ID: 1143066701

View in Genome Browser
Species Human (GRCh38)
Location 17:4255108-4255130
Sequence AGTGTGGGTTAGAACTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143066701_1143066705 10 Left 1143066701 17:4255108-4255130 CCACTCCAGTTCTAACCCACACT 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1143066705 17:4255141-4255163 TTTCTAGATTCACATCACCCTGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143066701 Original CRISPR AGTGTGGGTTAGAACTGGAG TGG (reversed) Intronic
900432897 1:2611381-2611403 AGGGTGGGGCAGGACTGGAGTGG + Intronic
901350091 1:8587705-8587727 GGTGGGGGATAGAACTGGAAAGG - Intronic
902000867 1:13193704-13193726 AGGGTGGGTCAGGGCTGGAGTGG + Intergenic
903402029 1:23060780-23060802 ATTGTAGGTTGGAACTTGAGAGG + Intronic
903545995 1:24123799-24123821 AGTGTGGGATGGAACTGGGCTGG - Intronic
905048446 1:35027909-35027931 AGTGTCTGTTAGATGTGGAGTGG - Intronic
905264779 1:36744118-36744140 AGTGGAGGTGAGAAATGGAGTGG + Intergenic
908443044 1:64173919-64173941 AGGGTGGGTGAGAAGTTGAGTGG - Intronic
909112324 1:71494843-71494865 AGTGTGGGTTTGAGCTGCACAGG + Intronic
909643580 1:77892735-77892757 AGTGTCGATTAGAGCTGGAAGGG + Intronic
909979823 1:82085449-82085471 AATATGGGTTAGAACTGCACAGG - Intergenic
911613482 1:99983189-99983211 TGTGTGTTTCAGAACTGGAGGGG + Intronic
912347592 1:108978972-108978994 ATTGAGGGTAAGAACTGGAAGGG + Intronic
915304510 1:154969973-154969995 AGTGAGCATTAGAACTGGAGGGG + Intronic
915594539 1:156888574-156888596 ACTGTGGGTGAGACATGGAGTGG + Intergenic
916125698 1:161569057-161569079 AGGGTGCATCAGAACTGGAGGGG - Intergenic
916135614 1:161650888-161650910 AGGGTGCATCAGAACTGGAGGGG - Intronic
921736407 1:218633535-218633557 GGTCAGGGTTAGACCTGGAGAGG + Intergenic
922615942 1:226961317-226961339 AGTGTGGGTTTGGCCTGCAGAGG + Intronic
924408287 1:243775473-243775495 AATTTGGGTTAGAACTGGCCGGG - Intronic
1066234499 10:33472030-33472052 GGGGTGGGTTAGAAGTGGGGTGG - Intergenic
1066521534 10:36225590-36225612 ACTGTTTGTTAGAACTGGAGGGG - Intergenic
1067216385 10:44307786-44307808 AGTGTTGGTTAGAAGTGTGGGGG + Intergenic
1068690918 10:59913000-59913022 AGTGTTGGATAGACCTGGATTGG + Intergenic
1073251602 10:102123254-102123276 AGTGTGGATCAGACCTGGGGAGG + Intergenic
1073478357 10:103769227-103769249 ATTGTGTGTTAGAGCTGGATGGG - Intronic
1074188356 10:111115681-111115703 GCTGTGGGTTAGGGCTGGAGGGG - Intergenic
1075230142 10:120669374-120669396 AGTTTGGGTTATAGATGGAGCGG - Intergenic
1075511684 10:123077560-123077582 AGTTTGGGTGAGATCAGGAGGGG - Intergenic
1076228426 10:128799777-128799799 AGTGGTGGTCAGAACTGGGGAGG + Intergenic
1078333611 11:10446053-10446075 AGTGGGGGTGAGAGCTAGAGGGG + Intronic
1078696652 11:13639776-13639798 AATGTGGAATAGAAGTGGAGTGG + Intergenic
1081934705 11:46896666-46896688 TGTGTGAGTTAGAATAGGAGTGG + Intronic
1083366046 11:62141954-62141976 AGTGTGGGTCTGAACTGAGGTGG + Intronic
1083616943 11:64030980-64031002 GGAGTTGGTTAGGACTGGAGAGG + Intronic
1086981519 11:93203734-93203756 AATGTGGGTTTGAACTGCATGGG + Intergenic
1088697724 11:112382780-112382802 AGTCTGGGTTAGGCCTGAAGAGG - Intergenic
1090418164 11:126555292-126555314 TTTGTGGGTGGGAACTGGAGTGG - Intronic
1090590241 11:128259509-128259531 AGTGTGTGTGGGAACTGCAGGGG + Intergenic
1090662996 11:128895093-128895115 AGGGTGGGGGAGAAATGGAGGGG + Intronic
1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG + Intergenic
1095426819 12:42083843-42083865 AGTGGAGGTTGGAAGTGGAGGGG - Exonic
1097945668 12:65365462-65365484 AGTGTGAGTTAGAGATGGATTGG + Intronic
1102403597 12:112652531-112652553 AGTGTGGATGAGGACTGGACTGG + Intronic
1107652965 13:42563159-42563181 TGGGTGGGATGGAACTGGAGGGG - Intronic
1108026110 13:46179732-46179754 AATGTGGGTTAGCAGTGGCGGGG + Intronic
1109423431 13:62143395-62143417 ATTGTTTGTTACAACTGGAGAGG - Intergenic
1111391470 13:87601099-87601121 CGTGTGGGTTTGAACTGCACGGG - Intergenic
1112032163 13:95467179-95467201 AGTATGGGTTAAAAGTAGAGGGG - Intronic
1112177327 13:97039045-97039067 AGTGAGGGTTAAAAATGGACAGG + Intergenic
1113106131 13:106773384-106773406 AGTGAGGGTAAGAACTTCAGTGG - Intergenic
1113404657 13:110026989-110027011 ATTGTGTGTTATACCTGGAGGGG + Intergenic
1114568078 14:23647042-23647064 ACTCAGGGTTAGAACTGGGGAGG + Intergenic
1120733201 14:88025299-88025321 AGTGGGCTTTAGAACTGAAGGGG - Intergenic
1120765279 14:88322966-88322988 AGCTTGGGGGAGAACTGGAGAGG + Exonic
1121245163 14:92456781-92456803 ACTGTGGGTTAGAGCTGCAGTGG + Intronic
1121967404 14:98323441-98323463 GGTTTGGATTAGAATTGGAGAGG - Intergenic
1122010365 14:98741472-98741494 GGGGTGGGTGAGAACTGGATTGG - Intergenic
1129073032 15:72967698-72967720 AGTGTGGGGTAGAACCAGAAAGG - Intergenic
1130008819 15:80130393-80130415 AGTTGGGGATAAAACTGGAGAGG + Intronic
1131557088 15:93409091-93409113 AGTGTGGCTCAGTTCTGGAGAGG + Intergenic
1133437554 16:5793026-5793048 AACGTGGGTTTGAACTGCAGGGG - Intergenic
1133697034 16:8274566-8274588 AGTGTGGGGGAAGACTGGAGAGG - Intergenic
1134310896 16:13074396-13074418 TGGGTGGGTAAGAAATGGAGAGG - Intronic
1136002296 16:27303931-27303953 AATGTGGCTGAGACCTGGAGAGG - Intergenic
1137222925 16:46473467-46473489 AGTGTGGGAAAGAGATGGAGAGG - Intergenic
1137570801 16:49565198-49565220 AGTGTGGGTTTGCACTGAAAAGG - Intronic
1137788822 16:51157301-51157323 AATGTGGGTTTGAACTGAAAAGG - Intergenic
1137814754 16:51388123-51388145 AGTATGGGTTTGAACTGCACAGG - Intergenic
1142316826 16:89352586-89352608 AGTGTGTGTGAGATCTGGATGGG - Intronic
1143066701 17:4255108-4255130 AGTGTGGGTTAGAACTGGAGTGG - Intronic
1144830356 17:18127570-18127592 AGTGTGGGTTAGGGGTGGGGTGG + Intronic
1147193632 17:38750682-38750704 AGGGTGGGTGAGTACTGGGGTGG + Exonic
1148109527 17:45136826-45136848 AGTGGGGGTCAGAACTGGAAGGG - Intronic
1149373893 17:56024141-56024163 AGTGAGGTTTAGAACTGTGGGGG + Intergenic
1149638616 17:58189447-58189469 AGTGGGGGCCAGAGCTGGAGAGG + Intergenic
1149690636 17:58572956-58572978 GGTTTTGGTTAGAACTGCAGTGG - Intronic
1150976929 17:70098075-70098097 AGTATGAGGTAGAGCTGGAGTGG - Intronic
1151153618 17:72109056-72109078 AGAGTGGGTTAGAAAGGAAGAGG - Intergenic
1151570291 17:74922529-74922551 AGTGGGGGCTAGAAAGGGAGGGG - Intronic
1153544971 18:6195989-6196011 AGTGTGGGTGAGACAGGGAGAGG - Intronic
1155242331 18:23875683-23875705 AGTGTGGGTTTGGGCTGGTGAGG - Intronic
1155246324 18:23913333-23913355 ATTATGGGTGAGGACTGGAGTGG + Intronic
1156829432 18:41472772-41472794 AGTGGAGGTTATAAATGGAGAGG + Intergenic
1157386079 18:47260920-47260942 GGTGTGCGTTTGAAGTGGAGGGG + Intergenic
1158056616 18:53287918-53287940 GGTATAGGATAGAACTGGAGAGG + Intronic
1159517330 18:69474179-69474201 AGTGTGTGAGAGAACAGGAGAGG - Intronic
1159707885 18:71715878-71715900 AGTGAGGGTATGAGCTGGAGTGG + Intergenic
1160038434 18:75322032-75322054 AGTGCTGGTTAGGAATGGAGGGG + Intergenic
1160179968 18:76625519-76625541 AGTGTGTATGAGAACTGCAGGGG + Intergenic
1160443248 18:78908575-78908597 AGTGTGAGTGCGACCTGGAGAGG + Intergenic
1162552477 19:11365317-11365339 AGAGTGGGTGAGAGGTGGAGAGG - Exonic
1163782225 19:19256617-19256639 AGGGTGGTCTGGAACTGGAGTGG + Exonic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
927805987 2:26147216-26147238 AGTGTGGGCCAGTCCTGGAGGGG + Intergenic
931837096 2:66110512-66110534 TGTATGGGTTGGTACTGGAGAGG + Intergenic
935017456 2:99197469-99197491 AGTGTGTGTAAGGCCTGGAGGGG + Exonic
936955804 2:118021132-118021154 AAAGAGGGTTAGACCTGGAGCGG + Intergenic
937227287 2:120377228-120377250 GGTGTGGGTGGGAACGGGAGTGG - Intergenic
938144440 2:128821908-128821930 AATGTGGGTGGGAACTGGATGGG + Intergenic
939426000 2:142037353-142037375 AGTCTGGTTTAGAACTTTAGAGG + Intronic
940109726 2:150138224-150138246 AGTGTGGGATGGAAGTGGGGTGG + Intergenic
942811526 2:180005983-180006005 AGTGTGGTTTTGACCAGGAGAGG - Intronic
948686209 2:239671248-239671270 AGTGTGTGTGAGGACTGGGGGGG - Intergenic
1169052639 20:2593895-2593917 AGTGTGAGGTATTACTGGAGAGG - Intronic
1169327077 20:4685036-4685058 AGTGTGGGTGAGCACTTGAAAGG - Intergenic
1169878642 20:10323931-10323953 AGTGTGGGGTAGGGCAGGAGAGG + Intergenic
1170268033 20:14489767-14489789 TGGGTGGGGTAGAAATGGAGTGG + Intronic
1171011717 20:21512730-21512752 AGTGTGGGTGAGAATTTGGGGGG + Intronic
1171355890 20:24545152-24545174 AGGGAGGATTAGAAATGGAGAGG + Intronic
1172590307 20:36113058-36113080 AGTGTGGGTTGGAGTTGGCGTGG + Intronic
1173256292 20:41396109-41396131 AGCCTGGGTCAGAGCTGGAGTGG + Intergenic
1175278779 20:57788789-57788811 AGAGTTGGTGAGAACAGGAGAGG - Intergenic
1175672926 20:60921441-60921463 AGAGTGGGTCAGCACTGGGGTGG - Intergenic
1178055622 21:28795444-28795466 AGAGTCTGTTGGAACTGGAGAGG - Intergenic
1178642186 21:34353815-34353837 TGTGGGGGTTAAAACTGGATGGG - Intergenic
1178907276 21:36647073-36647095 TGTGTGAGTGAGAACAGGAGAGG + Intergenic
1179939616 21:44629104-44629126 GGTGTGGGTGAGGACTGGAGGGG - Intronic
1180839551 22:18952826-18952848 AGTGTGTGTGAGAAGGGGAGTGG + Intergenic
1181392721 22:22595234-22595256 AGAGTGGGTTAGGTCAGGAGAGG + Intergenic
1181996463 22:26886692-26886714 AGTGTGGGAGTGAGCTGGAGGGG - Intergenic
950918415 3:16668179-16668201 GGTGTGGGTCAGACCTGGGGAGG + Intronic
954097586 3:48341406-48341428 AGTGTGGGTTAGATCTGGAAAGG - Intergenic
962949953 3:140209189-140209211 AGTTGGGGAGAGAACTGGAGAGG + Intronic
963799336 3:149660355-149660377 AATCTGGGTTGGAACTGGATGGG + Intronic
966164831 3:177006002-177006024 AGTGCAGGCTAGAGCTGGAGTGG - Intergenic
967597393 3:191342991-191343013 AGTGTGGGTTTGAACTGTGTGGG + Intronic
967768336 3:193307164-193307186 AGTGTGGGTTGGAAGCGGAGGGG - Intronic
969639955 4:8391317-8391339 GGTGCGAGTTAGAACTGCAGTGG + Intronic
970229134 4:13891102-13891124 AGTGGGGGGTAGAACAAGAGGGG - Intergenic
972429187 4:38964237-38964259 AGTGTGGCTTACAGCTGGGGAGG + Intergenic
972758287 4:42074475-42074497 ACTGAGGGTTAGAGCAGGAGGGG + Intronic
974034036 4:56801794-56801816 ACTGTGGATGAGAACTGGAATGG + Intergenic
974132321 4:57771728-57771750 ATTGGGGGTTAGAGCTGGGGAGG + Intergenic
975128277 4:70806516-70806538 AATGTGTGTAAGAACTGCAGCGG + Exonic
975983848 4:80185575-80185597 AGTGTGGTTGGGAGCTGGAGTGG + Intronic
976915542 4:90369757-90369779 AATATAAGTTAGAACTGGAGGGG - Intronic
977122336 4:93118523-93118545 AATGTGAGTTAGATCTAGAGAGG - Intronic
977346691 4:95824782-95824804 AGGGTGGTGTGGAACTGGAGAGG + Intergenic
978603700 4:110455804-110455826 AGTCTGGGATAGGACAGGAGAGG + Intronic
979338979 4:119497821-119497843 AGTGTGATTTAGAAATGGAATGG - Exonic
980857253 4:138454775-138454797 AGTGGGGGTAAGTAGTGGAGGGG + Intergenic
981964986 4:150589652-150589674 GGTGTGGGTTAGAAATGAAGTGG - Intronic
982207617 4:153008748-153008770 GGTGAGGGTTAAAACTGCAGTGG + Intergenic
985271161 4:188196565-188196587 TGAGTGGGTAGGAACTGGAGGGG - Intergenic
986093971 5:4537770-4537792 TTTGTGGGTGGGAACTGGAGTGG - Intergenic
986514810 5:8550136-8550158 TGTGTGGCAGAGAACTGGAGTGG - Intergenic
987031501 5:13980534-13980556 AGGGTGGGTTAGAAGTGAAGGGG - Intergenic
988498562 5:31765171-31765193 GGTCTGGGTTATAACTAGAGAGG - Intronic
989741423 5:44777944-44777966 AGTGTATGCTAGAAATGGAGTGG - Intergenic
990345815 5:54870250-54870272 AGTGGCCGTTAGAACTGGTGTGG - Intergenic
991981104 5:72231701-72231723 AGTTTGGGTAGGAACTGAAGAGG - Intronic
992935202 5:81696152-81696174 AGGGTAGGTTGGAACTAGAGCGG - Intronic
994227753 5:97273638-97273660 AGCCTGGTTCAGAACTGGAGAGG + Intergenic
996985335 5:129555279-129555301 AATGTGAGTTATAAATGGAGAGG + Intronic
997683501 5:135772611-135772633 ATTGTTGGTAATAACTGGAGGGG + Intergenic
1000238929 5:159390976-159390998 AGTGTGGGTTTGAACTGCACAGG + Intergenic
1002663763 5:180808294-180808316 AGTCTGGGTTAAGACTGGAATGG - Intronic
1003521175 6:6859982-6860004 AGTGTTGGACAGAACTGGGGTGG + Intergenic
1004431790 6:15551651-15551673 AGTGTGTGGTAGCAATGGAGAGG - Intronic
1007445910 6:41905832-41905854 AGGGTGCATGAGAACTGGAGAGG + Exonic
1007588996 6:43010184-43010206 AGTGTGGGTTAGAGTGGGAAAGG + Intronic
1008292475 6:49734233-49734255 AGTATGGGCTAGAGCAGGAGAGG - Intronic
1011879348 6:92004837-92004859 AGTGTGGGTCTGAACAGGAAAGG - Intergenic
1014084773 6:117330219-117330241 GGTGAGGGTTAGACCTGAAGAGG - Intronic
1015107356 6:129552570-129552592 ACTGTGGGTTACCACTGGAGGGG - Intergenic
1017572643 6:155763727-155763749 AATATGGGTTTGAACTGCAGAGG - Intergenic
1017782409 6:157726091-157726113 TTTGTGGGTGGGAACTGGAGTGG - Intronic
1018962722 6:168459651-168459673 GGGGTGGGTGAGCACTGGAGTGG + Intronic
1018962744 6:168459713-168459735 AGGGTGGGTGAGCACTGGAGTGG + Intronic
1019373924 7:678765-678787 AAAGTCTGTTAGAACTGGAGTGG - Intronic
1020544107 7:9501541-9501563 TGTGTGAGGTAGAACTGAAGAGG + Intergenic
1023804118 7:43859208-43859230 AGTGTGGATTGGAAATGGATTGG + Intergenic
1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG + Intronic
1026896650 7:74013455-74013477 AGTGTGGGTTGGATTTGGACAGG + Intergenic
1026898926 7:74026858-74026880 AGTGTGGGATGGAACAGGGGAGG - Intergenic
1028100094 7:86808623-86808645 TGTGTGTGTTAGAATTGGGGTGG + Intronic
1029014999 7:97306601-97306623 AGTGTTGGTTACATCTGTAGAGG - Intergenic
1029615880 7:101656910-101656932 TGTGTTTGTCAGAACTGGAGTGG - Intergenic
1029839252 7:103344687-103344709 AGTGAGAGGTAGAGCTGGAGGGG - Exonic
1031279904 7:119785752-119785774 AGTATGAGTTGGAACAGGAGTGG - Intergenic
1033269240 7:139915815-139915837 ACTGTGGGTTGGATCCGGAGCGG + Intronic
1033323174 7:140358463-140358485 AGTGTGCGTTGGAAATGGTGTGG - Intronic
1034965433 7:155387796-155387818 AGTGTGGGAAAGAACTGGATCGG + Intronic
1038049848 8:23798349-23798371 AGAGAGGGAGAGAACTGGAGAGG - Intergenic
1038987932 8:32833633-32833655 AGTGTGGGGTTCACCTGGAGAGG + Intergenic
1039218309 8:35298271-35298293 AGAGTGGGAGAAAACTGGAGTGG - Intronic
1039812259 8:41059600-41059622 AGTGTGGGCTAGAACCCCAGAGG + Intergenic
1042675032 8:71310823-71310845 AATGTTTGTTAGAAGTGGAGAGG - Intronic
1043381662 8:79708857-79708879 AGTGTGGGATAGGGCTGGAGAGG + Intergenic
1044288304 8:90436976-90436998 AGTGTGGCATAGAAGTTGAGTGG + Intergenic
1045407487 8:101880752-101880774 AGAGTGGATTAGAATTTGAGGGG + Intronic
1046016424 8:108610697-108610719 TGTCTGGGTTAGCAATGGAGTGG + Intronic
1046115652 8:109780167-109780189 AATATGGGTTAGAACTGCACAGG + Intergenic
1046771604 8:118122305-118122327 GGTGGGGGTTAGAGGTGGAGAGG - Intergenic
1048177411 8:132165109-132165131 AGTGTAGGTGACAGCTGGAGTGG - Intronic
1049627086 8:143629332-143629354 AGTATAGGCTAAAACTGGAGGGG - Intergenic
1051911399 9:22156229-22156251 ACTGAGGGTGAGAACTGAAGAGG + Intergenic
1052593244 9:30526173-30526195 GGTGTGTGTTAGGACGGGAGTGG + Intergenic
1053174414 9:35911807-35911829 AGAGTGGCTTGGAGCTGGAGAGG + Intergenic
1057378511 9:94546077-94546099 AGTGTTGGTGGGAACAGGAGAGG - Intergenic
1057729483 9:97596324-97596346 AGTGAGGGTTCTAAGTGGAGGGG - Intronic
1057963103 9:99476205-99476227 AGTAGGTGTTAGAGCTGGAGTGG + Intergenic
1059040346 9:110807950-110807972 AGTGTGTATTTGCACTGGAGAGG - Intergenic
1060766272 9:126296807-126296829 AGAGAGGCTTAGAACTGGAGTGG - Intergenic
1060833871 9:126740171-126740193 AGTGTGGTTTAGTACTACAGTGG + Intergenic
1185990525 X:4889900-4889922 AGTGGGGGTTAGGACTGAAGAGG + Intergenic
1186853403 X:13602318-13602340 TGTGTGGATTAGAAATGCAGGGG - Intronic
1190765665 X:53473637-53473659 AGTCAGGGTTGGAACTGGAGAGG + Intergenic
1191673847 X:63774393-63774415 AGAGTGGGTTGGAAAAGGAGAGG - Intronic
1191714524 X:64185216-64185238 AGTGAGAGCTAGAAGTGGAGAGG + Exonic
1192245287 X:69366942-69366964 AGTGGGGGCTAGAAGTGAAGGGG + Intergenic
1194499419 X:94661238-94661260 AGTGTGTGTTTTAACTGGCGAGG + Intergenic
1194666035 X:96678581-96678603 TGTGAGGATTGGAACTGGAGTGG - Intergenic
1195177390 X:102323822-102323844 AGTCTGGGATGAAACTGGAGTGG + Exonic
1195181474 X:102363271-102363293 AGTCTGGGATGAAACTGGAGTGG - Exonic
1195475944 X:105285509-105285531 AATGTGGATTAGAACTAGAAGGG + Intronic
1195863372 X:109404800-109404822 AGAGTGGGTTAGAACTTTTGGGG - Intronic
1196728300 X:118917017-118917039 AGTGTGGTTTTGATCAGGAGAGG + Intergenic
1197720838 X:129743659-129743681 GGTGTGGGTGAGAACTGCAGGGG - Intronic
1199474665 X:148232052-148232074 AGAGTGGATAAGAACTGGAGAGG + Intergenic
1199680088 X:150218135-150218157 AGAGTGGATTTGAGCTGGAGTGG - Intergenic