ID: 1143069292

View in Genome Browser
Species Human (GRCh38)
Location 17:4277022-4277044
Sequence CAGACAAGGTTCCCGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143069289_1143069292 16 Left 1143069289 17:4276983-4277005 CCAGCGATTCCTACAGGGGAACT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1143069292 17:4277022-4277044 CAGACAAGGTTCCCGAAGCTTGG 0: 1
1: 0
2: 1
3: 3
4: 98
1143069290_1143069292 7 Left 1143069290 17:4276992-4277014 CCTACAGGGGAACTCAGCTGTGC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1143069292 17:4277022-4277044 CAGACAAGGTTCCCGAAGCTTGG 0: 1
1: 0
2: 1
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143069292 Original CRISPR CAGACAAGGTTCCCGAAGCT TGG Intronic
901000561 1:6146879-6146901 CAGAGAAGGGTCCCCAAGGTGGG + Intronic
902393470 1:16119456-16119478 CAGACCAAGTTCCCACAGCTAGG - Intergenic
903491124 1:23729340-23729362 CAGGGAAGGTTCCAGAAGGTGGG + Intergenic
903597229 1:24503591-24503613 CAGACAAGTTTCAAGAAGTTAGG - Intronic
903821887 1:26109798-26109820 CAGACAAGGTTCCTGCCCCTAGG + Intergenic
903891450 1:26573044-26573066 CAGCCAAGGTTCCTGTCGCTGGG - Intronic
905061019 1:35139108-35139130 CAGACAAGGTTTCCAAAGGCTGG - Intergenic
905951451 1:41954871-41954893 CAGAAATGGTTCCACAAGCTTGG + Intronic
907839412 1:58142080-58142102 CAGAGAAGGTCCCTGAAGCAAGG - Intronic
911045709 1:93625632-93625654 CAGACCAGGTTCCTGCAGCCTGG + Intronic
915282026 1:154829353-154829375 CAGGAAAGGTTCCTGGAGCTTGG - Intronic
920299709 1:204981203-204981225 CAGACCAGGGTCCTGAATCTGGG - Intronic
920393353 1:205625582-205625604 TAGAAAAGGCTCCCAAAGCTCGG + Intronic
1064450743 10:15440088-15440110 CAGACAACGTTCTAGGAGCTAGG + Intergenic
1072654743 10:97321975-97321997 TAGACAAGGTCTCCGCAGCTGGG + Intergenic
1074511357 10:114115421-114115443 CACACAAGGTTACCATAGCTAGG + Intergenic
1076526195 10:131113666-131113688 CAGCCAGGGTCCCCGAGGCTGGG + Intronic
1077132068 11:978033-978055 CAGTCAAGGAGGCCGAAGCTGGG + Intronic
1078687914 11:13550025-13550047 CAGACAAGAGTACAGAAGCTGGG - Intergenic
1084570682 11:69957899-69957921 CAGACAAGGAAACCGAGGCTCGG - Intergenic
1085772500 11:79337871-79337893 CAGACAAGGAACCTGCAGCTGGG + Intronic
1091047526 11:132337584-132337606 CAGCCAAGATTCCTGAGGCTTGG - Intergenic
1093970062 12:25368412-25368434 CAGACAAGGTAACAGAAGCAAGG - Intergenic
1094737638 12:33253218-33253240 CATACAATGTGCCTGAAGCTGGG - Intergenic
1102960869 12:117092521-117092543 CAGAAAGGGTTCCAGAGGCTGGG + Intronic
1113398322 13:109969212-109969234 CAGACAAGGTCCTCGCATCTTGG + Intergenic
1113745335 13:112740769-112740791 CAGAGAAGCTTCTGGAAGCTGGG + Intronic
1119890435 14:78178455-78178477 CAGACAAGGTGCATGAAGCAAGG - Intergenic
1120092086 14:80343763-80343785 CAGACAAACTACCAGAAGCTGGG - Intronic
1120765107 14:88321964-88321986 CAGACACGGTGGCCGACGCTAGG + Intronic
1121922130 14:97891904-97891926 CAGACCAGGCTCCCTGAGCTTGG + Intergenic
1122049632 14:99047201-99047223 CAGACAAGGGAACCGAAGATGGG + Intergenic
1128478791 15:68019737-68019759 CAGACAAGGAACCTGAGGCTTGG + Intergenic
1129653628 15:77508475-77508497 CAGACAAGGAAGCTGAAGCTTGG + Intergenic
1130661094 15:85831853-85831875 CAGACAAGGTAACCAAGGCTCGG + Intergenic
1132291117 15:100704548-100704570 AAGACAAGATTCCCCAAGCCTGG + Intergenic
1132699722 16:1217154-1217176 CAGAAAAGGCTCCGGAAGCAGGG - Intronic
1133850054 16:9494917-9494939 CAGACAAAGTTCTGGATGCTGGG - Intergenic
1134446858 16:14337560-14337582 CAGGCACGGTTCCCTATGCTGGG + Intergenic
1135421734 16:22309503-22309525 CAGGCAAGGTACCCGGGGCTGGG + Exonic
1135530112 16:23245759-23245781 CAGACAGGGTTCCTGAAGCTGGG - Intergenic
1143069292 17:4277022-4277044 CAGACAAGGTTCCCGAAGCTTGG + Intronic
1143483765 17:7241650-7241672 TAGAAAAGGCTCCCAAAGCTCGG - Exonic
1147385786 17:40081145-40081167 CAGACAAGGAAACTGAAGCTTGG - Intronic
1152268929 17:79312537-79312559 CAGACCAGGGTCCCCAAGGTGGG + Intronic
1159106801 18:64011913-64011935 CAGAAATGGTTTCAGAAGCTTGG + Intergenic
1159416326 18:68153263-68153285 CAGAAAGGGTTTCAGAAGCTTGG + Intergenic
1161573313 19:5041894-5041916 CAGACAAGGTCCACTAAGCAGGG - Intronic
1164600604 19:29560844-29560866 CAGACAAGGTTCACGTTGCCAGG + Intronic
1165146277 19:33732844-33732866 CTCACAAGGTTCCCTAAGGTAGG + Intronic
926123296 2:10256317-10256339 CAGGCATGGTGCCTGAAGCTGGG + Intergenic
929399838 2:41567129-41567151 CAGTCAAGGTTCTCCATGCTGGG + Intergenic
932618243 2:73249769-73249791 CAGTGAAGGTTCCCGAGGCCAGG - Intronic
939763215 2:146211055-146211077 CAGAAAAGTTTCCAGGAGCTTGG + Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
1170559462 20:17544247-17544269 CAGGCAAGGGACGCGAAGCTGGG + Intronic
1170713044 20:18809472-18809494 CAGACAAGGTGCCTGCACCTGGG - Intergenic
1171208810 20:23301503-23301525 CAGCCAGGGCTCCCGAAGCAAGG + Intergenic
1179412437 21:41172465-41172487 CAGACAGGGTAACCGAGGCTTGG + Intronic
951713716 3:25613890-25613912 CAGATAAGGATCCTGAAGCTTGG - Intronic
951738167 3:25890952-25890974 CAGTCAAGCTTCCCACAGCTAGG + Intergenic
952766042 3:36955283-36955305 AAGACAAGGTTTCCCAACCTTGG - Intergenic
953498692 3:43412140-43412162 CAAATAAGATTCCTGAAGCTAGG + Intronic
953848113 3:46444915-46444937 CAGACATCTTTCCCCAAGCTGGG + Intronic
955475886 3:59335703-59335725 CCGAGAAGGCTCCCGAGGCTGGG - Intergenic
961640451 3:128361590-128361612 GAGACAAGGGTCCTGATGCTAGG + Intronic
961723279 3:128909783-128909805 AAGACCAGGTCCCAGAAGCTTGG - Intronic
965737936 3:171841641-171841663 CAGACAAGGTTGTAGACGCTGGG + Intergenic
966934337 3:184695939-184695961 CAGACCAGGTTCCCAAGGCAGGG - Intergenic
967882298 3:194310343-194310365 CAGGCAAGCTCCCGGAAGCTGGG + Intergenic
975985143 4:80196083-80196105 CAGAGAAGGGTCTCAAAGCTGGG + Exonic
979205675 4:118034002-118034024 CAGACAAGTTTCTCGCGGCTTGG + Intronic
984866843 4:184288246-184288268 CAGAAATGATTCCTGAAGCTGGG - Intergenic
989410980 5:41120259-41120281 AAGACATGGTGCCCAAAGCTTGG - Intergenic
992451129 5:76876920-76876942 AAGACAAGGTTCACGAAGGTTGG - Intronic
996889888 5:128405898-128405920 GAGACAAGTTTCCGGAAGCCAGG + Intronic
1002573744 5:180159947-180159969 CAAACAATGTGCTCGAAGCTTGG - Intronic
1002898230 6:1391198-1391220 CAAACAGGGACCCCGAAGCTAGG + Intronic
1005830478 6:29667148-29667170 CAGACAAGGCAACTGAAGCTTGG - Intronic
1020379989 7:7533481-7533503 GAGACAAAGTTTCCAAAGCTAGG - Intronic
1022144823 7:27526791-27526813 CTGACAATGTGCCAGAAGCTGGG + Intronic
1025000202 7:55309544-55309566 CAGACACGGTTCCTCCAGCTCGG + Intergenic
1026233103 7:68502591-68502613 CAGATGAGGTTTCTGAAGCTAGG - Intergenic
1026987218 7:74562151-74562173 CTCACACGGTTCCCGAAGCCTGG + Intronic
1027336637 7:77157882-77157904 CAGACAAGGTTCCTGACCTTAGG - Intronic
1029779153 7:102713227-102713249 CAGACAAGGTTCCTGACCTTAGG + Intergenic
1033213990 7:139481037-139481059 CATATAAGGCTCCTGAAGCTGGG - Intronic
1034549323 7:151810330-151810352 CCCACAAGGTTTCCGAGGCTTGG + Intronic
1036617906 8:10403183-10403205 CAGAGAAGCTTCCGGAAACTTGG + Intronic
1037702377 8:21286819-21286841 CACACAGGGTTCCAGAAGCATGG + Intergenic
1039976186 8:42367149-42367171 CAGGCACTGTTCTCGAAGCTTGG + Intronic
1040868698 8:52077787-52077809 CAGAGAAGCTCCCCGAACCTTGG + Intergenic
1042691320 8:71502689-71502711 CAGATAAGGTGCCTGAAGCATGG + Intronic
1045063361 8:98426600-98426622 AAGAAAAGTTTCCCGAAGCCCGG - Intronic
1048335570 8:133499738-133499760 CACACAAGGAAACCGAAGCTCGG + Intronic
1060174204 9:121485587-121485609 AAGACAAGGTTCCCCAAACCTGG + Intergenic
1062262033 9:135667613-135667635 CAAACAAGGGGCCGGAAGCTGGG - Intergenic
1062354698 9:136156491-136156513 CAGACAAGGGTGCCGAACCCCGG - Intergenic
1062507112 9:136883332-136883354 CAGAAAAGGTTTCCCAAGCTTGG - Intronic
1187107138 X:16254833-16254855 CAGAAAAGGGGCCCGATGCTCGG + Intergenic
1191780739 X:64862285-64862307 CAGACAACATTCCAGAATCTTGG - Intergenic
1195911248 X:109890443-109890465 CTGACATGGTCCCCGAGGCTGGG + Intergenic
1195968833 X:110453053-110453075 CAGACATGGCTCCATAAGCTGGG - Exonic