergenic
919080836 1:192863940-192863962 CTGAACATGAAAATGAAAATCGG - Intergenic
919377505 1:196813141-196813163 CTGTTAATTCAACTAAAAATTGG + Intergenic
919387019 1:196935039-196935061 CTGTTAATTCAACTAAAAATTGG + Intronic
919456506 1:197826787-197826809 CTATATATTAAAATGAAATAGGG + Intergenic
920809562 1:209269666-209269688 CAGTATGTAAAAATGAAAATTGG - Intergenic
922501581 1:226100775-226100797 GTGTATAATGAAATGAAATTGGG - Intergenic
922628583 1:227080237-227080259 CTGTATTTCCAAGTAAAAATAGG - Intronic
922921883 1:229312321-229312343 CAGTATTTTCATATGAAAAGGGG - Intergenic
923792404 1:237123277-237123299 CAGTATTTTTAAATAAAAATAGG - Intronic
924439228 1:244072755-244072777 CTGTATTTCCAGCTGAAAATGGG + Intergenic
1063572108 10:7225200-7225222 CGGTGGATTGAAATGAAAATAGG - Intronic
1063618901 10:7626750-7626772 CTCTGAATTCAAATGAAACTGGG + Intronic
1066591939 10:37005209-37005231 TTTTATATTCAAGTGAAACTAGG + Intergenic
1067003100 10:42636186-42636208 CAGTACATCCAAAAGAAAATTGG + Intronic
1068742253 10:60486833-60486855 CTGTATATACTACAGAAAATTGG - Intronic
1069318786 10:67141904-67141926 CTGTTTATTAAACTGTAAATTGG - Intronic
1069357579 10:67605176-67605198 CTATATATACAAAGGAAAAAAGG + Intronic
1069372994 10:67766808-67766830 CTGTATATGCATATTAAAAATGG - Intergenic
1071133094 10:82418444-82418466 CAGTTTATGCAAATGAAAAGAGG + Intronic
1071245331 10:83755098-83755120 CTGTATTTTGAAATGTAAAAAGG + Intergenic
1072594647 10:96860053-96860075 GTGGTTCTTCAAATGAAAATTGG + Intronic
1072794279 10:98342511-98342533 CTGTATATTAAAAAGAGAAATGG - Intergenic
1074130745 10:110571764-110571786 ATATATATTTAAATAAAAATGGG + Intronic
1074797062 10:116957594-116957616 TATTATATTCAAATGTAAATAGG + Intronic
1075432115 10:122394386-122394408 TTTTATCTTCAAATAAAAATTGG + Intronic
1079778708 11:24569561-24569583 CTCTACATGCCAATGAAAATAGG + Intronic
1080023419 11:27588492-27588514 GTATATATCCAAAAGAAAATAGG - Intergenic
1080348630 11:31355971-31355993 CGGTATATCCAAAAGGAAATGGG + Intronic
1080380373 11:31764615-31764637 CTGGATTTTTAAATGAAAATGGG - Intronic
1080382240 11:31785036-31785058 CTTTATTTTGAAAAGAAAATGGG - Exonic
1080547218 11:33332598-33332620 CTTTATATTCAAATTATATTTGG + Intronic
1080886697 11:36374772-36374794 CAGTTTACTCATATGAAAATGGG - Intronic
1081111607 11:39141549-39141571 TTACATAATCAAATGAAAATGGG + Intergenic
1081189469 11:40085133-40085155 CTGTATCTGCAAATAAAATTGGG + Intergenic
1081240384 11:40698521-40698543 CTTTATCTTCAAATGGAAAATGG + Intronic
1081275339 11:41141462-41141484 ATGTATAATTAAATTAAAATTGG - Intronic
1081305098 11:41502076-41502098 CTTTATATACAAATATAAATAGG - Intergenic
1082144687 11:48652663-48652685 ATGTATCTTCAAATAAAAATTGG + Intergenic
1082189635 11:49227171-49227193 AAGTAGATTCAAATGAGAATGGG - Intergenic
1083051997 11:59785634-59785656 CTTCATATTCAATAGAAAATAGG - Intronic
1083079834 11:60079732-60079754 CTGTATATTAAAATTTAAAAAGG - Intergenic
1085438565 11:76534811-76534833 CTCTATATTCAGATTATAATGGG - Intronic
1086316008 11:85593077-85593099 CTATATTTTAAAAAGAAAATTGG + Intronic
1086676890 11:89619329-89619351 AAGTAGATTCAAATGAGAATGGG + Intergenic
1086947680 11:92859487-92859509 CTGAATGTTCAAAAGGAAATGGG - Intronic
1087165189 11:94996211-94996233 CTGTATGTTCATTTAAAAATAGG - Intronic
1087507850 11:99049794-99049816 CTGTATAGACAATTGACAATAGG - Intronic
1088018561 11:105090590-105090612 CTGGAAGCTCAAATGAAAATTGG + Intronic
1088518176 11:110661161-110661183 CTTTTTATTAAAATGAAAATAGG - Intronic
1090099337 11:123777729-123777751 GGGTATATGCAAATGCAAATTGG + Intergenic
1090851446 11:130574097-130574119 CTGTATTTTCTAATAAAACTTGG + Intergenic
1091176903 11:133567196-133567218 CTGGATATACAAAAAAAAATAGG + Intergenic
1091615196 12:2045701-2045723 CTTGAGATTCAAGTGAAAATGGG + Intronic
1092317753 12:7437692-7437714 CTGTATATTTATTTGAAAACCGG + Intronic
1092631740 12:10386851-10386873 CAGTATATTGAAATGAATCTTGG - Intronic
1093189843 12:16061310-16061332 CTGTATTTTTGAATAAAAATCGG + Intergenic
1094246930 12:28308950-28308972 ATGTATATTGGAATGAAAATAGG - Intronic
1094380953 12:29842050-29842072 CTGAAGATTCAAATGATCATTGG + Intergenic
1095031338 12:37286295-37286317 GTGTATCTTCAAATAAAAACTGG + Intergenic
1097095009 12:56540031-56540053 CTGACTAGTCTAATGAAAATAGG + Intronic
1097759779 12:63449751-63449773 CTGAATATTGAAATGCATATGGG - Intergenic
1097813685 12:64047190-64047212 TTGTATATTCAGCTGAAATTGGG + Intronic
1098203068 12:68077754-68077776 CTGTTTCTTCAACTGAAAAGTGG + Intergenic
1099068716 12:78017991-78018013 CTTTATATTCACATGGAAATGGG - Intronic
1100388476 12:94125841-94125863 CTGTAAATTAAAAGGAAAAAAGG - Intergenic
1100574881 12:95881722-95881744 ATGAATATACAAAAGAAAATTGG + Intronic
1101533035 12:105591915-105591937 CGGTATATTTAAATGACAGTGGG - Intergenic
1101593354 12:106141403-106141425 CGGTTTCTTCAATTGAAAATAGG - Intergenic
1102067957 12:109994784-109994806 CGGTAAGTTCAACTGAAAATAGG + Intronic
1102422765 12:112817140-112817162 CTGGATCTTCAAATGGAAGTTGG + Intronic
1102550316 12:113686898-113686920 CTTTAAATTAAAATGAAAATTGG + Intergenic
1103637976 12:122324788-122324810 CAGTATATTTTAATGAAAAAAGG + Intronic
1103809080 12:123599683-123599705 CTAAAAATTCAACTGAAAATAGG + Intergenic
1105264582 13:18804717-18804739 CTGTATGATCAAAAGAAAAGAGG + Intergenic
1106903199 13:34376686-34376708 GTCTGTATTCAAATGCAAATAGG + Intergenic
1108060215 13:46525652-46525674 CTATATATTCAACTTACAATGGG + Intergenic
1108277614 13:48826851-48826873 TTGTTTATGCAAATGAGAATAGG + Intergenic
1108789485 13:53950254-53950276 CTTAAAATTCATATGAAAATAGG - Intergenic
1108974091 13:56415538-56415560 GTGTATATGCAAATACAAATTGG - Intergenic
1109123822 13:58491784-58491806 CTGTTTATAAAAGTGAAAATTGG - Intergenic
1109430538 13:62228202-62228224 CTTTAAATTCAGATGATAATAGG - Intergenic
1109533769 13:63688465-63688487 CTGTAAAGGCAAATGAAAAATGG - Intergenic
1109768712 13:66940201-66940223 CTTCATATTCTAATGAAAACTGG + Intronic
1109787487 13:67198418-67198440 CTGTGAATTCAAAAGAAAACTGG - Intronic
1110013763 13:70372759-70372781 CTGTGTTTTAAAAAGAAAATTGG - Intergenic
1110181467 13:72623183-72623205 ATGTCTATTAAAAGGAAAATTGG - Intergenic
1110407217 13:75164272-75164294 CTGTATATCAAAAAGTAAATAGG + Intergenic
1110547684 13:76774512-76774534 CTATATTTTCAAATACAAATAGG + Intergenic
1110768663 13:79309598-79309620 GTTTTTATTCAAATGGAAATGGG - Intergenic
1111048246 13:82845541-82845563 GTGTTTATTCAAATGTATATGGG - Intergenic
1112434927 13:99385090-99385112 TTCCATATTGAAATGAAAATTGG + Intronic
1114389679 14:22293662-22293684 CTGTATAATCTACTGAAATTAGG + Intergenic
1114854725 14:26424545-26424567 ATTTATATTCAAAAGAAGATTGG + Intergenic
1115051670 14:29071089-29071111 TTATCCATTCAAATGAAAATGGG + Intergenic
1115785377 14:36819912-36819934 CTGCATATTCATATAAAGATAGG - Intronic
1116683930 14:48013560-48013582 CTGTACATGGAAATGTAAATTGG + Intergenic
1116925582 14:50632369-50632391 CTGAATATTTAATTGACAATTGG - Exonic
1118552901 14:66976468-66976490 CTCTATATTAAAGTCAAAATGGG - Intronic
1118569970 14:67184701-67184723 CTGTACTTTCAAATGCCAATGGG - Intergenic
1119514254 14:75235468-75235490 CTCAATATTTAAATAAAAATGGG + Intergenic
1120544824 14:85798319-85798341 CTGTATAGTCAAATTCAATTTGG + Intergenic
1120842436 14:89097559-89097581 CTGCAGATTCAAATGGAAGTAGG - Intergenic
1124854410 15:33373145-33373167 TGGTAAATTCAAATGAGAATAGG - Intronic
1125102210 15:35927266-35927288 CTGTTTATAAAAATGCAAATTGG + Intergenic
1125439643 15:39688258-39688280 CTGTATTTTCAACTTACAATGGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127296098 15:57609814-57609836 CTGAACATTCAAATTAAAATTGG + Intronic
1127542947 15:59960879-59960901 TTTTATATTCAAATAAAAAATGG - Intergenic
1127998549 15:64170171-64170193 CACTAAACTCAAATGAAAATTGG + Exonic
1128487828 15:68112741-68112763 TTGGTTATGCAAATGAAAATTGG + Intronic
1128624728 15:69188341-69188363 ATCTATATTCATAGGAAAATTGG + Intronic
1130136424 15:81185277-81185299 TTGTATATTGAAAAGTAAATAGG - Intronic
1130449062 15:84032480-84032502 CTGTATCTTCTCAGGAAAATAGG - Intronic
1130753440 15:86737822-86737844 CAGTATTTTAAAATGTAAATGGG + Intronic
1133500347 16:6360167-6360189 CTGTACCTTGTAATGAAAATAGG + Intronic
1134090930 16:11391370-11391392 CTGTATACTCAAAAGAAAGCAGG + Intronic
1134691610 16:16194311-16194333 CTTTATCTTCAAATGTAACTGGG - Intronic
1137088861 16:36163018-36163040 CTGTATCTTCCATTGAAGATTGG + Intergenic
1137987894 16:53125845-53125867 CAGTATTTTCAACTTAAAATGGG + Intronic
1138763083 16:59567481-59567503 CTGAATTTTCAAATGTAATTTGG + Intergenic
1138938856 16:61764696-61764718 CTGTACATTAAAATGAACATTGG - Intronic
1139241794 16:65400216-65400238 CAGTATATATAAATTAAAATGGG - Intergenic
1139304031 16:65968250-65968272 CTGTAACTTCAACTGAAAATGGG - Intergenic
1140420477 16:74814891-74814913 TTGTATATTTAAATAATAATGGG - Intergenic
1140621308 16:76736492-76736514 CCTTTTATTCAAATTAAAATGGG + Intergenic
1141045660 16:80714120-80714142 TTATATATTCAAATGTAAACTGG + Intronic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1144236047 17:13261799-13261821 CTTTATATTAAGCTGAAAATTGG - Intergenic
1147692529 17:42325379-42325401 CTGTATCTTCACATGAAACAGGG + Intronic
1148520294 17:48267875-48267897 CTGTATAATCACATGAGAAATGG - Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149122794 17:53190361-53190383 CTGAATCTGCAAGTGAAAATTGG + Intergenic
1149145865 17:53491618-53491640 CTGTTTGTTCAAATGAGTATAGG + Intergenic
1150708802 17:67512187-67512209 CAGTTTCTTCAAATGAAAACCGG + Intronic
1151000625 17:70371099-70371121 CTGTTTATTCAATTGGAAAATGG - Intergenic
1151372978 17:73661055-73661077 CTGTATATTTAAAAGTAATTTGG + Intergenic
1153490654 18:5644535-5644557 ATGGGAATTCAAATGAAAATGGG - Intergenic
1153717195 18:7861887-7861909 CTGTATATTTGATTGAATATTGG + Intronic
1153852438 18:9108332-9108354 CTGTATTTTCAGATAGAAATAGG - Intronic
1154205608 18:12334279-12334301 CTGTTTATTGAAAGGAGAATTGG - Intronic
1155069389 18:22300510-22300532 CAGTATTTTCAAATGGAATTTGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156040857 18:32821123-32821145 CATTATATTAATATGAAAATTGG + Intergenic
1156137667 18:34062700-34062722 TTGTATATCAAAATAAAAATAGG + Intronic
1156601424 18:38611650-38611672 CTGTACATTCATCTGGAAATTGG + Intergenic
1158033321 18:52993556-52993578 CTGTATTGTCAAAGGAAATTTGG + Intronic
1158380537 18:56925261-56925283 ATGTCTACTCAAATGAAAACAGG - Intronic
1158580734 18:58680239-58680261 GTGTGTATTCATATGAAAAAAGG - Intronic
1159299498 18:66544411-66544433 CTTTATCTCCAAATTAAAATAGG - Intronic
1162584096 19:11548535-11548557 CTGTCTCTAAAAATGAAAATGGG + Intronic
1163974091 19:20832047-20832069 CTATTAATTCAAATGAAAACTGG - Intronic
1164787821 19:30948744-30948766 TTTAATATTCAGATGAAAATAGG - Intergenic
1165067636 19:33238359-33238381 ATGTATATTCAACTGGAAAGAGG + Intergenic
1165168620 19:33874411-33874433 ATTGATATTCTAATGAAAATAGG + Intergenic
1165961288 19:39536728-39536750 CTGCAAATTTAAAGGAAAATAGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1167816549 19:51887471-51887493 CTGTATATTCTGTAGAAAATGGG - Intronic
924987274 2:283586-283608 CTGTAAATTCTAAAGAAAGTGGG + Intronic
925397086 2:3542102-3542124 CTGTATGTTGAAATCTAAATTGG - Intronic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926603127 2:14868434-14868456 CTTTATTTTCAAATCAATATTGG - Intergenic
929165927 2:38881557-38881579 CTGGAAATTTCAATGAAAATAGG + Exonic
930190263 2:48451722-48451744 CAGTATATTTAACTGAAACTTGG - Intronic
930303973 2:49654230-49654252 TTGAATATCCAAATGATAATCGG - Intergenic
930532684 2:52609910-52609932 CTGTATATGGAGATGTAAATTGG - Intergenic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
930675323 2:54194950-54194972 ATGAATATTCAAATGAAGGTAGG + Intronic
930916760 2:56700676-56700698 CTTTACATTCAAATTAAAAAAGG - Intergenic
931550398 2:63438948-63438970 CAGTATAGTGAAAGGAAAATGGG + Intronic
933095933 2:78180792-78180814 ATGTATGATCAAATGGAAATTGG - Intergenic
933621232 2:84544212-84544234 CTCTATAAACAAATAAAAATTGG - Exonic
933844360 2:86313674-86313696 CTGTATTTTCAAAGCAAACTGGG - Intronic
934687119 2:96329231-96329253 CTCTATTGTCATATGAAAATAGG - Exonic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937558834 2:123194815-123194837 CTGTAAATTGTAAAGAAAATAGG - Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
939047185 2:137263662-137263684 ATCTATATACAAATGAAATTAGG - Intronic
939525784 2:143292129-143292151 CTGTATTTTAAAATAAGAATAGG - Intronic
939602445 2:144209636-144209658 AATTATATTCAAATGAAAAATGG - Intronic
940076495 2:149748014-149748036 CTGTATATTAATAAGAAAAAAGG + Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
942347932 2:175022182-175022204 CTGTATAGTGAAAGTAAAATTGG + Intergenic
942399223 2:175583620-175583642 CTGATTTCTCAAATGAAAATGGG - Intergenic
942909563 2:181226784-181226806 CTGTATATTCAAATAAACTTAGG + Intergenic
943293173 2:186101877-186101899 CTGTAAAATCAAATGAACTTTGG - Intergenic
943433837 2:187838038-187838060 CTCTATATTGATATGAAAAATGG + Intergenic
944980085 2:205107385-205107407 ATGTATCTTCATAGGAAAATTGG + Intronic
945248526 2:207743353-207743375 CGGTACATTCAAATGATTATTGG - Intronic
946121799 2:217522587-217522609 CTATATATTGAAAAGAAAATTGG - Intronic
946585646 2:221184539-221184561 CTGTATATTTTAATTAAAACAGG - Intergenic
946828063 2:223699256-223699278 ATATATATTTAAAAGAAAATGGG + Intergenic
946845063 2:223851632-223851654 GTGTATATTCAAAGGAAAAGAGG + Intergenic
948546937 2:238739347-238739369 GTGTATATGCAAAAGAAGATAGG - Intergenic
1169577593 20:6982478-6982500 CTGTATTTTCAAATTATAAAGGG - Intergenic
1169763460 20:9122299-9122321 CTGTATTTTAAAATAAAATTGGG + Intronic
1170092082 20:12600725-12600747 ATGTATATTTAAATAGAAATAGG - Intergenic
1170202141 20:13756178-13756200 CAGTTTATTCATATGGAAATTGG - Intronic
1171029071 20:21660554-21660576 CTGTATATTCTCATGATAATTGG - Intergenic
1176903530 21:14472907-14472929 CAGTTTATTCAAATGTAAAGGGG - Intergenic
1177608427 21:23413146-23413168 CAGAATTTTCACATGAAAATTGG - Intergenic
1179579998 21:42337048-42337070 ATGTAAATTAAAATGAAAACAGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180216710 21:46328269-46328291 CTGTATCTTAAAAAGAAAACGGG - Intronic
1181122327 22:20679733-20679755 CTGTTTATCATAATGAAAATTGG - Intergenic
1181122898 22:20684143-20684165 CTGTTTATCATAATGAAAATTGG - Intergenic
1181180099 22:21061347-21061369 CTGTTTATCATAATGAAAATTGG + Intronic
1181785834 22:25226204-25226226 GTGTATAATCAAATCAAACTTGG + Intronic
1182031953 22:27166154-27166176 CTATATAATAAAATGAAGATGGG + Intergenic
1182141477 22:27963222-27963244 CTGAATTTACAAATAAAAATAGG + Intergenic
1182867626 22:33617984-33618006 TTGTATATTTTAATGAAAACAGG - Intronic
949726023 3:7045978-7046000 CTGTAGATAAAAATGCAAATTGG - Intronic
950295391 3:11825179-11825201 CAGTATCCTCAAATGAAAAAGGG + Intronic
951161408 3:19427092-19427114 CTCTATCTTCAAAAGAAGATGGG + Intronic
951574745 3:24102047-24102069 CTGCATATTAAAATCATAATGGG + Intergenic
952647600 3:35680527-35680549 CTTTATTTCCAACTGAAAATAGG - Intronic
953060491 3:39424681-39424703 CTGAATATTCAAATCAAAGCAGG - Intergenic
953579445 3:44140520-44140542 ATGTATATTAAACTGTAAATGGG - Intergenic
954457240 3:50606449-50606471 CTGTGTACACAACTGAAAATCGG + Intergenic
954542281 3:51401670-51401692 CTTTATATTCAAATTAAGAATGG + Intronic
955132285 3:56182591-56182613 CTGTTTCTTCAAGTGAAAAATGG - Intronic
955260695 3:57387407-57387429 TTATATATTAAAATGAAAAAAGG + Intronic
955844573 3:63148415-63148437 AAGGATATTCAAATAAAAATAGG - Intergenic
955849208 3:63202060-63202082 ATATATATTCAAAAGAAAGTGGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956942176 3:74175917-74175939 CTGTAAGTTCAAGTGAAAAGAGG - Intergenic
957291658 3:78284768-78284790 ATGCATATTCATATGATAATAGG - Intergenic
957495457 3:80986034-80986056 CTGTATATTACAATGAACAATGG - Intergenic
957507392 3:81140610-81140632 CTGTATCTTCAGATGACAAGTGG - Intergenic
957549325 3:81683545-81683567 CTTTTTACTCAAATGAAAATAGG + Intronic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957728333 3:84097843-84097865 ATGTATAATCAAATGTTAATAGG + Intergenic
957947005 3:87077638-87077660 CAGTATGCTCAAGTGAAAATTGG + Intergenic
958091387 3:88881108-88881130 CTGTGTGTTCAAATGGATATTGG - Intergenic
958866378 3:99506320-99506342 CTGCATAATCAAATAAAAGTAGG + Intergenic
959172824 3:102863365-102863387 CTGTTTATTCACATGCACATTGG - Intergenic
959581283 3:107985239-107985261 ATATATATTTAAATGAAAATAGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959871509 3:111333705-111333727 CTTTAAATTTATATGAAAATTGG - Intronic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960277355 3:115743175-115743197 GTGTTTAATGAAATGAAAATTGG + Intergenic
960336930 3:116428817-116428839 ATGGATATTAAAATAAAAATGGG - Intronic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
963035233 3:141019938-141019960 TTATATATGCAAATAAAAATGGG - Intergenic
963226760 3:142870209-142870231 CTGGATAGTCAAATCAAATTAGG + Intronic
963512339 3:146263237-146263259 CTGTATATTTAAATTTAAACTGG + Intergenic
964202886 3:154137998-154138020 CTGTATATTTACATAAATATGGG - Intronic
964285601 3:155114431-155114453 CTATATAAACAAATGCAAATTGG + Intronic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
965678426 3:171224426-171224448 ATTTTTATCCAAATGAAAATGGG + Intronic
965776832 3:172240535-172240557 CTGTATATTGAGAAGTAAATAGG - Intronic
965922551 3:173935568-173935590 CTGTATATTCTCATGACAAATGG - Intronic
966251721 3:177873619-177873641 CTATTTATTCAAATTAAAAATGG - Intergenic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
970292857 4:14595105-14595127 CTTTATATTAAAATGAAACAAGG - Intergenic
970501611 4:16682923-16682945 CTGTATGTCAAAATGAAAGTGGG - Intronic
970820611 4:20207431-20207453 CTAAGTATTCAACTGAAAATTGG + Intergenic
971691942 4:29848223-29848245 CTGTTTATTGAAATAGAAATAGG + Intergenic
972085989 4:35216443-35216465 CTGTATAAGCAAATCTAAATAGG - Intergenic
972249625 4:37286489-37286511 ATGCATATTTAAATGCAAATTGG - Intronic
973014075 4:45114389-45114411 TTGTATTTTAAAATGTAAATAGG - Intergenic
974264796 4:59571609-59571631 CTGTACTGTCAAATGAAAACTGG + Intergenic
976489364 4:85650873-85650895 CTCTTTATTCAAGTGCAAATTGG + Intronic
976919297 4:90417618-90417640 GTATATATCCAAAGGAAAATGGG + Intronic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978270253 4:106880408-106880430 ATGTATATTAAAATGAAAGTTGG + Intergenic
979749627 4:124262761-124262783 GTGTTTATTCAAATGGAACTAGG + Intergenic
979970487 4:127128533-127128555 CTTAATCTTCAGATGAAAATTGG - Intergenic
980086139 4:128392123-128392145 CTGAATATTAAAAAGACAATGGG + Intergenic
980679193 4:136134209-136134231 TTGTACATACATATGAAAATAGG + Intergenic
981267162 4:142800485-142800507 ATGTATGATCAAATGGAAATTGG + Intronic
981500339 4:145443925-145443947 CTTTATTTTCAAATTTAAATTGG - Intergenic
981665414 4:147219632-147219654 CTGAACTTTCAAATGAAAAATGG + Intergenic
981813598 4:148803440-148803462 CTGTATTTTAAAATTAAAACAGG + Intergenic
983256690 4:165407981-165408003 CTGTCTATTCATTTTAAAATGGG + Intronic
983703493 4:170628450-170628472 ATGTTGATACAAATGAAAATGGG - Intergenic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
984021674 4:174491878-174491900 AGCTATATTCAAATGAAGATAGG + Exonic
984439110 4:179744040-179744062 CAATATATAGAAATGAAAATTGG + Intergenic
985989214 5:3541450-3541472 CAGGATAATCAAATGAAAAAAGG + Intergenic
987478996 5:18429023-18429045 CTGTAAAGTCAAAAGTAAATTGG - Intergenic
987742891 5:21933307-21933329 CTGTATATCCTAATGAGACTTGG + Intronic
987803925 5:22737249-22737271 ATGTATCTTGAAGTGAAAATAGG - Intronic
987867058 5:23556406-23556428 CTGTATATCTAAATGAACTTAGG - Intergenic
987979547 5:25064122-25064144 TTATATATACAAATGAAAGTGGG + Intergenic
988272393 5:29033375-29033397 CTGTTTATGCAAATGAGCATAGG + Intergenic
988473380 5:31561996-31562018 TTGAAGATTCAAATGAATATGGG + Intergenic
990556986 5:56946462-56946484 CTGTATTTTCAAATATAAATTGG - Intronic
990645679 5:57841574-57841596 CTGTGTATTCAAATGTAATAAGG - Intergenic
990765294 5:59176189-59176211 CTATATATTGAAATAAAAACTGG + Intronic
992116532 5:73543698-73543720 TTGTACATTAAAATGGAAATAGG + Intergenic
992650935 5:78859470-78859492 GTGGATATTAAAATGGAAATTGG - Intronic
992739695 5:79760946-79760968 CTGTTTCTTTAAAAGAAAATCGG - Intronic
992817326 5:80456503-80456525 CTGTTGATTCATATGGAAATGGG + Exonic
992917938 5:81478635-81478657 CTGTATAAAAAAATAAAAATAGG - Intronic
993752935 5:91692514-91692536 TTGTTTATGCAAATGAACATAGG + Intergenic
993764457 5:91838529-91838551 TTTTATTTTCAAATGAAATTTGG - Intergenic
993908587 5:93652243-93652265 CTGGTTTTTCAAAGGAAAATTGG + Intronic
994992335 5:107012945-107012967 TTCTATATTCAAATGTCAATAGG + Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
995909710 5:117171059-117171081 TTTGATATTCAAATTAAAATGGG + Intergenic
996225427 5:120987776-120987798 CTGTACAAATAAATGAAAATAGG - Intergenic
996593710 5:125177608-125177630 CTATATATGCAAATGACACTAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
997492735 5:134292153-134292175 ATGTATATTCTGCTGAAAATGGG - Intronic
998100279 5:139427324-139427346 TTGTATGTTTAAATGAAATTGGG - Intronic
998664004 5:144275029-144275051 CCGTATATTAAAATGCAAATCGG + Intronic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1000719054 5:164682837-164682859 GTTTTTATTCAAATTAAAATAGG - Intergenic
1001219322 5:169885772-169885794 CGGTTTATTCAACTGTAAATGGG - Intronic
1001735949 5:174001584-174001606 CAGTATATTCAAAGGAAAAGAGG - Intronic
1003674930 6:8194259-8194281 CAGCATATTCAAATGAAAGCTGG + Intergenic
1004077607 6:12358992-12359014 CAGTATATTCACATAAAAAAAGG + Intergenic
1004452748 6:15762180-15762202 CTGAAAATTCAAATGTAACTGGG - Intergenic
1004452944 6:15764077-15764099 CTGTAAAATCAAATCACAATCGG + Intergenic
1004804169 6:19183889-19183911 ATATATTTTCAAATGGAAATGGG + Intergenic
1007583203 6:42971831-42971853 TTGTACTTTCAAAGGAAAATAGG - Intronic
1008662519 6:53682628-53682650 CCGTTTTTTGAAATGAAAATGGG + Intergenic
1009283747 6:61785539-61785561 GTGTATATGCATATGAAAATTGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009487541 6:64244018-64244040 GTATATATTAAAATGAAAACTGG - Intronic
1009798257 6:68500220-68500242 CTATATTTTCAACTTAAAATGGG - Intergenic
1010063758 6:71656008-71656030 CATTATATTCCTATGAAAATAGG + Intergenic
1010091186 6:71984139-71984161 CTGTATTTTTAATTGAACATTGG + Intronic
1010623397 6:78105153-78105175 CTGCATATTCAAAGCAAAATGGG - Intergenic
1011859915 6:91741573-91741595 CTGTAGATCCAAATCTAAATTGG + Intergenic
1012164246 6:95928589-95928611 CTCTATTTTCATATGCAAATTGG - Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012761438 6:103308208-103308230 CTGTTTATGCAAATGCAGATGGG + Intergenic
1012784044 6:103600360-103600382 CAGTATATTTAAAATAAAATAGG + Intergenic
1013735077 6:113216765-113216787 CAGGATCTTCAAAGGAAAATGGG + Intergenic
1014777229 6:125525134-125525156 CTATATTTTCAAATTAATATTGG + Intergenic
1016094710 6:140020943-140020965 TTGTTTATTCAAATGACTATAGG + Intergenic
1016195310 6:141329028-141329050 ATGTCTTTTCAAAAGAAAATTGG - Intergenic
1016497001 6:144675064-144675086 CAGTTTATTCAAATGAGAAGGGG - Intronic
1016599813 6:145845493-145845515 CTGTATATTAAAATGTTAAAAGG - Intergenic
1016636607 6:146299541-146299563 CTTTATATTCCAAGGAGAATTGG - Intronic
1016665603 6:146636524-146636546 CTCTGGGTTCAAATGAAAATTGG + Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1018402598 6:163440033-163440055 TGGTATATTCAAATTAAAAGTGG - Intronic
1018611476 6:165651747-165651769 GTGTATATTTAAATGCAAAAAGG - Intronic
1021059336 7:16090835-16090857 ATGTATATACCAATGAAAACTGG + Intergenic
1021297596 7:18927584-18927606 ATTTAATTTCAAATGAAAATAGG + Intronic
1022018129 7:26370930-26370952 CTTTATATTTAAATAAAAACTGG - Intronic
1022053613 7:26705274-26705296 ATGTATATTAAAATGCAATTTGG + Intronic
1024319759 7:48053107-48053129 CTCTTTATTCAAATGAATAGCGG + Intronic
1024850377 7:53708118-53708140 ATTTATATTCAAATAAAATTAGG - Intergenic
1026083884 7:67246528-67246550 CTTTAGATTCAAAGGCAAATAGG + Intergenic
1026555475 7:71404989-71405011 CTGCAGATTCAGAAGAAAATGGG + Intronic
1027427720 7:78078589-78078611 CTGTGTACTCAAATGAACAGTGG + Intronic
1027642995 7:80760677-80760699 CTGTGTATTCCAAGAAAAATAGG + Intronic
1027785466 7:82574237-82574259 CTGTAAAATCAAAAGCAAATTGG + Intergenic
1028260273 7:88655834-88655856 CTATATTTACAAATGAAAAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028299809 7:89183806-89183828 CTGTATATTCAAATGCCAGAAGG - Intronic
1028618440 7:92797461-92797483 CTATATATACTAATGAAATTGGG + Intronic
1028875813 7:95822506-95822528 CTGTATTTTGAAATGAAGTTAGG + Intronic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1031141963 7:117952379-117952401 CAGTACTTTAAAATGAAAATAGG + Intergenic
1031403467 7:121354136-121354158 CTGTATATTCAATTAAATACTGG - Intronic
1031480327 7:122270519-122270541 ATATATATTTAAATGAAAACAGG + Intergenic
1031680720 7:124671017-124671039 CTGTATATTAAATATAAAATGGG - Intergenic
1031737186 7:125381339-125381361 ATATATGTTCAAATGAAGATCGG - Intergenic
1032949165 7:136887852-136887874 CTGTTTCTTCAAATGTAAAATGG - Intronic
1033139573 7:138813413-138813435 CTTTAGATTCAAAATAAAATAGG - Intronic
1033952265 7:146799372-146799394 CTGTGTATACAAATAAAAATGGG - Intronic
1034045956 7:147927884-147927906 CTGCATATTTAATTGATAATCGG - Intronic
1034736906 7:153437834-153437856 CTTCATATTTAAAAGAAAATAGG - Intergenic
1035825510 8:2640445-2640467 TTGTATTTTTAAGTGAAAATAGG + Intergenic
1035918006 8:3645802-3645824 CTGTCTATTCAAATGACACTGGG + Intronic
1035932540 8:3798855-3798877 CTGTATGAACAAAGGAAAATAGG - Intronic
1036721857 8:11183199-11183221 CTGTATATCCAAAAGAAAGGAGG - Intronic
1037045994 8:14304137-14304159 CTATATTTTCATTTGAAAATAGG - Intronic
1037181251 8:16007934-16007956 GTGTATATTCAGAATAAAATGGG + Intergenic
1037536672 8:19831039-19831061 CAGTATACTCAAAGGAAAATAGG - Intronic
1037686547 8:21144461-21144483 CTGTATATTCCTATAGAAATTGG - Intergenic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1038549997 8:28459211-28459233 AAGTATATACAAAAGAAAATTGG + Intronic
1038557461 8:28534713-28534735 CTGAATATTAAAATCAAAGTAGG - Intronic
1038827590 8:31021758-31021780 CTGGAAAATCATATGAAAATGGG + Intronic
1039143390 8:34418300-34418322 CTGTATAGTCAAAAGCAATTCGG - Intergenic
1039411931 8:37362069-37362091 GTATATACTCAAAAGAAAATAGG + Intergenic
1039631605 8:39118244-39118266 CATTATATTCATATTAAAATGGG - Intronic
1040042000 8:42925562-42925584 CTGCATATTTTGATGAAAATTGG + Exonic
1040584964 8:48731220-48731242 TTGTATATTCCAATGACACTGGG + Intronic
1040690667 8:49934462-49934484 TTTTATATTGAATTGAAAATTGG - Intronic
1041281626 8:56215817-56215839 CTATAAATTCAAAGGAAAGTAGG - Intronic
1041856160 8:62457592-62457614 ATGGATTTTCAAATGAAATTAGG - Intronic
1041977360 8:63815299-63815321 CAGTATATGCAAATGGAAGTGGG + Intergenic
1042013267 8:64274900-64274922 GAGTATATTCAAATGGACATGGG + Intergenic
1042079376 8:65034466-65034488 TTATATATTCAAATGAAATATGG + Intergenic
1042082866 8:65074976-65074998 CTGTTTATTCATATTAAAAGGGG - Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1043009213 8:74860756-74860778 CTGTATTTGAAAATGAAAATAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043727750 8:83631573-83631595 CTATATTTTCAAATCACAATGGG - Intergenic
1044215405 8:89603679-89603701 CTTGATATTCAAATCAAATTTGG + Intergenic
1044295066 8:90518345-90518367 TTGTTTATGCAAATGAATATAGG - Intergenic
1044433204 8:92133148-92133170 CTGTATATACCATTGGAAATGGG - Intergenic
1045084700 8:98670065-98670087 CTGTATATAAAAATGAATAGAGG + Intronic
1045261639 8:100580419-100580441 TTGTCTATTCAAATAAAACTGGG - Intronic
1045365114 8:101468915-101468937 CTCTATTTACAAATGGAAATTGG - Intergenic
1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG + Exonic
1045498336 8:102726914-102726936 CTGTGTTTTCAAATGCAACTTGG - Intergenic
1045605742 8:103772588-103772610 CTGTATATATAAATCAAATTGGG - Intronic
1045801924 8:106111797-106111819 AGGTATTTTCATATGAAAATAGG + Intergenic
1046034336 8:108822436-108822458 CTGTATTTTGAAATGTAAAAAGG + Intergenic
1046373527 8:113345021-113345043 CTGTTTCTTCAACTGAAGATAGG + Intronic
1046373562 8:113345765-113345787 CTGTCTCTTCAACTGAAGATAGG - Intronic
1046650697 8:116833966-116833988 CTGCACATTGAAATGAAAAATGG - Intronic
1046964261 8:120145774-120145796 CTGTATTTCCAAATAAAAGTAGG + Intronic
1047322923 8:123805305-123805327 CTGTTTCATCAAATGGAAATGGG - Exonic
1047856953 8:128921089-128921111 GTGTATGTTCACATGAAAAACGG + Intergenic
1049715805 8:144090756-144090778 TTGGATATTCAAATGCAAACAGG - Intergenic
1050848211 9:10250838-10250860 GTGTATAATCATATGTAAATAGG + Intronic
1051066366 9:13108737-13108759 CATTATATTTAAAGGAAAATAGG - Intronic
1051071953 9:13180524-13180546 TTGTATTTTTAAATCAAAATAGG + Intronic
1051985356 9:23078882-23078904 CTGTATATTACAAACAAAATTGG + Intergenic
1054569915 9:66799376-66799398 CTGTATAAAAAAAAGAAAATTGG + Intergenic
1055313840 9:75013094-75013116 CTGTATATACTTATGAGAATTGG - Intronic
1056025732 9:82493000-82493022 CTGGATATAAAAGTGAAAATAGG + Intergenic
1057423924 9:94933699-94933721 CTGTACATTCCACTTAAAATAGG + Intronic
1058199132 9:102017052-102017074 ATGTAAATTAAAATGACAATTGG + Intergenic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1058289780 9:103224664-103224686 ATGTATATTAATATCAAAATAGG + Intergenic
1060669228 9:125453992-125454014 ATGGTTATTCAAATGAATATTGG - Intronic
1186249323 X:7649240-7649262 CTTTGTTTTCAAATTAAAATAGG - Intergenic
1186300133 X:8191459-8191481 CTTTATATTCAAATGAGTATCGG - Intergenic
1186748523 X:12596409-12596431 TTGTATTTTGAAATGAATATAGG + Intronic
1187191094 X:17035809-17035831 TTTTATATACAAGTGAAAATAGG + Intronic
1187671928 X:21676038-21676060 CTGCATTTTCACATGTAAATAGG + Intergenic
1188169713 X:26910009-26910031 ATGTTTCTTCACATGAAAATTGG + Intergenic
1189141682 X:38613711-38613733 ATGAGTATTCTAATGAAAATAGG - Intronic
1189637102 X:43023057-43023079 CTGTAAAATCAAAAGAAAGTTGG + Intergenic
1189826035 X:44918814-44918836 CTGTATATTTAGGTGAAAGTGGG + Intronic
1190139121 X:47826012-47826034 CTGTATATTTATATGTAAAGTGG - Intergenic
1190502109 X:51089373-51089395 CAGTATATTGCAATGAAGATGGG - Intergenic
1193780904 X:85699730-85699752 ATTTATTTTCAAATAAAAATGGG + Intergenic
1194133246 X:90107251-90107273 ATGCATTTTAAAATGAAAATGGG + Intergenic
1194371006 X:93071370-93071392 CTTAATATTCAAAAGAAACTGGG - Intergenic
1194770302 X:97895081-97895103 CTGTATATTCAAATAACAGAGGG - Intergenic
1195058216 X:101167569-101167591 CTGCGTAATCAATTGAAAATTGG + Intergenic
1195522319 X:105845562-105845584 CTTGAAATTCAAATGTAAATGGG + Intronic
1196186090 X:112746596-112746618 CTGGACATTCACATGAAACTTGG + Intergenic
1196697484 X:118628897-118628919 CTCAATTTACAAATGAAAATTGG + Intronic
1196823000 X:119718343-119718365 CCATATATAAAAATGAAAATGGG + Intergenic
1197046718 X:122006293-122006315 CTCTAAGTCCAAATGAAAATCGG - Intergenic
1199063550 X:143388245-143388267 TTGTTTATGCAAATGAACATAGG - Intergenic
1199282485 X:146018536-146018558 CTTTATTTTCAGATGAAAATTGG - Intergenic
1200479030 Y:3677335-3677357 ATGCATTTTAAAATGAAAATGGG + Intergenic
1200678801 Y:6183259-6183281 CTTAATATTCAAAAGAAACTGGG - Intergenic
1200822685 Y:7603596-7603618 CTGTAAATGGAAATTAAAATTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201501584 Y:14649063-14649085 CTGTATATTTAAGCCAAAATAGG + Intronic
1201695652 Y:16822029-16822051 CTATATGTTCAAAATAAAATGGG + Intergenic
1202237618 Y:22730423-22730445 CTGTAAATGGAAATTAAAATTGG + Intergenic
1202249429 Y:22854512-22854534 CTGCATATGCAATTCAAAATTGG + Intergenic
1202402415 Y:24488260-24488282 CTGCATATGCAATTCAAAATTGG + Intergenic
1202468365 Y:25181823-25181845 CTGCATATGCAATTCAAAATTGG - Intergenic