ID: 1143061968

View in Genome Browser
Species Human (GRCh38)
Location 17:4209382-4209404
Sequence CACGTAAACCCGGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151553
Summary {0: 2, 1: 145, 2: 5826, 3: 39444, 4: 106136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143061968_1143061977 17 Left 1143061968 17:4209382-4209404 CCTCCGCCTCCCGGGTTTACGTG 0: 2
1: 145
2: 5826
3: 39444
4: 106136
Right 1143061977 17:4209422-4209444 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
1143061968_1143061976 9 Left 1143061968 17:4209382-4209404 CCTCCGCCTCCCGGGTTTACGTG 0: 2
1: 145
2: 5826
3: 39444
4: 106136
Right 1143061976 17:4209414-4209436 CCACAGTCTCCTGAGTAGCTGGG 0: 17
1: 4781
2: 109564
3: 214046
4: 241592
1143061968_1143061974 8 Left 1143061968 17:4209382-4209404 CCTCCGCCTCCCGGGTTTACGTG 0: 2
1: 145
2: 5826
3: 39444
4: 106136
Right 1143061974 17:4209413-4209435 GCCACAGTCTCCTGAGTAGCTGG 0: 12
1: 3805
2: 96048
3: 201745
4: 231749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143061968 Original CRISPR CACGTAAACCCGGGAGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr