ID: 1143076020

View in Genome Browser
Species Human (GRCh38)
Location 17:4343958-4343980
Sequence CTCTGGAGACTAAAGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1623
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 1565}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143076016_1143076020 -1 Left 1143076016 17:4343936-4343958 CCTCAGTTGCAACAGATACAAAC 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG 0: 1
1: 0
2: 3
3: 54
4: 1565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143076020 Original CRISPR CTCTGGAGACTAAAGCTCTG GGG Intronic
900699931 1:4040485-4040507 CTCTGTAGACTCCACCTCTGGGG + Intergenic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
901069371 1:6509551-6509573 CTCGGGAGACGTAGGCTCTGGGG + Intronic
901191863 1:7417367-7417389 CTCTGTAGACTCCACCTCTGGGG - Intronic
901224503 1:7605274-7605296 CTCTGTAGACTCCACCTCTGGGG - Intronic
901970737 1:12905658-12905680 CTCTGTAGACTCCACCTCTGGGG + Intronic
902014428 1:13296112-13296134 CTCTGTAGACTCCACCTCTGGGG - Intergenic
902843981 1:19095106-19095128 CTCTGGGGAGTAAGGCTGTGAGG - Intronic
904123082 1:28215933-28215955 CACTGCAGCCTCAAGCTCTGGGG + Intronic
904278862 1:29404443-29404465 CTCTGTAGACTCCACCTCTGGGG - Intergenic
905355447 1:37380663-37380685 CTCTGTAGACTCCAACTCTGTGG - Intergenic
905981708 1:42234993-42235015 CTCTGTAGACTCCACCTCTGGGG - Intronic
906008589 1:42502047-42502069 CTCTGTAGACTCCACCTCTGGGG - Intronic
906570117 1:46830772-46830794 CTCTGTAGACTCCAGCTCTGTGG - Intergenic
906571656 1:46846667-46846689 CTCTGTAGACTCCACCTCTGGGG + Intergenic
906663788 1:47602765-47602787 CTTTGTAGACTCCAGCTCTGGGG + Intergenic
906714508 1:47956756-47956778 CTCTGTAGACTCCACCTCTGGGG + Intronic
906892990 1:49738456-49738478 CTCTGTAGACTACACCTCTGGGG + Intronic
907003962 1:50891948-50891970 CTCTGTAGACTCCACCTCTGGGG - Intronic
907436034 1:54448858-54448880 CTCTGTAGACTCCACCTCTGTGG - Intergenic
907780765 1:57563840-57563862 CTCTGTAGACTCCATCTCTGGGG + Intronic
907994044 1:59611063-59611085 CTCTGTAGACTCCACCTCTGAGG + Intronic
908099004 1:60771216-60771238 CTCTGTAGACTCCACCTCTGGGG + Intergenic
908099704 1:60778119-60778141 CTCTGTAGACTCCACCTCTGGGG - Intergenic
908215128 1:61943635-61943657 CTCTGTAGACTCCACCTCTGGGG + Intronic
908595584 1:65685763-65685785 CTCTGTAGACTCCACCTCTGAGG - Intergenic
908638061 1:66190424-66190446 CTCTGTAGACTCCACCTCTGGGG - Intronic
908813514 1:68008690-68008712 CTCTGTAGACTCTACCTCTGGGG - Intergenic
908821636 1:68093197-68093219 CTCTGTAGACTCTATCTCTGGGG - Intergenic
908913707 1:69102120-69102142 CTCTGTAGACTCCACCTCTGGGG - Intergenic
909396963 1:75181310-75181332 CTCTGTAGACTCCACCTCTGGGG - Intergenic
909399165 1:75207204-75207226 CGCTGAAGTCAAAAGCTCTGAGG + Intronic
909552754 1:76917727-76917749 GCCTGGAGACTATAGCTCTTAGG - Intronic
909770409 1:79414692-79414714 CTCTGTAGACTCCACCTCTGGGG + Intergenic
910339323 1:86167933-86167955 CTCTGTAGACTCCACCTCTGGGG - Intergenic
910381699 1:86633522-86633544 CTCTGTAGACTCCACCTCTGGGG - Intergenic
910398443 1:86814323-86814345 CTCTGTAGACTCCACCTCTGGGG + Intergenic
910627680 1:89325670-89325692 CTCTGTAGACTCCACCTCTGGGG + Intergenic
910709788 1:90167379-90167401 CTCTGTAGACTCCACCTCTGGGG + Intergenic
910822550 1:91367158-91367180 CTCTGTAGACTCCACCTCTGGGG + Intronic
910945714 1:92589666-92589688 CTCTGTAGACTCCACCTCTGGGG + Intronic
911022962 1:93407546-93407568 CTCTGTAGACTCCACCTCTGGGG - Intergenic
911074139 1:93856269-93856291 CTCTGTAGACTTCACCTCTGGGG + Intergenic
911106322 1:94134652-94134674 CTCTGTAGACTCTACCTCTGGGG + Intergenic
911128968 1:94369890-94369912 CTCTGTAGACTCCACCTCTGGGG - Intergenic
911213149 1:95164091-95164113 CTCTGTAGACTCCACCTCTGGGG - Intronic
911339243 1:96617457-96617479 CTCTGTAGACTCCACCTCTGGGG - Intergenic
911670636 1:100603860-100603882 CTCTGTAGACTCCACCTCTGGGG - Intergenic
911963622 1:104337963-104337985 CTCTGTAGACTCCACCTCTGGGG - Intergenic
912225804 1:107732757-107732779 CTCTGTAGACTCCACCTCTGGGG + Intronic
912285387 1:108363869-108363891 CTCTGTAGACTCCACCTCTGGGG - Intergenic
912614015 1:111079097-111079119 CTCTGTAGACTCCACCTCTGGGG - Intergenic
912742372 1:112212167-112212189 CTCTGTAGACTCCACCTCTGGGG + Intergenic
912751119 1:112288529-112288551 CTCTGTAGACTCCACCTCTGGGG + Intergenic
912973302 1:114304528-114304550 CTCTGTAGACTCCACCTCTGGGG + Intergenic
913033148 1:114932946-114932968 CTCTGTAGACTCCACCTCTGGGG + Intronic
913091746 1:115480793-115480815 CTCTAACCACTAAAGCTCTGGGG + Intergenic
913258343 1:116975275-116975297 CTCTGTAGACTCCAACTCTGGGG + Intronic
913285033 1:117218131-117218153 CTCTGTAGACTCCACCTCTGGGG + Intergenic
913580738 1:120224587-120224609 CTCTGTAGACTGCACCTCTGGGG - Intergenic
913627441 1:120673812-120673834 CTCTGTAGACTGCACCTCTGGGG + Intergenic
913710455 1:121477661-121477683 CTCTGTAGACTCCACCTCTGGGG + Intergenic
914208687 1:145558889-145558911 CTCTGTAGACTCCACCTCTGGGG - Intergenic
914441512 1:147711654-147711676 CTCTGTAGACTCCACCTCTGAGG - Intergenic
914562668 1:148836024-148836046 CTCTGTAGACTGCACCTCTGGGG - Intronic
914583446 1:149040590-149040612 CTCTGTAGACTCCACCTCTGGGG - Intronic
914610161 1:149294198-149294220 CTCTGTAGACTGCACCTCTGGGG + Intergenic
914912798 1:151800952-151800974 CTCTGGGGATAAAAACTCTGGGG - Exonic
914997075 1:152553378-152553400 CTCTGTAGACTCCACCTCTGGGG - Intronic
915733158 1:158068181-158068203 CTCTGCCGACCAAAGCTCTCTGG - Intronic
915763260 1:158336621-158336643 CTCTAGAGACTCCACCTCTGGGG + Intergenic
915814678 1:158953272-158953294 CTCTGTAGACTCCACCTCTGGGG + Intronic
915886823 1:159730976-159730998 CTCTGTAGACTCCACCTCTGGGG + Intergenic
916373564 1:164126547-164126569 CTCTGTAGACTCCACCTCTGGGG - Intergenic
916597328 1:166257181-166257203 CTCTGGAGGCTCAAGCTCTGGGG + Intergenic
916915405 1:169401199-169401221 CTCTGTAGACTCTACCTCTGGGG + Intronic
916923793 1:169496696-169496718 CTTTGGAGAATAAAGAACTGAGG - Intergenic
917398323 1:174618193-174618215 CTCTGTAGACTCCACCTCTGGGG + Intronic
917764120 1:178198916-178198938 CTCTGTAGACTCCACCTCTGGGG - Intronic
917893711 1:179465712-179465734 CTCTGCAGACTCCATCTCTGGGG - Intronic
917987330 1:180334066-180334088 CTCTGTAGACTCCACCTCTGCGG + Intronic
918554610 1:185783937-185783959 CTCTGTAGACTCTACCTCTGGGG - Intronic
918593123 1:186262181-186262203 CTCTGTAGACTCCACCTCTGGGG - Intergenic
918890318 1:190258083-190258105 CTCTGTAGACTCCACCTCTGGGG - Intronic
919623273 1:199886536-199886558 CTCTGTAGACTCCACCTCTGGGG - Intergenic
919860834 1:201738756-201738778 CACTAGAGACTACTGCTCTGTGG + Intronic
920085438 1:203412009-203412031 CTCTGTAGACTCCACCTCTGTGG + Intergenic
920589899 1:207207271-207207293 CTCTGTAGACTTCACCTCTGGGG + Intergenic
920781116 1:208991973-208991995 CTCTGTAGACTCCACCTCTGGGG + Intergenic
921184596 1:212658557-212658579 CTCTGTAGACTCCACCTCTGGGG + Intergenic
921258124 1:213361148-213361170 CTCTGTAGACTCCACCTCTGGGG - Intergenic
921469631 1:215532750-215532772 CTCTGTAGACTCCACCTCTGGGG + Intergenic
921700167 1:218260004-218260026 CTCTGGAGAAAAACTCTCTGGGG + Intergenic
921993065 1:221388651-221388673 CTCTGTAGACTCCACCTCTGGGG - Intergenic
922374361 1:224946079-224946101 CTCTGTAGACTCCACCTCTGGGG - Intronic
922383833 1:225061104-225061126 CTCTGTAGACTCCACCTCTGGGG - Intronic
922393176 1:225168701-225168723 CTCTGTAGACTGCACCTCTGGGG + Intronic
922777022 1:228219538-228219560 CTCCGGAGAGTACAGCTGTGAGG + Exonic
924285477 1:242481610-242481632 CTCTGTAGACTGCACCTCTGGGG + Intronic
924411221 1:243807584-243807606 CTCTGTAGACTCCACCTCTGGGG + Intronic
1063220753 10:3965569-3965591 CTCTGGAGACTAAGGCAGGGAGG - Intergenic
1063844495 10:10110986-10111008 ATCTGCCTACTAAAGCTCTGGGG - Intergenic
1064431103 10:15270428-15270450 CTCTGTAGACTCCACCTCTGGGG + Intronic
1064602830 10:17010561-17010583 CACTGGAGCCTTGAGCTCTGAGG - Intronic
1065049702 10:21779146-21779168 CTCTGTAGACTCCACCTCTGGGG + Intronic
1065074297 10:22061250-22061272 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1065081161 10:22130913-22130935 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1066139350 10:32488075-32488097 CTCTGTAGACTCCACCTCTGAGG - Intronic
1066152833 10:32642240-32642262 CTCTGTAGACTCCACCTCTGGGG - Intronic
1066163029 10:32755167-32755189 CTCTGTAGACTCCACCTCTGGGG + Intronic
1066168575 10:32816387-32816409 CTCTGTAGACTCCACCTCTGGGG + Intronic
1066176488 10:32912712-32912734 CTCTGTAGACAACACCTCTGGGG + Intronic
1066274268 10:33853336-33853358 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1066603684 10:37137775-37137797 CTCTGTAGACTCCACCTCTGGGG + Intronic
1066709384 10:38216806-38216828 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1066755106 10:38703559-38703581 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1067195224 10:44112340-44112362 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1067339314 10:45388241-45388263 CTCTGTAGACTCCACCTCTGGGG + Intronic
1067845353 10:49715463-49715485 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1067903136 10:50262932-50262954 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1067996743 10:51281604-51281626 CTCTGTAGACTCCACCTCTGGGG + Intronic
1068169100 10:53370625-53370647 CTCTGTAGACTTCACCTCTGTGG + Intergenic
1068210130 10:53910051-53910073 CTCTGTAGACTCCACCTCTGGGG + Intronic
1068214702 10:53968402-53968424 CTCTGTAGACTCCACCTCTGGGG + Intronic
1068309195 10:55256775-55256797 CTCTGTAGACTCCACCTCTGGGG + Intronic
1068576212 10:58687460-58687482 CTCTGTAGACTCCACCTCTGGGG - Intronic
1068609505 10:59043458-59043480 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1068641567 10:59413911-59413933 CTCTGCAGACTCCACCTCTGGGG - Intergenic
1068961984 10:62876288-62876310 CACTGGAAACTGAAACTCTGTGG - Intronic
1069057229 10:63857282-63857304 CTCTGTAGACTCCACCTCTGAGG - Intergenic
1069066786 10:63950235-63950257 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1069188976 10:65464019-65464041 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1069227159 10:65958983-65959005 CTCTGTAGACTTCACCTCTGGGG - Intronic
1069256314 10:66335820-66335842 CTCTGTAGACTCCACCTCTGAGG - Intronic
1069355882 10:67584658-67584680 CTCTGTAGACTCCACCTCTGGGG - Intronic
1069984889 10:72276288-72276310 CTCTGGAGACTCTGGCTCGGTGG - Intergenic
1070064711 10:73022035-73022057 CTCTGTAGACTCCACCTCTGTGG + Intronic
1070217622 10:74403334-74403356 CTCTGTAGACTCCATCTCTGGGG - Intronic
1070455347 10:76609048-76609070 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1070542125 10:77423592-77423614 CTCTGTATTCTGAAGCTCTGAGG + Intronic
1070936788 10:80304569-80304591 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1071244388 10:83746794-83746816 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1071323734 10:84491330-84491352 CTCTGTAGACTCCACCTCTGGGG - Intronic
1071421485 10:85504668-85504690 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1071663569 10:87530793-87530815 CTCTGTAGACTCCACCTCTGGGG - Intronic
1071763365 10:88634190-88634212 CTCTGTAGACTGCATCTCTGGGG - Intergenic
1071884698 10:89937113-89937135 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1072243680 10:93521496-93521518 CTCTGTAGACTCCAACTCTGGGG + Intronic
1072287319 10:93928204-93928226 CTCTGTAGACTCCAACTCTGGGG + Intronic
1072361373 10:94663155-94663177 CTCTGTAGACTACACCTCTGGGG - Intergenic
1072364581 10:94696033-94696055 CTCTGTAGACTCCACCTCTGGGG + Intronic
1072370157 10:94758025-94758047 CTCTGTAGACTCCACCTCTGGGG - Intronic
1072373813 10:94793950-94793972 CTCTGTAGACTACACCTTTGGGG - Intronic
1072384928 10:94914827-94914849 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1072388756 10:94960216-94960238 CTCTGTAGACTCCACCTCTGGGG - Intronic
1072775039 10:98182636-98182658 CTCTGTAGACTCCACCTCTGGGG - Intronic
1072859104 10:98984043-98984065 CTCTGTAGACTCCACCTCTGGGG + Intronic
1072929180 10:99646150-99646172 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1073016869 10:100406867-100406889 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1073022266 10:100454991-100455013 CTCTGTAGACTCCAGCTCTGGGG + Intergenic
1073193677 10:101670537-101670559 CTGTGGAGTATAAAGCTCTAGGG - Intronic
1073927389 10:108532984-108533006 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1074000532 10:109367773-109367795 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1074017319 10:109546809-109546831 CTCTGTAGACTACACCTCTGGGG + Intergenic
1074240882 10:111637645-111637667 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1074286719 10:112104460-112104482 CTCTGTAGGCTCCAGCTCTGAGG + Intergenic
1074536546 10:114332162-114332184 CTCTGCTGGCCAAAGCTCTGTGG - Intronic
1074619517 10:115104942-115104964 CTTTGGTTACTATAGCTCTGTGG + Intronic
1075205666 10:120445605-120445627 CTCTGCAGACTCCACCTCTGGGG + Intergenic
1075841053 10:125503885-125503907 CTCTGCAGAATGAAGTTCTGTGG + Intergenic
1075858080 10:125648053-125648075 CTCTGTAGACTTCACCTCTGGGG + Intronic
1076590925 10:131581569-131581591 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1076666046 10:132093355-132093377 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1077450431 11:2639802-2639824 CTCTGTAGACTCCACCTCTGGGG - Intronic
1077454112 11:2667668-2667690 CTCTGGAGGCTGAAGCACGGAGG + Intronic
1077698225 11:4414531-4414553 CTCAGGAGATTACAGCTTTGAGG + Intergenic
1077860980 11:6179664-6179686 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1078111449 11:8397013-8397035 CTCTGTAGACTCCACCTCTGGGG + Intronic
1078166423 11:8889793-8889815 CTCTGTAGACTCCACCTCTGGGG + Intronic
1078726737 11:13938955-13938977 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1078812116 11:14778216-14778238 CTCTGTAGACTCCACCTCTGGGG + Intronic
1078990692 11:16643504-16643526 CTCTGTAGACTCCACCTCTGGGG - Intronic
1079037531 11:17034097-17034119 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1079177729 11:18158326-18158348 CTCTGTAGACTCCACCTCTGGGG + Intronic
1079337828 11:19586968-19586990 CTCTGTAGACTCCACCTCTGGGG - Intronic
1079342523 11:19624357-19624379 CTCTGTAGACTCCACCTCTGGGG - Intronic
1079549296 11:21674512-21674534 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1079567131 11:21896936-21896958 CTATGGAGGTTCAAGCTCTGAGG - Intergenic
1079656695 11:22994168-22994190 CTCTGAAGTCAAAAGCCCTGTGG - Intergenic
1079682975 11:23321504-23321526 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1079865083 11:25724327-25724349 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1079873780 11:25831825-25831847 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1080430361 11:32192395-32192417 TTCTGGAGGCTAAAAGTCTGAGG - Intergenic
1080488033 11:32731324-32731346 CTCTGTAGACTCCACCTCTGGGG + Intronic
1080490904 11:32763148-32763170 CTCTGTAGACTCCACCTCTGTGG + Intronic
1080818164 11:35779036-35779058 CTCTGTAGACTCCACCTCTGGGG - Intronic
1080917424 11:36673939-36673961 CTCTGTAGACTCCACCTCTGCGG + Intergenic
1080983631 11:37435419-37435441 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1081180885 11:39984553-39984575 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1081241390 11:40710797-40710819 CTCTGTAGACTCCACCTCTGGGG - Intronic
1081257125 11:40911097-40911119 CTCTGTAGACTCCACCTCTGGGG + Intronic
1081377531 11:42377356-42377378 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1081405075 11:42688556-42688578 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1081433767 11:43004959-43004981 CTCTGTAGACTCTACCTCTGGGG - Intergenic
1081454374 11:43206822-43206844 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1081768276 11:45628101-45628123 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1082122194 11:48391479-48391501 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1082136467 11:48554983-48555005 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1082145197 11:48658333-48658355 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1082273683 11:50199352-50199374 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1082556177 11:54565721-54565743 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1082575470 11:54798150-54798172 CTCTGTAGACTACACCTCTTGGG + Intergenic
1082684368 11:56220002-56220024 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1082754756 11:57063289-57063311 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1082860245 11:57848373-57848395 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1082966644 11:58972790-58972812 CTCTGTAGACTCCACCTCTGGGG + Intronic
1083003647 11:59321083-59321105 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1083009886 11:59387238-59387260 CTCTGTAGACTCCAACTCTGGGG - Intergenic
1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG + Intronic
1083094242 11:60233327-60233349 CTTTGGAGGCTTGAGCTCTGGGG - Intronic
1083099537 11:60288544-60288566 CTCTGGAGGCTTGAGCTCTGGGG + Intronic
1083523017 11:63333720-63333742 CTCTGTAGACTCCACCTCTGGGG - Intronic
1083531916 11:63430974-63430996 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1083658165 11:64240184-64240206 CTCTGGAGGCGGTAGCTCTGGGG - Intergenic
1084247666 11:67871229-67871251 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1084796804 11:71511576-71511598 CTCTGTAGACTCCACCTCTGGGG + Intronic
1084825157 11:71724264-71724286 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1085133235 11:74060168-74060190 CTCTGTAGACTCCACCTCTGGGG + Intronic
1085162464 11:74360949-74360971 CTCTGTAGACTCCACCTCTGGGG + Intronic
1085222634 11:74887973-74887995 CTCTGTAGACTCCACCTCTGAGG + Intronic
1085248011 11:75119828-75119850 CTCTGTAGACTCCACCTCTGGGG + Intronic
1085368827 11:75979467-75979489 CTCTGTAGACTCCACCTCTGGGG - Intronic
1085536529 11:77223794-77223816 CTCTGTAGACTCCACCTCTGGGG - Intronic
1086078620 11:82880127-82880149 CTCTGTAGACTCCACCTCTGGGG - Intronic
1086142821 11:83518111-83518133 CTCTGTAGACTCCACCTCTGGGG - Intronic
1086301008 11:85426188-85426210 CTCTGTAGACTCTACCTCTGGGG + Intronic
1086417012 11:86598495-86598517 CTCTGTAGACTCCACCTCTGGGG + Intronic
1086565710 11:88223794-88223816 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1086730298 11:90240601-90240623 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1086757548 11:90583052-90583074 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1086873980 11:92073071-92073093 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1086881045 11:92153671-92153693 CTCTGGAATCAAAAGCCCTGGGG - Intergenic
1086979479 11:93177963-93177985 CTCTGTAGACTCCACCTCTGGGG - Intronic
1087080105 11:94162309-94162331 CTCTGTAGACTCCACCTCTGGGG - Intronic
1087089006 11:94248585-94248607 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1087101667 11:94370908-94370930 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1087103209 11:94384750-94384772 CTCTGTAGACTCCACCTCTGGGG + Intronic
1087249113 11:95876190-95876212 CTCTGAAGACTCCACCTCTGGGG - Intronic
1087503995 11:98996979-98997001 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1087718881 11:101639408-101639430 CTCTGCAGACTCCACCTCTGGGG + Intronic
1087878908 11:103392090-103392112 CTCTGTAGACTCCACCTCTGCGG - Intronic
1088142471 11:106633979-106634001 AGCTGGAGCCAAAAGCTCTGAGG + Intergenic
1088309123 11:108441372-108441394 CTCTGTAGACTCCACCTCTGGGG + Intronic
1088381032 11:109192959-109192981 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1088419993 11:109635518-109635540 CTCTGGAGCCTGAAGCTATGGGG + Intergenic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1089192883 11:116667238-116667260 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1089642290 11:119855741-119855763 CTCTGGACAAAAAAGCTCTCTGG + Intergenic
1090095077 11:123734661-123734683 CACTGGACTGTAAAGCTCTGAGG + Intronic
1090308877 11:125717094-125717116 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1090746924 11:129713082-129713104 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1090856106 11:130610463-130610485 CTTCGGAGACTAAAGCACGGGGG + Intergenic
1091220472 11:133927424-133927446 CTTGGGAGAGTAAGGCTCTGGGG + Intronic
1091424589 12:376170-376192 CTCTGTAGACTCCACCTCTGGGG - Intronic
1091867288 12:3851655-3851677 CTCTGTAGACTCCACCTCTGGGG + Intronic
1091874714 12:3924398-3924420 CTCTGTAGCCTAGTGCTCTGGGG + Intergenic
1092079023 12:5698006-5698028 CTCTGTAGACTCCACCTCTGGGG + Intronic
1092517118 12:9226305-9226327 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1092638547 12:10478567-10478589 CTCTGTAGACTGCACCTCTGGGG - Intergenic
1092718494 12:11416704-11416726 CTCTGTAGACTCCACCTCTGGGG + Intronic
1093309784 12:17564684-17564706 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1093320223 12:17704974-17704996 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1093547251 12:20363152-20363174 CTTTTGAGGCTAAAGCTTTGGGG + Intergenic
1093672975 12:21899861-21899883 CTCTGTAGACTCCACCTCTGGGG + Intronic
1094162391 12:27405149-27405171 CTCTGTAGACTCCATCTCTGGGG + Intronic
1094381591 12:29848995-29849017 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1094387452 12:29910437-29910459 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1094792506 12:33930952-33930974 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1095033401 12:37323351-37323373 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1095089662 12:38091868-38091890 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1095209376 12:39475242-39475264 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1095217714 12:39569217-39569239 ATCTGTAGACTCAACCTCTGGGG - Intronic
1095225039 12:39669643-39669665 CTCTGTAGACTCCACCTCTGGGG - Intronic
1095231616 12:39746477-39746499 CTCTGTAGACTCCACCTCTGGGG + Intronic
1095483399 12:42658958-42658980 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1095490166 12:42725400-42725422 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1095827466 12:46545520-46545542 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1095845285 12:46737499-46737521 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1095854847 12:46849104-46849126 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1095913911 12:47457390-47457412 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1096044871 12:48553796-48553818 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1096359672 12:50973042-50973064 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1096891644 12:54777296-54777318 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1096954334 12:55510292-55510314 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1096962939 12:55598615-55598637 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1097139502 12:56888399-56888421 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1097264352 12:57737266-57737288 CTCTGGAGCCTCCAGCTCCGGGG - Exonic
1097304299 12:58052350-58052372 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1097569673 12:61317269-61317291 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1097734579 12:63167845-63167867 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1097774367 12:63628617-63628639 CTCTGTAGACTCCACCTCTGGGG + Intronic
1097775020 12:63634832-63634854 CTCTGTAGACTCCACCTCTGGGG + Intronic
1098015510 12:66100320-66100342 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1098638478 12:72813159-72813181 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1098699465 12:73606242-73606264 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1098722845 12:73924679-73924701 CTCTGTAGACTCCACCTCTGCGG + Intergenic
1098844866 12:75523024-75523046 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1098901281 12:76114345-76114367 CTCGGGAGACTAAGGTTGTGGGG + Intergenic
1099086956 12:78257734-78257756 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1099240113 12:80128630-80128652 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1099313922 12:81061835-81061857 CTCTGTAGACTCCACCTCTGGGG - Intronic
1099357730 12:81659606-81659628 CTCTGTAGACTCCACCTCTGGGG + Intronic
1099428253 12:82550808-82550830 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1099677892 12:85785950-85785972 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1099703529 12:86120290-86120312 CTCTGTAGACTCCACCTCTGGGG + Intronic
1099740401 12:86627266-86627288 CTCTGTAGACTCCACCTCTGGGG + Intronic
1099795484 12:87394478-87394500 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1099860408 12:88218651-88218673 GTCTGCACACTACAGCTCTGGGG - Intergenic
1099965553 12:89441165-89441187 CTCTGTAGACTTCACCTCTGGGG + Intronic
1100414367 12:94356422-94356444 CTCTGGAAAAGAAAGATCTGGGG - Intronic
1101031417 12:100664444-100664466 CTCTGGAGGCTGAGGCACTGAGG - Intergenic
1101242943 12:102856384-102856406 CTCTGTAGACTCCACCTCTGGGG + Intronic
1101401735 12:104394148-104394170 CTCTGCAGACTCCACCTCTGGGG - Intergenic
1101414938 12:104500773-104500795 CACTGAAAGCTAAAGCTCTGTGG - Intronic
1101524843 12:105519454-105519476 CTCTGTAGACTTCACCTCTGGGG - Intergenic
1101636907 12:106551508-106551530 CTCTGTAGACTCCACCTCTGGGG - Intronic
1103203591 12:119110416-119110438 CTCTGTAGACTCCACCTCTGGGG - Intronic
1103236125 12:119374182-119374204 ATCTAGAGACTTAAGATCTGAGG + Intronic
1103560826 12:121792657-121792679 CTCTGCAGCCTGAGGCTCTGGGG - Intronic
1104175350 12:126326255-126326277 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1104186573 12:126438355-126438377 GTGTGGAAACTAAAGCTCAGAGG + Intergenic
1104644723 12:130488787-130488809 CTCTGCAGACCAAAGCCCAGGGG - Intronic
1105072752 12:133245476-133245498 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1105283525 13:18984273-18984295 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1105311837 13:19219156-19219178 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1105420041 13:20243808-20243830 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1105648430 13:22346620-22346642 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1105992634 13:25637658-25637680 CTCTGTAGACTCCAACTCTGGGG + Intronic
1106445751 13:29829279-29829301 CTCTGTAGACTCTACCTCTGGGG - Intronic
1106646276 13:31638016-31638038 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1106737956 13:32607650-32607672 CTCTGTAGACTCCAACTCTGGGG - Intronic
1107380673 13:39853867-39853889 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1107412347 13:40169568-40169590 CACTGGAGACTAAACCTGTTGGG - Intergenic
1107507332 13:41047868-41047890 CTCTGTAGACTCCACCTCTGGGG - Intronic
1107596760 13:41971317-41971339 CTCTGGATGCCAAAGCTCAGTGG + Intergenic
1108170366 13:47735305-47735327 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1108471721 13:50773873-50773895 CTCTGTAGACTCCATCTCTGGGG - Intronic
1108547963 13:51515290-51515312 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1108553266 13:51567563-51567585 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1108562055 13:51653996-51654018 CTCTGTAGACTCCACCTCTGGGG - Intronic
1108799525 13:54077758-54077780 CTCTGAAAGCTATAGCTCTGAGG - Intergenic
1108810643 13:54219487-54219509 CTCTGCAGACTCCACCTCTGGGG + Intergenic
1108988790 13:56629214-56629236 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1109363279 13:61324096-61324118 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1109566374 13:64121082-64121104 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1109572993 13:64216627-64216649 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1109675884 13:65675423-65675445 CTCTCTAGACTCAACCTCTGTGG - Intergenic
1109949578 13:69483453-69483475 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1110502382 13:76243390-76243412 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1110699164 13:78526587-78526609 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1110729753 13:78866404-78866426 CTCTGCAGACTCCACCTCTGGGG + Intergenic
1111115396 13:83769951-83769973 CTCTGAAGGCTAAAATTCTGAGG - Intergenic
1111746814 13:92281298-92281320 CTCTGTAGACTCCACCTCTGGGG + Intronic
1111765036 13:92517229-92517251 CTCTGTAGACTCCACCTCTGGGG + Intronic
1111967051 13:94871315-94871337 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1112087506 13:96047019-96047041 CTCTGTAGACTCCACCTCTGGGG + Intronic
1112178688 13:97054719-97054741 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1112484245 13:99805551-99805573 CTCAGGATACTAAAGCTGGGAGG + Intronic
1112612539 13:100969789-100969811 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1112663796 13:101544644-101544666 CTCTGTAGACTCCACCTCTGGGG - Intronic
1112790793 13:103000411-103000433 CTGTGGAGAATAAAGTTCTGTGG + Intergenic
1112835379 13:103508092-103508114 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1113488129 13:110670109-110670131 CTCTGTAGACTCCACCTCTGGGG + Intronic
1114240297 14:20860649-20860671 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1114425739 14:22621206-22621228 CTCTGTAGACTCCACCTCTGAGG - Intergenic
1114432828 14:22677393-22677415 TTCTGGAGACTTCATCTCTGAGG + Intergenic
1114432864 14:22677630-22677652 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1114581258 14:23762299-23762321 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1114681923 14:24491965-24491987 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1114691553 14:24587276-24587298 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1114923459 14:27363107-27363129 CTCTGTAGACTCCAACTCTGGGG - Intergenic
1115077973 14:29414282-29414304 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1115107224 14:29775696-29775718 CTCTGTAGACTCCATCTCTGGGG + Intronic
1115135888 14:30107477-30107499 CTCTGTAGACTCCACCTCTGGGG + Intronic
1115362324 14:32517745-32517767 CTCTGTAGACTCCACCTCTGTGG + Intronic
1115477107 14:33826011-33826033 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1115643597 14:35351474-35351496 CACTGCAGACTCAAACTCTGAGG + Intergenic
1115743510 14:36412249-36412271 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1115869706 14:37786216-37786238 CTCTGTAGACTCCACCTCTGTGG - Intronic
1116011676 14:39359142-39359164 CTCTGTAGACTCCACCTCTGGGG - Intronic
1116198303 14:41757347-41757369 CTCTGTAGACTTCACCTCTGGGG - Intronic
1116284896 14:42958702-42958724 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1116489151 14:45486196-45486218 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1116515195 14:45796301-45796323 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1116634482 14:47377763-47377785 CTCTGTAGACTCTAGATCTGGGG + Intronic
1116666436 14:47781602-47781624 CTCTGGAAACTAAAGTTCTGAGG - Intergenic
1116711323 14:48371846-48371868 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1117079484 14:52136679-52136701 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1117104571 14:52384713-52384735 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1117115135 14:52503128-52503150 CTCTGTAGACTCCACCTCTGGGG + Intronic
1117170062 14:53085168-53085190 CTCTGTAGACTCCACCTCTGGGG + Intronic
1117193742 14:53318577-53318599 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1117576694 14:57106080-57106102 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1117797599 14:59409986-59410008 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1117807919 14:59513717-59513739 CTCTGTAGACTCCACCTCTGGGG + Intronic
1117852707 14:59991863-59991885 CTCTGTAGACTCCACCTCTGGGG + Intronic
1117856751 14:60042340-60042362 CTCTGTAGACTCCACCTCTGGGG - Intronic
1117952571 14:61097857-61097879 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1118040700 14:61913244-61913266 TTCTGGGCACTACAGCTCTGGGG - Intergenic
1118146634 14:63144573-63144595 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1118415181 14:65528139-65528161 CTCTGCAGACTCCACCTCTGTGG - Intronic
1118483333 14:66189320-66189342 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1118938478 14:70310666-70310688 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1119093541 14:71807188-71807210 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1119699655 14:76744815-76744837 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1120090562 14:80327966-80327988 CTCAGGACAGTTAAGCTCTGGGG - Intronic
1120709743 14:87781042-87781064 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1120778238 14:88461299-88461321 CTCTGTAGACTCCACCTCTGGGG - Intronic
1121213982 14:92233030-92233052 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1121298904 14:92853360-92853382 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1123127771 14:105961709-105961731 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1123158566 14:106254436-106254458 CTCTGGATACTAGGGCTTTGTGG + Intergenic
1123397201 15:19948754-19948776 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1123408235 15:20037522-20037544 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1123517558 15:21044173-21044195 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1123822388 15:24043731-24043753 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1123877589 15:24639522-24639544 CTCTGTAGACTCTACCTCTGGGG - Intergenic
1124067272 15:26355878-26355900 CACTGGAGAGTCAAGGTCTGCGG + Intergenic
1124502901 15:30245837-30245859 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1124513385 15:30346801-30346823 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1124569972 15:30854196-30854218 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1124669248 15:31623355-31623377 CTCTGTAGACTCCACCTCTGGGG - Intronic
1124729537 15:32183964-32183986 CTCTGTAGGCTACACCTCTGGGG + Intergenic
1124740660 15:32292812-32292834 CTCTGTAGGCTACACCTCTGGGG + Intergenic
1125055679 15:35356873-35356895 CTCTGTAGACTCCACCTCTGGGG - Intronic
1125330938 15:38581251-38581273 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1125779470 15:42251846-42251868 CTCTGTAGACTCCACCTCTGGGG - Intronic
1125837400 15:42764652-42764674 CTCTGTAGACTCCACCTCTGGGG + Intronic
1126468940 15:48986251-48986273 CTCTGGAGATAAAAGAACTGGGG + Intergenic
1126542478 15:49838809-49838831 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1126889003 15:53183775-53183797 CTCTGTAGACTCCACCTCTGAGG + Intergenic
1126996442 15:54450361-54450383 CTCTGTAGACTCCACCTCTGGGG - Intronic
1127021125 15:54749789-54749811 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1127189577 15:56515506-56515528 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1127355388 15:58193937-58193959 CTCTGTAGACTCCACCTCTGGGG + Intronic
1127494826 15:59500403-59500425 CTCAGGAGACTAAAGTTGGGGGG - Intronic
1127971161 15:63962941-63962963 CTCTGTAGACTCCACCTCTGGGG - Intronic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1128311078 15:66632109-66632131 TTCTGGGGACTAAACCCCTGGGG - Intronic
1128339809 15:66813603-66813625 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1128677506 15:69622610-69622632 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1128696610 15:69769537-69769559 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1129009971 15:72407002-72407024 CTCTGGAGGCCAAAGAGCTGGGG + Intronic
1129162842 15:73756487-73756509 CTCCGTAGACTAAAGCACTAGGG - Intergenic
1129166621 15:73781997-73782019 CACTGCAGACTCAACCTCTGGGG - Intergenic
1129548789 15:76426203-76426225 CTCTGTAGACTCCACCTCTGGGG - Intronic
1130364496 15:83222067-83222089 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1130444053 15:83982314-83982336 CTCTGGACACTGAGGATCTGCGG - Exonic
1130450136 15:84042940-84042962 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1130645001 15:85717075-85717097 CACTGGAGACTCAAATTCTGAGG - Intronic
1130703649 15:86211437-86211459 CTCTGTAGACCCCAGCTCTGGGG - Intronic
1130778061 15:87006282-87006304 CTCTGTAGACTCCACCTCTGGGG - Intronic
1130798387 15:87235340-87235362 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1130800229 15:87255331-87255353 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1131363324 15:91815241-91815263 CTCAGGAGAGGATAGCTCTGAGG - Intergenic
1131551103 15:93357726-93357748 CTCTGCAGTCTCAAGCTCTGTGG + Intergenic
1131555551 15:93395546-93395568 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1131595382 15:93792767-93792789 CTCTGTAGACTGCACCTCTGGGG + Intergenic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1132144556 15:99421221-99421243 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1132218330 15:100084393-100084415 CTCTGTAGACTCCACCTCTGGGG + Intronic
1132986947 16:2772217-2772239 CTGTGGAGACTACAGCCGTGTGG - Intronic
1133432481 16:5750457-5750479 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1134897989 16:17906947-17906969 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1135121829 16:19772925-19772947 CACTGCAGCCTAAACCTCTGGGG - Intronic
1135301738 16:21334634-21334656 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1135613851 16:23892448-23892470 CCCTTAAGATTAAAGCTCTGGGG - Intronic
1136600532 16:31284317-31284339 CTCTGTAGACTCCACCTCTGGGG - Intronic
1136652855 16:31687743-31687765 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1136779903 16:32891375-32891397 CTCTACAGACTCCAGCTCTGTGG + Intergenic
1136890709 16:33970145-33970167 CTCTACAGACTCCAGCTCTGTGG - Intergenic
1137051872 16:35721415-35721437 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1137074414 16:35944241-35944263 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1137317977 16:47347595-47347617 CTCTGTAGACTCCACCTCTGGGG + Intronic
1137461486 16:48668238-48668260 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1137471101 16:48759235-48759257 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1137503445 16:49029217-49029239 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1137525149 16:49228617-49228639 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1137877697 16:52013203-52013225 CTCTGTAGACTCCACCTCTGGGG - Intronic
1138007287 16:53349980-53350002 CTCTGCAGACTCCACCTCTGGGG - Intergenic
1138260399 16:55615964-55615986 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1138665796 16:58567217-58567239 CTCTGCATCCTAAAGCGCTGGGG - Intronic
1138692867 16:58785462-58785484 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1138702472 16:58878715-58878737 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1138713189 16:58992846-58992868 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1138785059 16:59836287-59836309 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1138874793 16:60936474-60936496 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1139105286 16:63820217-63820239 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1139282052 16:65779462-65779484 TTCTGGAGTCTAAAGATCTGGGG + Intergenic
1139375982 16:66496519-66496541 CTCTGTAGACTCCACCTCTGGGG + Intronic
1140054121 16:71510773-71510795 CTCTGTAGACTCCACCTCTGAGG - Intronic
1140539224 16:75740418-75740440 CTCTGTAGACTCCACCTCTGGGG - Intronic
1140583142 16:76254898-76254920 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1140984147 16:80141903-80141925 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1141235131 16:82209351-82209373 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1141930679 16:87200459-87200481 CTCAGGAGAGCAAAGATCTGGGG - Intronic
1202998857 16_KI270728v1_random:144465-144487 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1203082323 16_KI270728v1_random:1153463-1153485 CTCTACAGACTCCAGCTCTGTGG + Intergenic
1142538670 17:639990-640012 CTCTGTAGACTCCACCTCTGGGG - Intronic
1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG + Intronic
1143257611 17:5573367-5573389 CTCTGTAGACTCCACCTCTGGGG + Intronic
1143422724 17:6808057-6808079 CTCTGTAGACTCCACCTCTGGGG - Intronic
1143448168 17:7020765-7020787 GACAGGAGACTAAAGTTCTGGGG - Intergenic
1144244585 17:13350180-13350202 CTCTGGAAACAAGAGCTCTGGGG + Intergenic
1144556971 17:16290754-16290776 CACTGGAGCCTTAACCTCTGGGG + Intronic
1145219856 17:21079460-21079482 CTCTGGAAAAGAAAGATCTGAGG + Intergenic
1145396739 17:22502528-22502550 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1145738360 17:27249729-27249751 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1146298504 17:31670513-31670535 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1146530312 17:33602896-33602918 CTCTGGAGGATAAAACACTGAGG - Intronic
1146561943 17:33877659-33877681 CTCTGTAGACTCCACCTCTGGGG + Intronic
1147664119 17:42134932-42134954 CTCTGGACACTACAGGTCAGTGG + Intronic
1147754434 17:42759292-42759314 CTCTGCAGCCTCAACCTCTGGGG + Intronic
1147979612 17:44266447-44266469 CTCTGGATTCTGCAGCTCTGAGG - Intronic
1148395949 17:47308411-47308433 CCCTTGAGTATAAAGCTCTGGGG - Intronic
1149733539 17:58970763-58970785 CTCAAGAGACTGGAGCTCTGAGG - Intronic
1151428279 17:74045444-74045466 CTCTGGAGGCGAGTGCTCTGGGG - Intergenic
1151498869 17:74476060-74476082 CTCTGGACACCAAAGCTTGGAGG - Intronic
1151513140 17:74574367-74574389 CTCTGGCGACTTAGGCACTGAGG + Intergenic
1151803094 17:76389168-76389190 CTCTGGAGACTACAGCTGCTGGG + Intergenic
1152203075 17:78958429-78958451 CTCTGGAGACCAGAAGTCTGAGG - Intergenic
1152236280 17:79140649-79140671 GCTAGGAGACTAAAGCTCTGTGG - Intronic
1152861906 17:82701255-82701277 CTCTGGAGACTAGGCCTCTGTGG + Intergenic
1153135361 18:1911412-1911434 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1153181630 18:2441676-2441698 CTCTGGAAACCGAAGCTCAGTGG - Intergenic
1153221434 18:2865800-2865822 CTCTGTAGACTGCACCTCTGGGG - Intronic
1153790911 18:8578809-8578831 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1154184688 18:12172698-12172720 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1154397666 18:14006398-14006420 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1154401549 18:14043178-14043200 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1154403488 18:14065523-14065545 CTCTGTAGACTCCACCTCTGGGG + Intronic
1154413963 18:14163190-14163212 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1155020083 18:21888536-21888558 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1155095279 18:22549447-22549469 CTGTGGAGACTAAAGATAGGAGG - Intergenic
1155126805 18:22885921-22885943 CTCTGTAGACTCCACCTCTGGGG + Intronic
1155223050 18:23702716-23702738 CTCTGGTGCCCAAATCTCTGAGG + Intronic
1155476856 18:26244167-26244189 CTCTGTAGACTCCACCTCTGGGG - Intronic
1156186637 18:34671012-34671034 CTCTGTAGACTCCACCTCTGGGG - Intronic
1156295967 18:35791147-35791169 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1156308142 18:35898016-35898038 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1156433459 18:37100571-37100593 CTCTGTAGACTCCACCTCTGGGG + Intronic
1156443824 18:37219425-37219447 CTCTGTAGACTCCACCTCTGGGG - Intronic
1156532565 18:37832376-37832398 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1157061806 18:44300409-44300431 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1157205540 18:45695005-45695027 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1157561494 18:48649497-48649519 CTCTGTAGACTCCACCTCTGGGG + Intronic
1157720017 18:49916449-49916471 CCCTGGCTACTAAAGCCCTGTGG - Intronic
1158054300 18:53260793-53260815 CTCTGTAGACTCCACCTCTGAGG - Intronic
1158100205 18:53821436-53821458 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1158101379 18:53833955-53833977 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1158102925 18:53851068-53851090 CTCTGGGGATTAAGACTCTGTGG - Intergenic
1158145690 18:54309678-54309700 CTCTGTAGACTCCATCTCTGAGG - Intronic
1158217427 18:55114534-55114556 CTTTGGAGACTAAGCCACTGAGG - Intergenic
1159126619 18:64231917-64231939 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1159143492 18:64424807-64424829 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1159364749 18:67451206-67451228 CTCTGCAGACTTCACCTCTGGGG - Intergenic
1159592306 18:70348535-70348557 CTCTGTAGACTCCACCTCTGGGG - Intronic
1159629815 18:70736387-70736409 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1160285375 18:77537741-77537763 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1160337843 18:78058745-78058767 CTCTGCAGCCTAAAACTCTTGGG - Intergenic
1160632170 18:80254336-80254358 CTCAGGAGAGTGATGCTCTGAGG + Intergenic
1161052045 19:2169250-2169272 CTCAGGACACTCAAGCTCAGAGG - Intronic
1162245678 19:9398227-9398249 CTCTGTAGACTCCACCTCTGCGG + Intergenic
1162658522 19:12151285-12151307 CACTGCAGACTCAACCTCTGGGG + Intronic
1163171243 19:15532717-15532739 CTCAGGAAACTGATGCTCTGAGG - Intronic
1163858536 19:19726676-19726698 CTCTGTAGACTCCACCTCTGGGG - Intronic
1163881127 19:19923507-19923529 CTCTGTAGACTCCACCTCTGGGG - Intronic
1163940031 19:20482967-20482989 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1163974908 19:20841541-20841563 CTCTGTAGGCTCAACCTCTGGGG + Intronic
1164111217 19:22161116-22161138 CTCTGTAGACTACACCTCTGGGG - Intergenic
1164265624 19:23613947-23613969 CTCTGTAGACTCCACCTCTGGGG + Intronic
1164367567 19:27602552-27602574 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1164394836 19:27853219-27853241 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1164410173 19:27996020-27996042 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1164568400 19:29348886-29348908 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1164688626 19:30190256-30190278 CTCTGTAGACTTCATCTCTGGGG - Intergenic
1164788924 19:30959603-30959625 CTCTGGAGATCAAAGCCCTGGGG - Intergenic
1165197541 19:34116655-34116677 CTCTGGAGGCTAGAGCTTGGGGG - Intergenic
1165365813 19:35363926-35363948 CTCTGGGGCCTCAAGATCTGAGG + Intergenic
1165973073 19:39649711-39649733 CTCTGTAGACTCCATCTCTGGGG + Intergenic
1166396278 19:42443590-42443612 CTCTGAGACCTAAAGCTCTGGGG - Intergenic
1166478308 19:43148272-43148294 CTCTCGAGGATAAAGATCTGAGG - Intronic
1166880470 19:45926865-45926887 TTCTGGAGAGTAAAGCTGAGTGG + Intergenic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
925117008 2:1388300-1388322 CTCTGTAGACTCCACCTCTGGGG - Intronic
925814319 2:7732787-7732809 CGCTGGACACCAAAGCTCAGGGG - Intergenic
926074712 2:9932771-9932793 CTCTGTAAACTACACCTCTGGGG - Intronic
926917702 2:17909048-17909070 CTCTGTAGACTCCACCTCTGGGG - Intronic
926926044 2:17988710-17988732 CTCTGTAGACTCCACCTCTGGGG - Intronic
927148125 2:20180185-20180207 GTCTGGAGTCTGATGCTCTGTGG - Intergenic
927202873 2:20589361-20589383 CTCTTGACACTAAACCCCTGTGG + Intronic
927302040 2:21526558-21526580 CTCTGTAGACTCCACCTCTGGGG - Intergenic
927634785 2:24805914-24805936 CTCTGTAGACTCCACCTCTGGGG - Intronic
928091166 2:28375976-28375998 GTGTGGAGACTGCAGCTCTGGGG + Intergenic
928195940 2:29216457-29216479 CTGTGGGGACTAAATCTCTCTGG + Intronic
928522696 2:32106051-32106073 CTCTGTAGACTCCACCTCTGGGG - Intronic
928759131 2:34560901-34560923 CTCTGTAGACTCCACCTCTGGGG - Intergenic
928795383 2:35012983-35013005 CTCTGTAGACTCCACCTCTGGGG + Intergenic
928818248 2:35325344-35325366 CTCTGTAGACTCCACCTCTGGGG - Intergenic
928852550 2:35766986-35767008 CTCTGTAGACTCCACCTCTGGGG + Intergenic
929038890 2:37723688-37723710 CTCTGTAGACTCCACCTCTGGGG + Intronic
929069003 2:38010301-38010323 CTCTGTAGACTCCACCTCTGGGG - Intronic
929381457 2:41359011-41359033 CTCTGTAGACTCCAACTCTGGGG + Intergenic
929843923 2:45501840-45501862 CTCTGTAGACTCCACCTCTGGGG + Intronic
930268948 2:49233260-49233282 CTCTGTAGACTCCACCTCTGGGG - Intergenic
930448179 2:51500914-51500936 CTCTGTAGACTCCACCTCTGGGG - Intergenic
930516950 2:52420253-52420275 CTCTGTAGACTCCACCTCTGGGG + Intergenic
930686399 2:54313031-54313053 GTCTGGAGCCTTGAGCTCTGTGG - Intergenic
930734098 2:54757598-54757620 CTCTGGAGATTTACTCTCTGGGG - Intronic
930868145 2:56142727-56142749 CTCTGTAGACTCCACCTCTGGGG - Intergenic
930941805 2:57022710-57022732 CTCTGTAGACTCCACCTCTGGGG + Intergenic
931204636 2:60135804-60135826 CTCTGTAGACTCTACCTCTGGGG - Intergenic
931469200 2:62521120-62521142 CTCTGCAGACTCCACCTCTGGGG - Intergenic
931475787 2:62586438-62586460 CTCTGTAGACTCCACCTCTGGGG - Intergenic
931477653 2:62605773-62605795 CTCTGTAGACTCCACCTCTGGGG + Intergenic
931558502 2:63531238-63531260 CTCTGTAGACTCCACCTCTGGGG + Intronic
931860784 2:66352468-66352490 CTCTGTAGACTCCACCTCTGAGG - Intergenic
931986157 2:67744563-67744585 CTCTGTAGACTCCACCTCTGGGG - Intergenic
932520246 2:72404260-72404282 CTCTGTAGACTCCACCTCTGGGG + Intronic
932649403 2:73538935-73538957 CTCTGTAGACTCCACCTCTGGGG + Intronic
933202458 2:79466429-79466451 CTCTGTAGACTCCACCTCTGGGG + Intronic
933269253 2:80215852-80215874 CTCTGTAGACTCCACCTCTGGGG - Intronic
933593907 2:84262906-84262928 CTCTGTAGACTCCACCTCTGGGG + Intergenic
933618624 2:84511163-84511185 CTCTGTAGACTCCACCTCTGGGG - Intergenic
933631348 2:84662653-84662675 CTCTGTAGACTCCACCTCTGGGG + Intronic
934997464 2:98978357-98978379 CTCTGTAGACTCCACCTCTGGGG + Intergenic
934999682 2:99001019-99001041 CTCTGTAGACTTCACCTCTGGGG + Intronic
935118245 2:100157250-100157272 CTCTGTAGACTCCACCTCTGGGG - Intergenic
935369009 2:102324902-102324924 CTCTGTAGACTGCACCTCTGGGG + Intronic
935877883 2:107531711-107531733 CACTGGAGACTCATGGTCTGGGG - Intergenic
935938107 2:108208724-108208746 CTCTGTAGACTCCACCTCTGGGG - Intergenic
936142661 2:109953475-109953497 CTCTGTAGACTCCACCTCTGGGG + Intergenic
936179349 2:110251440-110251462 CTCTGTAGACTCCACCTCTGGGG + Intergenic
936202027 2:110417992-110418014 CTCTGTAGACTCCACCTCTGGGG - Intronic
936229481 2:110687512-110687534 CTCTGAACACCAAAGCTCAGTGG - Intergenic
936823561 2:116553319-116553341 CTCTGCAGACTCCACCTCTGGGG + Intergenic
936859654 2:117001664-117001686 CTCTGTAGACTCCACCTCTGGGG + Intergenic
936873064 2:117156562-117156584 CTCTGTAGGCTACACCTCTGGGG + Intergenic
937186750 2:120051245-120051267 CTCTGTAGACTCCACCTCTGGGG - Intronic
937245232 2:120488205-120488227 CTCTGGGGACTAAGGGTTTGAGG - Intergenic
937507264 2:122551242-122551264 CTCTGTAGACTCCACCTCTGGGG + Intergenic
937606162 2:123804170-123804192 CTCTGTAGACTCCATCTCTGGGG - Intergenic
937632931 2:124123454-124123476 CTCTGTAGACTCCACCTCTGGGG + Intronic
937809445 2:126183508-126183530 CTCTGTAGGCTACACCTCTGGGG - Intergenic
937920627 2:127127030-127127052 GTCTGGACACTGAAGCTCAGTGG + Intergenic
938147574 2:128849495-128849517 CTCTGTAGACTCCACCTCTGGGG + Intergenic
938862226 2:135381401-135381423 CTCTGTAGACTCCACCTCTGTGG + Intronic
938975088 2:136469216-136469238 CTCTGTTGACTCCAGCTCTGGGG + Intergenic
939594268 2:144104658-144104680 CTCTGTAGACTCCACCTCTGGGG + Intronic
939730860 2:145782908-145782930 CTCTGTAGACTCCACCTCTGGGG + Intergenic
939893694 2:147767057-147767079 CTCTGTAGACTCCACCTCTGGGG + Intergenic
940067209 2:149643463-149643485 CTCTGTAGACTCCACCTCTGGGG - Intergenic
940095190 2:149966270-149966292 CTCTGTAGACTCCACCTCTGGGG + Intergenic
940257241 2:151743871-151743893 CTCTGTAGACTCCACCTCTGGGG + Intergenic
940417438 2:153439409-153439431 CTCTGTAGACTCCACCTCTGGGG - Intergenic
940644415 2:156375852-156375874 CTCTGTAGACTCCACCTCTGCGG - Intergenic
940803306 2:158156656-158156678 CTGTGGAGAGTAAAGCCATGTGG - Intergenic
940827887 2:158434020-158434042 CTCTGTAGACTCCACCTCTGGGG + Intronic
941550810 2:166913195-166913217 CTCTGTAGACTCCACCTCTGGGG - Intronic
941623945 2:167809874-167809896 CTCTGTAGACTCCACCTCTGGGG - Intergenic
941971423 2:171355558-171355580 CTCTGTAGACTCCACCTCTGGGG - Intronic
942107628 2:172648883-172648905 CTCTGTAGACTCCACCTCTGGGG + Intergenic
942434667 2:175958105-175958127 CTCTGTAGACTCCACCTCTGGGG + Intronic
942753599 2:179315026-179315048 CTCTGTAGACTCCACCTCTGGGG + Intergenic
942790696 2:179757552-179757574 CTCTGTAGACTCCACCTCTGGGG - Intronic
942854760 2:180532186-180532208 CTCTGTAGACTCCAACTCTGGGG - Intergenic
942859396 2:180591199-180591221 CTCTGTAGACTTCACCTCTGGGG - Intergenic
943125316 2:183789160-183789182 CTCTGTAGACTCCACCTCTGGGG + Intergenic
943299983 2:186186470-186186492 CTCTGTAGACTCCATCTCTGGGG - Intergenic
943440255 2:187918778-187918800 CTCTGATGGCTAGAGCTCTGAGG + Intergenic
943628489 2:190224305-190224327 CTCTGTAGACTCCACCTCTGGGG + Intronic
943935017 2:193904412-193904434 CTCTGTAGACTCCACCTCTGGGG + Intergenic
943987281 2:194639293-194639315 CTCTGTAGACTCCACCTCTGGGG + Intergenic
944196818 2:197062869-197062891 CTCTGTAGACTCCACCTCTGGGG + Intronic
944382373 2:199126348-199126370 GCGTGCAGACTAAAGCTCTGAGG - Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
944599749 2:201291079-201291101 CTCTGTAGACTCCACCTCTGGGG + Intronic
944612978 2:201430419-201430441 CTCTGTAGACTCCACCTCTGGGG - Intronic
944629871 2:201613101-201613123 CTCTGTAGACTCCACCTCTGGGG + Intronic
945273206 2:207962300-207962322 CTCAGGACACTGAAGCTCAGAGG + Intronic
945343525 2:208685956-208685978 CTCTGTAGACTCCACCTCTGGGG - Intronic
945481545 2:210351159-210351181 CTCTGTAGACTCCACCTCTGTGG + Intergenic
945495825 2:210505938-210505960 CTCTGTAGACTCCACCTCTGGGG + Intronic
945776665 2:214114430-214114452 CTCTATAGACTCAACCTCTGTGG - Intronic
946205856 2:218108158-218108180 CTCTGTAGACTCCACCTCTGGGG - Intergenic
946513651 2:220387818-220387840 CTCTGTAGACTCCACCTCTGGGG - Intergenic
947056268 2:226107789-226107811 CTCTGTAGACTCCACCTCTGGGG + Intergenic
948025904 2:234775998-234776020 CTCTGTAGACTCCACCTCTGAGG + Intergenic
948419640 2:237849041-237849063 CTCTGTAGACTCCACCTCTGTGG - Intergenic
948541781 2:238696459-238696481 ATCCGGAGAACAAAGCTCTGTGG + Intergenic
948900960 2:240956690-240956712 CTCTGGAGAGGAGGGCTCTGGGG + Intronic
1168830877 20:844769-844791 CTCCGCAGACTAAAGCCCTCGGG + Exonic
1169041800 20:2501363-2501385 CTCTGTAGACTCCACCTCTGGGG + Intronic
1169659045 20:7958125-7958147 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1170707749 20:18760825-18760847 CTCTGTAGACTCCACCTCTGGGG - Intronic
1170719797 20:18866802-18866824 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1170752820 20:19167275-19167297 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1170958927 20:21007657-21007679 GACTGGAGACTAGAGCTCTGGGG - Intergenic
1171075140 20:22115167-22115189 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1171434119 20:25105781-25105803 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1171454645 20:25261029-25261051 CTCTGTAGACTCCACCTCTGGGG + Intronic
1171496375 20:25559043-25559065 CTCTTGAGACTGAAGCTCACAGG - Intronic
1171819123 20:29817262-29817284 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1172873716 20:38151567-38151589 CTTTGGAAACGAAAGCCCTGAGG + Intronic
1173301371 20:41806854-41806876 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1173543827 20:43876727-43876749 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1173604991 20:44325493-44325515 CACTGCAGCCTCAAGCTCTGGGG - Intergenic
1173770463 20:45651986-45652008 CTCTGTAGACTCCACCTCTGGGG + Intronic
1174485082 20:50855866-50855888 CTCTGGAGAATAAAACTCACAGG + Intronic
1176350029 21:5785676-5785698 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1176356843 21:5906260-5906282 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1176544350 21:8183746-8183768 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1176563301 21:8366791-8366813 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1176743713 21:10631625-10631647 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1176859065 21:13995059-13995081 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1177132167 21:17271842-17271864 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1177702724 21:24659402-24659424 ATCTAAAGGCTAAAGCTCTGGGG - Intergenic
1178027541 21:28485301-28485323 CTCTTGACAATAAAGCTTTGAGG - Intergenic
1178044431 21:28677448-28677470 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1178345153 21:31819814-31819836 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1178903591 21:36617072-36617094 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1179300979 21:40109968-40109990 CTCTGTAGACTCCACCTCTGGGG + Intronic
1180181351 21:46119949-46119971 CTCTGGAGAGTGAGGCCCTGGGG - Intronic
1180306581 22:11131475-11131497 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1180545099 22:16493658-16493680 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1180640968 22:17299234-17299256 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1181341979 22:22188381-22188403 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1182162185 22:28133761-28133783 CTCTGTAGACTCCACCTCTGGGG + Intronic
1182169228 22:28209687-28209709 CTCTGCAGACTCCACCTCTGGGG + Intronic
1182180205 22:28339481-28339503 CTCTGTAGACTCCACCTCTGGGG - Intronic
1182511039 22:30820607-30820629 ATGAGGAGACTAAGGCTCTGAGG - Intronic
1182789845 22:32941997-32942019 CTCTGTAGACTCCACCTCTGGGG + Intronic
1182947325 22:34335633-34335655 CTGTGAACACTAAAGCACTGGGG + Intergenic
1182996477 22:34817326-34817348 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1183039527 22:35166206-35166228 CTCTGCAGACTTCACCTCTGGGG + Intergenic
1184886727 22:47351118-47351140 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1185019618 22:48366615-48366637 CTTTGGAGCCTAAGCCTCTGAGG + Intergenic
1185045587 22:48527165-48527187 CTCTGGAGGCTGTGGCTCTGGGG + Intronic
1203249219 22_KI270733v1_random:99984-100006 CTCTGTAGACTCCACCTCTGGGG + Intergenic
949532115 3:4966273-4966295 CTCTGTAGACTCCACCTCTGGGG + Intergenic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
949912349 3:8922467-8922489 CTCTGTAGACTCCACCTCTGGGG + Intronic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
950147075 3:10657648-10657670 CTCTGTAGACTCCACCTCTGGGG + Intronic
950597194 3:13995303-13995325 CTCTGTAGACTCCACCTCTGGGG - Intronic
950862721 3:16164440-16164462 CTCTGTAGACTCCACCTCTGGGG - Intergenic
951042675 3:18005278-18005300 CTCTGTAGACTCCACCTCTGGGG - Intronic
951274229 3:20665685-20665707 CTCTGGAGCAGGAAGCTCTGAGG - Intergenic
951286586 3:20820983-20821005 CTCTGTAGACTCTACCTCTGGGG - Intergenic
951330774 3:21365390-21365412 CTCTGTAGACTCCACCTCTGGGG + Intergenic
951368326 3:21812746-21812768 CTCTGTAGACTCCACCTCTGGGG + Intronic
951440370 3:22715737-22715759 CTATGGAGAGTAAAGCAATGAGG - Intergenic
951584792 3:24204058-24204080 CTCTGTAGACTCTACCTCTGGGG + Intronic
951617771 3:24567251-24567273 CTCTGTAGACTCCATCTCTGCGG + Intergenic
951672910 3:25205015-25205037 CTCTGTAGACTCCACCTCTGGGG - Intronic
951861959 3:27263407-27263429 CTCTGTAGACTCCACCTCTGGGG - Intronic
951964716 3:28369747-28369769 CTCTGTAGACTCCACCTCTGCGG - Intronic
952290575 3:32010992-32011014 CTCTGTAGACTCCACCTCTGGGG + Intronic
952437465 3:33286628-33286650 CTCTGTAGACTCCACCTCTGGGG - Intronic
952513969 3:34085307-34085329 CTCTGTAGACTTCACCTCTGGGG - Intergenic
952514974 3:34094610-34094632 CTCTGTAGACTCCATCTCTGGGG + Intergenic
952547195 3:34433327-34433349 CTCTGTAGACTCCACCTCTGGGG - Intergenic
952659175 3:35824128-35824150 CTCTGTAGACTCCACCTCTGGGG - Intergenic
952709465 3:36415259-36415281 CTCTGTAGACTCCACCTCTGGGG - Intronic
952837703 3:37618552-37618574 CTCTGTAGACTCCACCTCTGGGG - Intronic
953116201 3:39994589-39994611 CTCTGTAGACTCCACCTCTGGGG + Intronic
953145648 3:40271915-40271937 CTCTGTAGACTCCACCTCTGGGG + Intergenic
953305471 3:41824716-41824738 CTCTGTAGACTCCACCTCTGGGG + Intronic
953398150 3:42589385-42589407 CTCAGGGGAATAAAGCTCTAGGG + Intronic
953515993 3:43592148-43592170 CTCTGTAGACTCCACCTCTGGGG + Intronic
953524756 3:43679491-43679513 CTCTGTAGACTCCACCTCTGGGG + Intronic
953994632 3:47510320-47510342 CTCTGGAAAAAAAAGCACTGAGG + Intronic
954492680 3:50922146-50922168 CTCTGTAGACTCCACCTCTGCGG - Intronic
954500766 3:51012239-51012261 CTCTGTAGACTCCACCTCTGTGG - Intronic
954821637 3:53334186-53334208 CTCTGCAGCCTCAACCTCTGAGG - Intronic
954827975 3:53391667-53391689 CTCTGTAGACTCCACCTCTGGGG + Intergenic
954833712 3:53446339-53446361 CTCTGTAGACTCCACCTCTGGGG - Intergenic
955172587 3:56582005-56582027 CTCTGTAGACTCCACCTCTGGGG - Intronic
955404266 3:58615998-58616020 CAGTGGAGACAAAAGCTCTGAGG + Intronic
955423534 3:58764126-58764148 CTCTGTAGACTCCACCTCTGGGG - Intronic
955626419 3:60924109-60924131 CTCTGTAGACTCCACCTCTGGGG + Intronic
956048320 3:65220333-65220355 CTCTGTAGACTCCACCTCTGGGG - Intergenic
956207374 3:66769247-66769269 CTCTGTAGACTCCACCTCTGGGG - Intergenic
956394492 3:68810723-68810745 CTCTGCAGACTCCACCTCTGGGG + Intronic
956448099 3:69345387-69345409 CTCTGTAGACTCCATCTCTGGGG + Intronic
956477375 3:69636944-69636966 CTCTGTAGACTCCACCTCTGTGG - Intergenic
956569795 3:70681263-70681285 CTCTGTAGACTCCACCTCTGGGG - Intergenic
956589451 3:70898400-70898422 CTCTGTAGACTCCACCTCTGGGG - Intergenic
956795576 3:72715939-72715961 CTCTGTAGACTCCACCTCTGGGG - Intergenic
956941124 3:74162555-74162577 CTCTGTAGACTCCACCTCTGGGG - Intergenic
956993319 3:74794614-74794636 CTCTGTAGACTCCACCTCTGGGG + Intergenic
957565443 3:81878661-81878683 CTCTGTAGACTCCACCTCTGGGG + Intergenic
957604123 3:82375889-82375911 CTCTGGAGACTCCTCCTCTGGGG - Intergenic
957727546 3:84087174-84087196 CTCTGTAGACTCCACCTCTGGGG + Intergenic
957871332 3:86093501-86093523 CTCTGCAGACTCCACCTCTGCGG + Intergenic
957886730 3:86297571-86297593 CTCTGTAGACTCCACCTCTGGGG + Intergenic
958102738 3:89035049-89035071 CTCTGTAGACTCCACCTCTGGGG + Intergenic
958166604 3:89885016-89885038 CTCTGTAGACTCCACCTCTGGGG - Intergenic
958185133 3:90110581-90110603 CTCTGTAGACTCCACCTCTGGGG - Intergenic
958553574 3:95645569-95645591 CTCTGTAGACTCCACCTCTGGGG + Intergenic
958624488 3:96606927-96606949 CTCTGTAGACTCCACCTCTGGGG - Intergenic
958810944 3:98859276-98859298 CTCTGTAGACTCCACCTCTGGGG + Intronic
958944621 3:100349539-100349561 CTCTGAAGACATAAGCTCTGTGG - Intronic
959052797 3:101540775-101540797 CTCTGTAGACTCCACCTCTGGGG - Intergenic
959103512 3:102040460-102040482 CTCTGCAGACTCCACCTCTGGGG + Intergenic
959618024 3:108369863-108369885 CTCTGTAGACTCCACCTCTGGGG + Intronic
959642377 3:108656045-108656067 CTCTGTAGACTCCACCTCTGGGG + Intronic
959670521 3:108972032-108972054 CTCTGGAGACTTAAACTCTTTGG - Intronic
959723890 3:109522300-109522322 CTCTGTAGACTCCACCTCTGGGG + Intergenic
959730412 3:109594716-109594738 CACAGGAGACTTAAGCTCTTTGG + Intergenic
959953741 3:112211757-112211779 CTCTGTAGACTCCACCTCTGGGG + Intronic
959956033 3:112239047-112239069 CTCTGTAGACTCCACCTCTGGGG - Intronic
960276772 3:115738092-115738114 CTCTGAAGACTCCACCTCTGGGG - Intergenic
960612552 3:119568766-119568788 CTCTGTAGACTCCACCTCTGGGG - Intergenic
960730318 3:120719750-120719772 CTCTGTAGACTCCACCTCTGGGG + Intronic
960792778 3:121451877-121451899 CTCTGTAGACTCCACCTCTGGGG - Intronic
961291524 3:125850347-125850369 CTCTGTAGACTCCACCTCTGGGG + Intergenic
961419627 3:126791413-126791435 CTCTGTAGACTCCACCTCTGGGG - Intronic
962232948 3:133681751-133681773 CTCTGTAGACTCCACCTCTGGGG + Intergenic
962287687 3:134101653-134101675 CTCTGTAGACTCCACCTCTGGGG - Intronic
962666724 3:137661118-137661140 CTCTGTAGACTCCACCTCTGGGG + Intergenic
962690881 3:137897145-137897167 CTCTGTAGACTCCACCTCTGGGG + Intergenic
962699247 3:137980380-137980402 CTCTGTAGACTCCACCTCTGGGG + Intergenic
962752642 3:138445056-138445078 CTCTGGAATCAAAATCTCTGTGG + Intronic
962761407 3:138518233-138518255 CTCTGTAGACTCTAGCTCTAGGG + Intronic
962766996 3:138574487-138574509 CTCTGTAGACTCCACCTCTGGGG + Intronic
962834122 3:139172064-139172086 CTCTGTAGACTCCACCTCTGGGG - Intronic
963032052 3:140988107-140988129 CTCTGTAGACTCCACCTCTGGGG + Intergenic
963050701 3:141140920-141140942 CTCTGGAGGCTCCACCTCTGGGG - Intronic
963070457 3:141301122-141301144 CTCTGTAGACTCCACCTCTGGGG - Intergenic
963109072 3:141670445-141670467 CTCTGTAGACTTCACCTCTGGGG + Intergenic
963135548 3:141900335-141900357 CTCTGGACACTGAAGTTCAGTGG + Intronic
963191724 3:142480677-142480699 CTCTGTAGACTCCACCTCTGGGG - Intronic
963303182 3:143621166-143621188 CTCTGTAGACTCCACCTCTGGGG + Intronic
963306882 3:143662849-143662871 CTCTGTAGACTCCACCTCTGGGG + Intronic
963340156 3:144023572-144023594 CTCTGTAGACTCCACCTCTGGGG - Intronic
963387918 3:144620214-144620236 CTCTGTAGACTCCACCTCTGGGG - Intergenic
963620456 3:147599432-147599454 CTCTGTAGACTCCACCTCTGAGG - Intergenic
963714381 3:148786231-148786253 CTCTGTAGACTCCACCTCTGGGG - Intergenic
964175657 3:153823882-153823904 CTCTGTAGACTCCACCTCTGGGG + Intergenic
964214389 3:154263116-154263138 CTCTGTAGACTTCACCTCTGGGG + Intergenic
964243217 3:154619905-154619927 CTCTGTAGACTCCACCTCTGGGG + Intergenic
964588092 3:158329824-158329846 CTCTGTAGACTCCACCTCTGGGG - Intronic
964696249 3:159511058-159511080 CTCTGTAGACTCCACCTCTGGGG - Intronic
964860453 3:161195900-161195922 CTCTGTAGACTCCACCTCTGGGG - Intronic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965183206 3:165431129-165431151 TTCTGGATATTAAAGCTTTGTGG + Intergenic
965271099 3:166617974-166617996 CTCTGTAGACTCCACCTCTGGGG + Intergenic
965311105 3:167129889-167129911 CTCTGTAGACTCCACCTCTGGGG + Intergenic
965393071 3:168128802-168128824 CTCTGTAGACTCCACCTCTGGGG + Intergenic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
965818922 3:172665581-172665603 CTCTGTAGACTCCACCTCTGGGG - Intronic
965886379 3:173451650-173451672 CTCTGCAGACTCCACCTCTGGGG - Intronic
965973255 3:174588967-174588989 CTCTGTAGACTCCACCTCTGGGG - Intronic
966494150 3:180560443-180560465 CTCTGTAGACTCCACCTCTGGGG + Intergenic
966966139 3:184996391-184996413 CTCTGGTGACCGAAGCTCTCAGG - Exonic
967199270 3:187057893-187057915 CTCTGTAGACTCCACCTCTGGGG - Intronic
967240907 3:187438807-187438829 GTTTGGAGACAAAAGTTCTGGGG - Intergenic
967361492 3:188636577-188636599 CTCTGTAGGCTCCAGCTCTGGGG + Intronic
967569859 3:191016036-191016058 CTCTGTAGACTCCACCTCTGCGG - Intergenic
967756884 3:193179906-193179928 CTCTGTAGACTCCACCTCTGTGG + Intergenic
968208640 3:196827224-196827246 CTCTGGATTCTGAAGTTCTGGGG - Exonic
968376014 4:42145-42167 CTCTGTAGACTCCACCTCTGGGG - Intergenic
968388824 4:171434-171456 CTCTGTAGACTCCACCTCTGGGG - Intergenic
968657984 4:1786853-1786875 CTCTGGGGACTCCAGCTCTGGGG - Intergenic
969005770 4:4019148-4019170 CTCTGTAGACTCCATCTCTGGGG - Intergenic
969807179 4:9618145-9618167 CTCTGTAGACTCCACCTCTGGGG + Intergenic
970643268 4:18090770-18090792 CTCTGTAGACTCCACCTCTGGGG + Intergenic
970671507 4:18401871-18401893 CTATGGGGACTGAAACTCTGTGG + Intergenic
970862660 4:20721915-20721937 CTCTGTAGACTCCACCTCTGGGG - Intronic
970972171 4:21997178-21997200 CTCTGTAGACTCCACCTCTGGGG + Intergenic
970983006 4:22123547-22123569 CTCTGTAGACTCCACCTCTGGGG + Intergenic
971437278 4:26640944-26640966 CTCTGTAGACTCCATCTCTGGGG + Intronic
971621299 4:28857103-28857125 CTCTGTAGACTCCACCTCTGGGG - Intergenic
972373441 4:38448382-38448404 CTCTGTAGACTCCACCTCTGGGG - Intergenic
972376549 4:38477020-38477042 CTCTGTAGACTCCACCTCTGGGG + Intergenic
972416725 4:38847834-38847856 CTCTGTAGACTCCACCTCTGGGG + Intronic
972528216 4:39937067-39937089 CTGTGAACACTAAAGCTCAGGGG - Intronic
972692942 4:41417501-41417523 CTCTGGAGACTAGATTTCTGAGG + Intronic
972704223 4:41525864-41525886 CTCTGGACCCTGGAGCTCTGGGG + Intronic
972917326 4:43897093-43897115 CTCTGTAGACTCCACCTCTGGGG - Intergenic
972972407 4:44593632-44593654 CTCTGTAGACTCCACCTCTGGGG + Intergenic
973311215 4:48711610-48711632 CTCTGTAGACTCCACCTCTGGGG + Intronic
973542929 4:51952818-51952840 CTCTGTAGACTCCACCTCTGGGG - Intergenic
973564516 4:52170786-52170808 CTCTGTAGACTCCACCTCTGGGG - Intergenic
973683016 4:53340511-53340533 CTCTGTAGACTCCACCTCTGGGG + Intronic
973874762 4:55206440-55206462 CTCTGTAGACTCCACCTCTGAGG + Intergenic
974023701 4:56713165-56713187 CTCTGTAGACTCCACCTCTGGGG + Intergenic
974112090 4:57537434-57537456 CTCTGTAGACTCCACCTCTGGGG - Intergenic
974119767 4:57624729-57624751 CTCTGTAGACTCCACCTCTGGGG - Intergenic
974127552 4:57714636-57714658 CTCTGTAGACTCCACCTCTGCGG + Intergenic
974426036 4:61744258-61744280 CTCTGTAGACTCCACCTCTGGGG + Intronic
974427549 4:61760248-61760270 CTCTGTAGACTCCACCTCTGGGG - Intronic
974536516 4:63182283-63182305 CTCTGTAGACTCCACCTCTGGGG + Intergenic
974547707 4:63334136-63334158 CTCTGAAGACTCCACCTCTGGGG + Intergenic
974723495 4:65771730-65771752 CTCTGTAGACTCCACCTCTGGGG - Intergenic
974871778 4:67653070-67653092 CTCTATAGACTCAACCTCTGTGG + Intronic
974917329 4:68194599-68194621 CTCTGTAGACTCCACCTCTGGGG + Intergenic
974967082 4:68773807-68773829 CTCTGTAGACTCCACCTCTGGGG - Intergenic
975034247 4:69661225-69661247 CTCTGTAGACTCCACCTCTGGGG - Intergenic
975150183 4:71012317-71012339 CTCTGTAGACTCCACCTCTGGGG + Intronic
975157656 4:71089986-71090008 CTCTGTAGACTCCACCTCTGGGG - Intergenic
975165696 4:71175729-71175751 CTCTGTAGACTCCACCTCTGGGG + Intergenic
975232196 4:71948112-71948134 CTCTGCAGACTTCACCTCTGGGG + Intergenic
975287004 4:72632589-72632611 CTCTGTAGACTCCACCTCTGGGG + Intergenic
975305155 4:72841115-72841137 CTCTGTAGACTCCACCTCTGGGG - Intergenic
975305894 4:72848183-72848205 CTCTGTAGACTCCACCTCTGGGG + Intergenic
975352437 4:73360682-73360704 CTCTGTAGACTCCACCTCTGGGG + Intergenic
975643716 4:76525917-76525939 CTCTGGAGATTCTAGCTCAGGGG - Intronic
975753562 4:77549939-77549961 CTCTGTAGACTCCACCTCTGGGG - Intronic
975806499 4:78118423-78118445 CTCTGTAGACTCCACCTCTGGGG - Intronic
975813643 4:78195362-78195384 CTCTGCAGACTCCACCTCTGGGG - Intronic
975821616 4:78276905-78276927 CTCTGTAGACTCCACCTCTGGGG - Intronic
975887384 4:78982032-78982054 CTCTGTAGACTCCACCTCTGGGG - Intergenic
976158754 4:82175938-82175960 CTCTGTAGACTCCACCTCTGGGG + Intergenic
976289061 4:83398442-83398464 CTCTGTAGACTCCACCTCTGGGG + Intergenic
976529470 4:86135207-86135229 CTCTGGAGGCTCCACCTCTGGGG + Intronic
976550263 4:86386392-86386414 CTCTAGAGCCTAAATCCCTGTGG + Intronic
976574744 4:86656815-86656837 CTCTGTAGACTCCACCTCTGGGG - Intronic
976597198 4:86905475-86905497 CTCTGCAGCCTTAATCTCTGGGG - Intronic
976876224 4:89856667-89856689 CTCTGTAGACTCCACCTCTGGGG + Intergenic
976905198 4:90228144-90228166 CTCTGGAGGCTCCACCTCTGGGG + Intronic
976941325 4:90705563-90705585 CTCTGTAGACTCCACCTCTGGGG - Intronic
976974874 4:91154100-91154122 CTCTGTAGACTCCACCTCTGGGG - Intronic
976977248 4:91180400-91180422 CTCTGTAGACTCCACCTCTGGGG - Intronic
977004239 4:91544898-91544920 CTCTGTAGACTCCAACTCTGGGG - Intronic
977029481 4:91863908-91863930 CTCTGCAGACTCCACCTCTGGGG - Intergenic
977108644 4:92921937-92921959 CTCTGTAGACTCCACCTCTGGGG - Intronic
977219768 4:94325380-94325402 CTCTGTAGACTCCACCTCTGGGG - Intronic
977288620 4:95139505-95139527 CTCTGTAGACTCCACCTCTGGGG - Intronic
977343704 4:95791917-95791939 CTCTGTAGACTCCACCTCTGGGG + Intergenic
977497896 4:97800772-97800794 CTCTGTAGACTCCAACTCTGGGG - Intronic
977617139 4:99099444-99099466 CTCTGTAGACTCCATCTCTGGGG - Intergenic
977624585 4:99176311-99176333 CTCTGTAGACTCCACCTCTGGGG - Intergenic
977630668 4:99239207-99239229 CTCTGTAGACTCCATCTCTGGGG - Intergenic
977633565 4:99270201-99270223 CTCTGTAGACTCCACCTCTGGGG - Intergenic
977772440 4:100875711-100875733 CTCTGGACACTGAAGTTCAGTGG - Intronic
977775693 4:100916714-100916736 CTCTGTAGACTCCACCTCTGGGG + Intergenic
977897395 4:102380342-102380364 CTCTGTAGACTCCACCTCTGGGG - Intronic
977974036 4:103243664-103243686 CTCTGTAGACTCCACCTCTGGGG - Intergenic
978012778 4:103708052-103708074 CTCTGTAGACTCCACCTCTGGGG + Intronic
978186334 4:105860657-105860679 CTCTGTAGACTCCACCTCTGAGG + Intronic
978188019 4:105880697-105880719 CTCTGTAGACTCCACCTCTGGGG + Intronic
978205284 4:106073712-106073734 CTCTGTAGACTCCAGCTCTGGGG - Intronic
978243177 4:106540698-106540720 CTCTGTAGACTCCACCTCTGGGG - Intergenic
978245181 4:106563680-106563702 CTCTGTAGACTCCACCTCTGGGG - Intergenic
978336278 4:107672618-107672640 CTCTGTAGACTCCACCTCTGGGG + Intronic
978363615 4:107957224-107957246 CTCTGTAGACTCCACCTCTGGGG + Intergenic
978412504 4:108441008-108441030 CTCTGTAGACTCCACCTCTGTGG - Intergenic
978537302 4:109775549-109775571 CTCTGTAGACTCCACCTCTGGGG + Intronic
978565505 4:110077140-110077162 CTCTGTAGACTCCACCTCTGGGG + Intronic
978591235 4:110327402-110327424 CTCTGTAGACTCCACCTCTGGGG - Intergenic
978694888 4:111565675-111565697 CTCTGTAGACTCCACCTCTGGGG + Intergenic
978756582 4:112309338-112309360 CTCTGCAGACTCTACCTCTGGGG - Intronic
978956174 4:114616190-114616212 CTCTGTAGACTCCACCTCTGGGG - Intronic
979074753 4:116257496-116257518 CTCTGTAGACTCCACCTCTGGGG - Intergenic
979215711 4:118161467-118161489 CTCTGTAGACTCCACCTCTGGGG - Intronic
979236317 4:118404229-118404251 CTCTGTAGACTCCACCTCTGAGG + Intergenic
979422423 4:120521720-120521742 CTTTGGTTACTACAGCTCTGTGG - Intergenic
979462665 4:121001610-121001632 CTCTGTAGACCCAACCTCTGTGG - Intergenic
979599753 4:122574771-122574793 CTCTGTAGACTCCACCTCTGGGG - Intergenic
979757650 4:124361760-124361782 CTCTGTAGACTCCACCTCTGGGG + Intergenic
979934088 4:126670259-126670281 CTCTGTAGACTTCACCTCTGGGG + Intergenic
980090385 4:128437092-128437114 CTCTGTAGACTCCACCTCTGGGG - Intergenic
980206083 4:129721079-129721101 CTCTGTAGACTCCACCTCTGGGG - Intergenic
980451744 4:132982277-132982299 CTCTGGAGACCATTGCTTTGAGG - Intergenic
980503944 4:133690785-133690807 CTCTGTAGACTCCACCTCTGCGG - Intergenic
980607516 4:135111850-135111872 CTCTGTAGACTCCACCTCTGGGG - Intergenic
981096562 4:140788300-140788322 CTCTGTAGACTCCACCTCTGGGG - Intergenic
981188516 4:141834157-141834179 CTCTGTAGACTCCACCTCTGGGG + Intergenic
981207977 4:142066873-142066895 CTCTGCAGACTCCACCTCTGGGG + Intronic
981295489 4:143126340-143126362 CTCTAGACACTGAAGCTCAGTGG - Intergenic
981299125 4:143166997-143167019 CTCTGTAGACTCCACCTCTGGGG + Intergenic
981345661 4:143673682-143673704 CTCTGTAGACTCTACCTCTGGGG - Intronic
981514873 4:145596896-145596918 CTCTGTAGACTCCACCTCTGAGG - Intergenic
981520095 4:145652232-145652254 CTTGGGACACTAAAGCTCAGGGG - Intronic
981560919 4:146047900-146047922 CTCTGTAGACTCCACCTCTGGGG - Intergenic
981839464 4:149094176-149094198 CTCTGTAGACTCCACCTCTGGGG - Intergenic
981855547 4:149286399-149286421 CTCTGGAGCCAAAAGTTCTAGGG + Intergenic
981958070 4:150503103-150503125 CTCTGGAGGCTCCACCTCTGGGG + Intronic
982619963 4:157692033-157692055 CTCTGTAGACTCCACCTCTGGGG + Intergenic
982638537 4:157927242-157927264 CTCTGTAGACTCCATCTCTGGGG - Intergenic
982785643 4:159533650-159533672 CTCTGTAGACTCCACCTCTGGGG - Intergenic
982793025 4:159615002-159615024 CTCTGTAGACTCCACCTCTGGGG - Intergenic
983101629 4:163632768-163632790 CTCTGTAGGCTCAACCTCTGGGG + Intronic
983173705 4:164563679-164563701 CTCTGTAGACTCCACCTCTGGGG + Intergenic
983182746 4:164667910-164667932 CTCTGTAGACTCCACCTCTGGGG + Intergenic
983183575 4:164676426-164676448 CTCTGTAGACTCCACCTCTGGGG + Intergenic
983362424 4:166744004-166744026 CTCTGTAGACTCCACCTCTGAGG + Intronic
983364621 4:166769778-166769800 CTCTGTAGACTCCACCTCTGGGG - Intronic
983598770 4:169499990-169500012 CTCTGTAGACTCCACCTCTGGGG - Intronic
983694398 4:170510683-170510705 CTCTGTAGACTCCACCTCTGGGG - Intergenic
983704367 4:170639762-170639784 CTCTGTAGGCTCAACCTCTGGGG + Intergenic
983799024 4:171903665-171903687 CTCTGGAGGCTCCACCTCTGGGG + Intronic
983879096 4:172912765-172912787 TTCTGTAGACTCCAGCTCTGGGG + Intronic
984434004 4:179685281-179685303 CTCTGTAGACTCCACCTCTGGGG - Intergenic
984509872 4:180666428-180666450 CTCTGAAATCTAATGCTCTGTGG + Intergenic
984626561 4:182013632-182013654 CTCTGGGAAGAAAAGCTCTGGGG + Intergenic
985473754 5:65725-65747 CTCTGTAGACTCCACCTCTGGGG - Intergenic
986127066 5:4893171-4893193 CTCTGTAGACTCCACCTCTGTGG - Intergenic
986359856 5:6966810-6966832 CTCTGTAGGCTCCAGCTCTGGGG + Intergenic
986653899 5:9991270-9991292 CTCTGTAGACTCCACCTCTGGGG + Intergenic
986655076 5:10002935-10002957 CTCTGTAGACTCCACCTCTGGGG + Intergenic
986750272 5:10780470-10780492 CTCTGTAGACTCCACCTCTGGGG + Intergenic
987490192 5:18570308-18570330 TTCTGGTTACTAAAGCTTTGTGG - Intergenic
987611560 5:20211291-20211313 CTCTGTAGACTCCACCTCTGGGG + Intronic
987803609 5:22732117-22732139 TTCTGGAGACTAGAAGTCTGAGG + Intronic
987949779 5:24660342-24660364 CTCTGTAGACTCCACCTCTGGGG - Intergenic
988023641 5:25655445-25655467 CTCTGTAGACTACACCTCTGGGG - Intergenic
988370762 5:30364833-30364855 CTCTGTAGACTCCACCTCTGGGG - Intergenic
988416071 5:30948285-30948307 CTCTGTAGACTCCACCTCTGGGG + Intergenic
988668229 5:33353754-33353776 CTCTGTAGACTCCACCTCTGGGG - Intergenic
988687642 5:33540352-33540374 CTCTGTAGACTCCACCTCTGTGG + Intronic
988859371 5:35261547-35261569 CTCTGTAGACTCCACCTCTGGGG - Intergenic
988917763 5:35912261-35912283 CTCTGTAGACTCCACCTCTGGGG + Intronic
988945177 5:36189810-36189832 CTCTGTAGACTCCACCTCTGGGG - Intergenic
989072214 5:37523031-37523053 CTCTGTAGACTCCACCTCTGGGG + Intronic
989284913 5:39688091-39688113 CTCTGTAGACTACACCTCTGCGG - Intergenic
989418270 5:41205770-41205792 CTCTGTAGACTCCACCTCTGGGG + Intronic
989522442 5:42418020-42418042 CTCTGTAGACTCCAACTCTGGGG - Intergenic
989544782 5:42660154-42660176 CTCTGTAGACTCCACCTCTGGGG + Intronic
989569528 5:42932267-42932289 CTCTGTAGACTCCACCTCTGGGG + Intergenic
989616456 5:43341305-43341327 CTCTGTAGACTCCACCTCTGGGG + Intergenic
989649617 5:43672874-43672896 CTCTGTAGACTCCACCTCTGGGG - Intronic
989660491 5:43792174-43792196 CTCTGTAGACTCCACCTCTGGGG + Intergenic
989662359 5:43813766-43813788 CTCTGTAGACTCCACCTCTGGGG - Intergenic
989784657 5:45312917-45312939 CTCTGTAGACTCCACCTCTGGGG + Intronic
989804420 5:45586114-45586136 CTCTGTAGACTCCACCTCTGGGG - Intronic
989942843 5:50174411-50174433 CTCTGTAGGCTCAACCTCTGGGG - Intergenic
989951459 5:50303104-50303126 CTATGGTGATTAAAACTCTGGGG + Intergenic
990038278 5:51349208-51349230 CTCTGTAGACTCCACCTCTGGGG + Intergenic
990095134 5:52102386-52102408 CTCTGAAGACTCCACCTCTGGGG - Intergenic
990164093 5:52976204-52976226 CTCTGTAGACTCCACCTCTGGGG - Intergenic
990216788 5:53542001-53542023 CTCTGGAGGTTAAAGCTTTGAGG - Intergenic
990226919 5:53665416-53665438 CTCTGTAGACTCCACCTCTGGGG - Intronic
990230274 5:53705786-53705808 CTCTGTAGACTCTACCTCTGGGG - Intergenic
990244851 5:53854294-53854316 CTCTGTAGACTCCACCTCTGGGG - Intergenic
990340082 5:54813499-54813521 CTCTGTAGACTCCACCTCTGGGG + Intergenic
990360432 5:55013386-55013408 CTCTGTAGACTCCACCTCTGGGG + Intronic
990437576 5:55808906-55808928 CTCTGTAGACTCCACCTCTGGGG - Intronic
990482192 5:56221896-56221918 CTCTGTAGACTCCACCTCTGGGG + Intronic
990541931 5:56781914-56781936 CTCTGTAGACTCCACCTCTGGGG - Intergenic
990652989 5:57923391-57923413 CTCTGTAGACTCCACCTCTGGGG + Intergenic
990860356 5:60320072-60320094 CTCTGTAGACTACACCTCTGGGG - Intronic
990887920 5:60615693-60615715 CTCTGTAGACTCCACCTCTGGGG + Intronic
990913820 5:60881450-60881472 CTCTGTAGACTTCACCTCTGGGG - Intronic
990944937 5:61239411-61239433 CTCTGTAGACTCCACCTCTGGGG + Intergenic
991052959 5:62292074-62292096 CTCTGCAGACTCCACCTCTGGGG + Intergenic
991097339 5:62752943-62752965 CTCTGTAGACTCCACCTCTGGGG + Intergenic
991199981 5:63980507-63980529 CTCTGTAGACTCCACCTCTGGGG - Intergenic
991280749 5:64910549-64910571 CTCTGTAGACTCCACCTCTGGGG - Intronic
991529897 5:67603914-67603936 CTCTGTAGACTCCACCTCTGGGG - Intergenic
992197061 5:74350674-74350696 CTCTGTAGACTCCACCTCTGGGG - Intergenic
992274639 5:75102522-75102544 CTCTGTAGACTCCACCTCTGGGG - Intronic
992277142 5:75131560-75131582 CTCTGTAGACTCCACCTCTGGGG + Intronic
992338677 5:75799774-75799796 CTCTGTAGACTCCACCTCTGGGG - Intergenic
992631195 5:78682489-78682511 CTCTGTAGACTCTACCTCTGGGG + Intronic
992659500 5:78944868-78944890 CTCTGTAGACTCCACCTCTGGGG - Intronic
992873522 5:81029199-81029221 CTCTGTAGACTCCACCTCTGAGG + Intronic
993008797 5:82457130-82457152 CTCTGTAGACTCCACCTCTGGGG - Intergenic
993052761 5:82944580-82944602 CTCTGTAGACTCCACCTCTGGGG + Intergenic
993142392 5:84050864-84050886 CTCTGTAGACTCCACCTCTGGGG + Intronic
993244314 5:85432005-85432027 CTCTGTAGACTCCACCTCTGGGG + Intergenic
993305440 5:86270591-86270613 CTCTGTAGACTCCACCTCTGGGG - Intergenic
993370344 5:87084958-87084980 CTCTGTAGACTCCACCTCTGGGG + Intergenic
993444153 5:87991001-87991023 CTCTGTAGACTCCACCTCTGAGG + Intergenic
993578898 5:89635521-89635543 CTCTGTAGACTCCACCTCTGGGG - Intergenic
993610265 5:90045118-90045140 CTCTGTAGACTCCACCTCTGGGG - Intergenic
993619122 5:90147297-90147319 CTCTGTAGACTCCACCTCTGGGG + Intergenic
993688509 5:90970275-90970297 CTCTGCAGACTCCACCTCTGGGG + Intronic
993742280 5:91555913-91555935 CTCTGCAGACTCCATCTCTGGGG + Intergenic
993864107 5:93172135-93172157 CTCTGTAGACTCCATCTCTGGGG - Intergenic
993917586 5:93761607-93761629 CTCTGTAGACTCCACCTCTGGGG + Intronic
994287864 5:97991850-97991872 CTCTGTAGACTCCACCTCTGTGG + Intergenic
994528498 5:100935678-100935700 CTCTGTAGACTCCACCTCTGGGG - Intergenic
995111750 5:108436873-108436895 CACTGCAGCCTCAAGCTCTGGGG - Intergenic
995203941 5:109457792-109457814 CTCTGTAGACTCCACCTCTGGGG + Intergenic
995270709 5:110217099-110217121 CTCTGTAGACTCCACCTCTGGGG - Intergenic
995329878 5:110934517-110934539 CTCTGTAGACTTCACCTCTGGGG + Intergenic
995459786 5:112390592-112390614 CTCTGTAGACTCCACCTCTGGGG + Intronic
995467522 5:112466324-112466346 CTCTGTAGACTCCACCTCTGGGG - Intergenic
995573252 5:113503448-113503470 CACTGCAGGCTAAAGCTCTGGGG - Intergenic
995665398 5:114536239-114536261 CTCTGTAGACTACACCTCTGGGG - Intergenic
995690347 5:114818873-114818895 CTCTGTAGACTCCACCTCTGGGG - Intergenic
995692679 5:114844953-114844975 CTCTGTAGACTCCACCTCTGGGG + Intergenic
995749870 5:115442428-115442450 CTCTGTAGACTCCACCTCTGGGG + Intergenic
995771441 5:115675052-115675074 CTCTGTAGACTCCACCTCTGGGG + Intergenic
995905440 5:117117379-117117401 CTCTGTAGACTCCACCTCTGGGG - Intergenic
996013044 5:118502358-118502380 CTCTGTAGACTCCACCTCTGGGG - Intergenic
996085355 5:119299704-119299726 CTCTGTAGACTCCACCTCTGGGG - Intronic
996114170 5:119599862-119599884 CTCTGTAGACTCCACCTCTGGGG + Intronic
996144373 5:119955627-119955649 CTCTGGATGCTGAAGCTCAGTGG + Intergenic
996335794 5:122383012-122383034 CTCTGTAGACTCCACCTCTGGGG - Intronic
996514918 5:124358780-124358802 CTCTGTAGACTCCACCTCTGGGG + Intergenic
996520818 5:124423669-124423691 CTCTGTAGACTCCAACTCTGGGG + Intergenic
996938317 5:128973370-128973392 CTCTGTAGACTCTACCTCTGGGG - Intronic
997107219 5:131034304-131034326 CTCTGTAGACTCCACCTCTGGGG - Intergenic
997117234 5:131138505-131138527 CTCTGTAGACTCCACCTCTGGGG - Intergenic
997137021 5:131337559-131337581 CTCTGTAGACTCCACCTCTGGGG - Intronic
997205308 5:132044781-132044803 TTCTGGATACTAATGCTCTATGG - Intergenic
997578629 5:135003543-135003565 CTCTGTAGACTCCACCTCTGAGG - Intronic
997861650 5:137423374-137423396 CTCTGTAGACTCCACCTCTGGGG - Intronic
997874415 5:137535652-137535674 CTCTGTAGACTCCACCTCTGGGG + Intronic
998241740 5:140452271-140452293 CTCTGTAGACTCCACCTCTGGGG + Intronic
998645335 5:144055505-144055527 CTCTGTAGACTCCACCTCTGGGG - Intergenic
998803201 5:145891684-145891706 CTCTGTAGACTCCACCTCTGGGG + Intergenic
999358853 5:150964666-150964688 CTCTGTAGACTCCACCTCTGGGG + Intergenic
999542305 5:152586890-152586912 CTCTGTAGACTCCACCTCTGGGG + Intergenic
999867741 5:155719528-155719550 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1000144849 5:158444389-158444411 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1000158633 5:158577462-158577484 CTCTGTAGACTCACCCTCTGGGG - Intergenic
1000587872 5:163122420-163122442 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1000632907 5:163611330-163611352 TTCTGGAGGCTCAAACTCTGAGG + Intergenic
1000746994 5:165046033-165046055 CTCTGTAGACTCCACCTCTGCGG - Intergenic
1001212198 5:169820171-169820193 CTCTGTAGACTGCACCTCTGGGG + Intronic
1001983376 5:176052293-176052315 CTCTGTAGACTCCACCTCTGGGG + Intronic
1001987070 5:176083760-176083782 CTCTGTAGACTCCACCTCTGGGG - Intronic
1002229799 5:177754387-177754409 CTCTGTAGACTCCACCTCTGGGG + Intronic
1002234092 5:177791759-177791781 CTCTGTAGACTCCACCTCTGCGG - Intronic
1002265546 5:178029390-178029412 CTCTGTAGACTCCACCTCTGGGG - Intronic
1002553959 5:180019840-180019862 CACTGGACACTCAAGCACTGGGG + Intronic
1002657480 5:180762260-180762282 CTCTGTAGACTCCACCTCTGCGG - Intergenic
1002659364 5:180780788-180780810 CACTGCAGCCTAAACCTCTGGGG - Intergenic
1003388505 6:5691778-5691800 CTCTGTAGACTCTACCTCTGGGG - Intronic
1003649759 6:7948765-7948787 CTCTGTAGACTCCACCTCTGGGG - Intronic
1003956586 6:11170839-11170861 CTCGGGAGGCTAAAGCAGTGAGG + Intergenic
1004375536 6:15087702-15087724 TTCTGAAGATTAAAGCTCTAAGG + Intergenic
1004831573 6:19482275-19482297 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1005033300 6:21531615-21531637 CTCTGGTGTTTAAAGATCTGAGG + Intergenic
1005193868 6:23259870-23259892 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1005202664 6:23364561-23364583 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1005373523 6:25158721-25158743 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1005558172 6:27008932-27008954 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1005757614 6:28939355-28939377 ATCTGGAGACTTAAGGTCTTTGG + Intergenic
1005846146 6:29780302-29780324 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1006041507 6:31260097-31260119 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1006942356 6:37761437-37761459 CTCTGCAGCCTCAACCTCTGGGG + Intergenic
1007155306 6:39736942-39736964 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1007890149 6:45281642-45281664 CTCTGTAGACTCCACCTCTGGGG + Intronic
1007892371 6:45307169-45307191 CTCTGTAGACTCCACCTCTGGGG + Intronic
1007977894 6:46119983-46120005 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1007988348 6:46230366-46230388 CTCTGTAGACTCCACCTCTGGGG - Intronic
1008253960 6:49275058-49275080 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1008281285 6:49599093-49599115 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1008414572 6:51224879-51224901 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1008436830 6:51485991-51486013 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1008529989 6:52448162-52448184 CTCTGTAGACTCCACCTCTGAGG - Intronic
1008581269 6:52909770-52909792 CTCTGGAGACTAAAGTGGTGTGG - Intergenic
1008633197 6:53383249-53383271 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1008671588 6:53774565-53774587 CTCTGCAGACTCCACCTCTGGGG + Intergenic
1008874100 6:56307313-56307335 CTCTGTAGACTCCACCTCTGGGG - Intronic
1009056496 6:58342332-58342354 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1009234688 6:61108266-61108288 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1009410797 6:63362747-63362769 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1009476403 6:64097343-64097365 CTCTGTAGACTCTACCTCTGGGG - Intronic
1010281697 6:74030260-74030282 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010282210 6:74035299-74035321 CTCTGTAGACTCAACCTCTGGGG - Intergenic
1010286560 6:74084632-74084654 CTCTATAGACTCAACCTCTGGGG - Intergenic
1010307624 6:74343377-74343399 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010461394 6:76118356-76118378 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010463780 6:76143315-76143337 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010476894 6:76299128-76299150 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010484309 6:76391060-76391082 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1010503428 6:76628731-76628753 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010511794 6:76729479-76729501 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010603684 6:77862626-77862648 CTCTGTAGACTCCACCTCTGGGG + Intronic
1010670093 6:78676483-78676505 CTCTGGAGACTCCACCTCTGGGG + Intergenic
1010671769 6:78694859-78694881 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1010721266 6:79285209-79285231 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1010772874 6:79852690-79852712 TTTTGGTGACTATAGCTCTGTGG - Intergenic
1010869236 6:81017653-81017675 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010876881 6:81117636-81117658 CTCTGTAGACTCTACCTCTGGGG - Intergenic
1010912676 6:81579090-81579112 CTCTGTAGACTCCACCTCTGGGG + Intronic
1010944495 6:81958620-81958642 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1010993106 6:82502027-82502049 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1011081663 6:83496197-83496219 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1011304175 6:85908626-85908648 CTCTGTAGACTCCAGCTCTGGGG - Intergenic
1011315512 6:86026958-86026980 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1011320687 6:86089121-86089143 CTCTGGAGACTCCAGATGTGTGG - Intergenic
1011376705 6:86694965-86694987 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1011524949 6:88254133-88254155 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1011760753 6:90562624-90562646 CTCTGTAGACTCCACCTCTGGGG + Intronic
1011909737 6:92421273-92421295 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1011953359 6:92995709-92995731 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1012129416 6:95471951-95471973 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1012251520 6:96986462-96986484 CTCTGTAGACTCCACCTCTGGGG - Intronic
1012459758 6:99447596-99447618 CTCTGTAGACTCCACCTCTGGGG + Intronic
1012481880 6:99676392-99676414 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1012595177 6:101030907-101030929 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1012608636 6:101188672-101188694 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1012799073 6:103802372-103802394 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1013258274 6:108411311-108411333 CTCTGTAGACTCCACCTCTGGGG + Intronic
1013383768 6:109603662-109603684 CTCTGTAGACTCCACCTCTGGGG - Intronic
1013387434 6:109645603-109645625 CTCTGTAGACTCCACCTCTGGGG + Intronic
1013517853 6:110904833-110904855 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1013874349 6:114805499-114805521 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1013883068 6:114928804-114928826 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1013998993 6:116343195-116343217 CTCTGTAGACTCCACCTCTGTGG + Intronic
1014063570 6:117100854-117100876 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1014122034 6:117736996-117737018 CTCTGGAAGCTAAACCACTGTGG - Intergenic
1014220834 6:118796842-118796864 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1014277251 6:119400518-119400540 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1014357718 6:120433123-120433145 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1015046256 6:128779843-128779865 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1015179554 6:130346630-130346652 CTCTGTAGACTCCACCTCTGGGG + Intronic
1015268825 6:131317855-131317877 GTCTGGAGACTAATACACTGTGG + Intergenic
1015430301 6:133123247-133123269 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1016333862 6:142982994-142983016 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1016875833 6:148864094-148864116 CTCTGTAGACTCCACCTCTGGGG - Intronic
1016923021 6:149315184-149315206 CTCTGAAGTTTAAAGCTCTTGGG + Intronic
1017226568 6:152028695-152028717 CTCTGTAGACTCCACCTCTGGGG + Intronic
1017279659 6:152609515-152609537 CTCTGTAGACTCCACCTCTGTGG + Intronic
1017305077 6:152908755-152908777 ATCTGTACACTAAACCTCTGTGG - Intergenic
1017781462 6:157718820-157718842 CTCTGCAAACCAAGGCTCTGAGG - Intronic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1018011166 6:159671144-159671166 CTCTGTAGACTCCACCTCTGGGG + Exonic
1018015070 6:159704676-159704698 CTCTGTAGACTCCACCTCTGGGG + Intronic
1018113996 6:160565073-160565095 CTCTGTAGACTCCACCTCTGGGG + Intronic
1018175765 6:161178224-161178246 CTCTGTAGACTCCACCTCTGGGG - Intronic
1018759997 6:166885359-166885381 CTCTGTAGACTCCACCTCTGGGG + Intronic
1019199554 6:170303313-170303335 CACTGCAGACTGAAACTCTGGGG + Intronic
1019339383 7:501498-501520 CTCTGCAGCCTCAAGCTCTTGGG + Intronic
1020344142 7:7145216-7145238 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1020619598 7:10501490-10501512 CTCTGTAGACTCCACCTCTGAGG + Intergenic
1020754215 7:12181520-12181542 CTCTGGGGACTCACACTCTGGGG - Intergenic
1020818769 7:12939697-12939719 CTCTGTAGACTCCATCTCTGAGG - Intergenic
1020874639 7:13677760-13677782 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1021156395 7:17215753-17215775 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1021201762 7:17735233-17735255 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1021307210 7:19046259-19046281 CTCTGTAGACTCCACCTCTGTGG + Intronic
1021798154 7:24278588-24278610 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1022073267 7:26939252-26939274 CTCTGCAGAATCAAGATCTGTGG - Intronic
1022187308 7:27982501-27982523 CTCTGTAGACTCCAACTCTGGGG + Intronic
1022347307 7:29528755-29528777 CTCTGTAGACCCAACCTCTGGGG + Intergenic
1022453612 7:30538016-30538038 CTCTGTAGACTCCACCTCTGGGG + Intronic
1022879986 7:34576335-34576357 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1022933934 7:35152353-35152375 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1023066028 7:36378697-36378719 CTCTGTAGACTCCAACTCTGGGG - Intronic
1023142969 7:37120676-37120698 CTCTGTAGACTCCACCTCTGAGG + Intronic
1023455986 7:40339336-40339358 CTCTGTAGACTCCACCTCTGGGG - Intronic
1023972673 7:45002902-45002924 CTCTGGCCACTAAAGGTGTGGGG + Intronic
1024552627 7:50576424-50576446 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1024738209 7:52328407-52328429 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1024892379 7:54218662-54218684 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1024901538 7:54323715-54323737 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1025034192 7:55582785-55582807 CTCTGTAGACTTCACCTCTGGGG - Intergenic
1025146720 7:56512001-56512023 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1025577553 7:62667397-62667419 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1025582896 7:62742365-62742387 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1025737180 7:64161060-64161082 CTCTGTAGACTCCACCTCTGGGG + Intronic
1025869246 7:65415323-65415345 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1025874698 7:65470078-65470100 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1026061420 7:67030091-67030113 CCCTGGACACTGAAGCTCAGTGG - Intronic
1026642943 7:72142526-72142548 CTCTGGAGACTCCACCTCTGGGG + Intronic
1026716930 7:72797343-72797365 CCCTGGACACTGAAGCTCAGTGG + Intronic
1027493633 7:78860834-78860856 CTCTGTAGACTCCATCTCTGGGG - Intronic
1027495984 7:78888280-78888302 CTCTGTAGACTCCACCTCTGGGG + Intronic
1027577297 7:79946673-79946695 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1027792387 7:82650390-82650412 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1028050090 7:86174464-86174486 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1028200498 7:87955722-87955744 CTCTGTAGGCTACACCTCTGGGG - Intronic
1028436192 7:90807018-90807040 CTCTGTAGACTCCACCTCTGGGG + Intronic
1028836447 7:95379754-95379776 CTCTGTAGACTCCACCTCTGGGG + Intronic
1028918867 7:96288811-96288833 CTCTGTAGACTCCACCTCTGGGG + Intronic
1029059862 7:97786143-97786165 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1029304361 7:99607706-99607728 CCCTGGAGATCAAGGCTCTGAGG + Exonic
1029325391 7:99803195-99803217 CTCAGTAGACTACACCTCTGGGG - Intergenic
1029829867 7:103245133-103245155 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1029951640 7:104592694-104592716 CTCTGTAGACTCCACCTCTGGGG - Intronic
1029965459 7:104735307-104735329 CTCTGTAGACTTCACCTCTGGGG - Intronic
1029979489 7:104864643-104864665 CTCTGTAGACTCCATCTCTGGGG + Intronic
1030131994 7:106209258-106209280 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1030177764 7:106672277-106672299 CTCTAGAGACTCCACCTCTGTGG + Intergenic
1030179402 7:106689960-106689982 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1030451616 7:109719658-109719680 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1030510075 7:110472755-110472777 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1030762096 7:113364587-113364609 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1030817540 7:114055469-114055491 CTCTGTAGACTCCACCTCTGGGG + Intronic
1030970336 7:116047551-116047573 CTCTGTAGACTCCACCTCTGAGG + Intronic
1030997065 7:116371786-116371808 CTCTGTAGACTCCACCTCTGGGG + Intronic
1031284933 7:119855348-119855370 CTCTGTAGACTCCAGCTCTGGGG + Intergenic
1031344693 7:120651206-120651228 CTCTGTAGACTCCACCTCTGGGG - Intronic
1031435225 7:121724925-121724947 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1031527084 7:122834836-122834858 CTCTGTAGACTCCACCTCTGGGG + Intronic
1031829925 7:126613930-126613952 CTCTGTAGACTCCACCTCTGGGG + Intronic
1032705502 7:134418141-134418163 CTCAAGAAACTGAAGCTCTGAGG - Intergenic
1033293431 7:140108861-140108883 CTCTGTAGACTCCACCTCTGGGG - Intronic
1033348035 7:140540585-140540607 CTCTGGTGACAGCAGCTCTGTGG + Intronic
1033887561 7:145967099-145967121 CTCTGTAGACTCAACCTCTAGGG + Intergenic
1034028809 7:147737608-147737630 CTCTGTAGACTCCACCTCTGGGG - Intronic
1034236915 7:149579390-149579412 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1034583311 7:152066031-152066053 CTCTGTAGACTCCACCTCTGGGG - Intronic
1034723946 7:153318192-153318214 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1035493329 7:159298913-159298935 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1035533251 8:372162-372184 CTCTGTAGACTCCACCTCTGCGG - Intergenic
1035558806 8:589660-589682 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1035639467 8:1173478-1173500 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1035900672 8:3455901-3455923 CTCTGTAGACTCCACCTCTGGGG - Intronic
1036370292 8:8156485-8156507 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1036516222 8:9446898-9446920 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1036880600 8:12509146-12509168 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1037249832 8:16878819-16878841 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1037591252 8:20313782-20313804 ATCTGCAGACTAGAGCTCTTGGG + Intergenic
1037641019 8:20743229-20743251 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1037999483 8:23379526-23379548 CTCTGTAGACTCCACCTCTGGGG - Intronic
1038655747 8:29449740-29449762 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1038846679 8:31236855-31236877 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1038928992 8:32171897-32171919 CTCTGTAGACTCCACCTCTGGGG + Intronic
1039103638 8:33967307-33967329 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1039646453 8:39289851-39289873 CTCTGGAGAGGAAGGATCTGAGG + Intergenic
1039850072 8:41357526-41357548 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1040071070 8:43189224-43189246 CTCTGTAGACTCCACCTCTGGGG - Intronic
1040403426 8:47076049-47076071 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1040430855 8:47340796-47340818 TTCTGGATACTAAAGCTCAGTGG + Intronic
1040439012 8:47422199-47422221 CTCTGTAGACTCCACCTCTGGGG - Intronic
1040539451 8:48339455-48339477 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1040712787 8:50209272-50209294 CTCTGTAGACTCCACCTCTGGGG + Intronic
1040814469 8:51492833-51492855 CTCTGTAGACTCCACCTCTGGGG + Intronic
1041121013 8:54586587-54586609 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1041294241 8:56338350-56338372 CTCTGTAGACTCTACCTCTGGGG - Intergenic
1041302714 8:56429635-56429657 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1041466822 8:58165691-58165713 CTCTGGGAACTCAGGCTCTGAGG - Intronic
1041518260 8:58726535-58726557 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1041665891 8:60444577-60444599 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1041842999 8:62293827-62293849 CTCTGTAGACTCCACCTCTGGGG - Intronic
1041845357 8:62321919-62321941 CTCTGTAGACTCCACCTCTGGGG - Intronic
1041997732 8:64084193-64084215 CTCTGCAGACTCCACCTCTGGGG + Intergenic
1042024215 8:64405498-64405520 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1042204851 8:66318342-66318364 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1042686925 8:71452320-71452342 CTCTGTAGACTCCACCTCTGGGG + Intronic
1042853501 8:73240558-73240580 CTCTAGAGACTCCACCTCTGTGG - Intergenic
1042931324 8:74016407-74016429 CTCTGTAGACTCCACCTCTGGGG + Intronic
1043009774 8:74867054-74867076 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1043089170 8:75876003-75876025 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1043123481 8:76360543-76360565 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1043177630 8:77042393-77042415 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1043236945 8:77880071-77880093 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1043411694 8:80004037-80004059 CTCTGTAGACTCCACCTCTGGGG + Intronic
1043475320 8:80600079-80600101 CTCTTAAGACAAAGGCTCTGAGG - Intergenic
1043480740 8:80649714-80649736 CTCTGTAGACTCCACCTCTGGGG + Intronic
1043497953 8:80823471-80823493 CTCTGTAGACTCCACCTCTGGGG + Intronic
1043605112 8:81990699-81990721 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1043726915 8:83622930-83622952 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1043762262 8:84082447-84082469 CTCTGTAGACTCCATCTCTGGGG - Intergenic
1043818972 8:84839519-84839541 CTCTGTAGACTCCACCTCTGAGG + Intronic
1043911891 8:85873864-85873886 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1044042326 8:87385668-87385690 CTCTGTAGACTCCACCTCTGGGG + Intronic
1044195733 8:89374452-89374474 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1044202989 8:89458071-89458093 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1044811821 8:96070954-96070976 CTCTGCAGACTCCACCTCTGGGG + Intergenic
1044816374 8:96117205-96117227 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1044960742 8:97528630-97528652 CTCTGTAGACTCCACCTCTGAGG - Intergenic
1045088233 8:98710692-98710714 CTCTGTAGACTCCACCTCTGGGG + Intronic
1045125716 8:99087046-99087068 CTCTGTAGACTCCACCTCTGCGG - Intronic
1045143516 8:99313758-99313780 CTCTGTAGACTCCACCTCTGGGG - Intronic
1045177300 8:99739374-99739396 CTCTGTAGACTCCACCTCTGGGG + Intronic
1045241120 8:100402347-100402369 CTCTGTAGACTCCACCTCTGGGG + Intronic
1045360297 8:101426297-101426319 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1045709258 8:104964283-104964305 CTCTGTAGACTCCACCTCTGGGG - Intronic
1046609837 8:116410859-116410881 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1046704463 8:117434854-117434876 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1046811205 8:118535538-118535560 CTCTGTAGACTCCACCTCTGGGG - Intronic
1047195112 8:122713980-122714002 CTCTTGAAACTTTAGCTCTGGGG - Intergenic
1047845594 8:128801769-128801791 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1048231350 8:132644883-132644905 CTCTGTAGACTCCACCTCTGGGG + Intronic
1048466435 8:134668158-134668180 CTCTGCAGACTCCACCTCTGGGG + Intronic
1049074422 8:140382710-140382732 CTCTGTAGACTCCACCTCTGGGG + Intronic
1050052995 9:1622721-1622743 CTCTGCAGAGTATAGCCCTGTGG + Intergenic
1050083172 9:1936655-1936677 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1050322481 9:4467182-4467204 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1050381190 9:5032299-5032321 CTCTGTAGACTCCACCTCTGGGG + Intronic
1050446447 9:5728134-5728156 CTCTGTAGACTCCACCTCTGGGG - Intronic
1050478244 9:6063244-6063266 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1050497908 9:6263906-6263928 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1050509000 9:6374735-6374757 CTCTGTAGACTCTACCTCTGGGG + Intergenic
1050604132 9:7283308-7283330 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1051296382 9:15600726-15600748 CTCTGTAGACTCCACCTCTGGGG - Intronic
1051300452 9:15644793-15644815 CTCTGTAGACTCCACCTCTGGGG + Intronic
1051320796 9:15903082-15903104 CTCTGTAGACTCCACCTCTGGGG + Intronic
1051327521 9:15988979-15989001 CTCTGTAGACTCCACCTCTGGGG + Intronic
1051879375 9:21824691-21824713 CTCTGTAGACTCCAACTCTGGGG - Intronic
1051909762 9:22139776-22139798 TTCTGGAGGCTAAAATTCTGAGG - Intergenic
1051941284 9:22508459-22508481 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1052098091 9:24409005-24409027 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1052115437 9:24644341-24644363 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1052117645 9:24668460-24668482 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1052328216 9:27239907-27239929 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1052441184 9:28498248-28498270 CTCTGTAGACTCCACCTCTGGGG - Intronic
1052714514 9:32099059-32099081 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1052992895 9:34532150-34532172 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1053048800 9:34941386-34941408 GTCTGGATGCTAATGCTCTGTGG + Intergenic
1053521057 9:38779924-38779946 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1053827108 9:42036597-42036619 CTCTGTAGACTCCACCTCTGGGG + Intronic
1054193216 9:62003917-62003939 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1054603455 9:67150835-67150857 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1054645191 9:67584774-67584796 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1054997378 9:71407623-71407645 CTCTGTAGACTCCACCTCTGGGG + Intronic
1055053185 9:72000095-72000117 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1055338663 9:75259274-75259296 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1055548583 9:77408846-77408868 CTCTGTAGACTCCACCTCTGGGG + Intronic
1055578898 9:77687835-77687857 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1056230250 9:84536033-84536055 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1056426309 9:86480793-86480815 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1056516686 9:87358974-87358996 CTCTGTGGACTAAAGTTCTCTGG + Intergenic
1057175905 9:92999063-92999085 CTCTGTAGACTCCACCTCTGGGG - Intronic
1057324685 9:94050803-94050825 CTCTGTAGACTCCACCTCTGGGG - Intronic
1057342730 9:94217274-94217296 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1057698114 9:97341779-97341801 CTCTGTAGACTCCACCTCTGGGG - Intronic
1058207918 9:102131355-102131377 CTCTGTAGACTGCACCTCTGGGG + Intergenic
1058305792 9:103439119-103439141 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1058340350 9:103887718-103887740 CTCTGAAGACAAATGGTCTGTGG + Intergenic
1058367045 9:104220905-104220927 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1058496462 9:105563703-105563725 CTCTGTAGACTTCACCTCTGGGG + Intronic
1058517403 9:105790662-105790684 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1058614350 9:106809703-106809725 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1058988825 9:110235355-110235377 CTCTGCAGACTCCACCTCTGGGG - Intergenic
1059673507 9:116514595-116514617 CTCTGTAGACTCCACCTCTGGGG - Intronic
1059675685 9:116536946-116536968 CTCTGTAGACTCCACCTCTGGGG - Intronic
1059689159 9:116668112-116668134 CTGTGGAGACTAAAGATTTCAGG - Intronic
1059898720 9:118897941-118897963 CTCTGGAGACTCCAGCTCTCAGG + Intergenic
1060339329 9:122759557-122759579 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1060810507 9:126609383-126609405 CTCTCGGGACTGGAGCTCTGAGG - Intergenic
1061552366 9:131344988-131345010 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1203465616 Un_GL000220v1:83246-83268 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1185639646 X:1581326-1581348 GGCTGGAGAGTAAAGCTCAGTGG - Intergenic
1186041201 X:5480989-5481011 CTCTGTAGGCTACACCTCTGGGG + Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186563593 X:10638556-10638578 CTCTGTAGACTCCACCTCTGGGG + Intronic
1186702542 X:12106950-12106972 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1186775818 X:12863885-12863907 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1187256863 X:17651212-17651234 CACTGGAGACTTAAACTCTGGGG + Intronic
1187595826 X:20771685-20771707 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1187702347 X:21974879-21974901 ATCTGGAGAATAAAGATCAGAGG + Intronic
1187835523 X:23428888-23428910 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1187848482 X:23566248-23566270 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1187868109 X:23742455-23742477 CTCTGGAGTCTAAGGCCCTCAGG + Intronic
1188272024 X:28152311-28152333 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1188289227 X:28367673-28367695 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1188525390 X:31082905-31082927 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1188944215 X:36278188-36278210 CTCTGTAGACTCCACCTCTGTGG - Intronic
1189200010 X:39185952-39185974 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1189524865 X:41809140-41809162 CTCTGTAGACTCCACCTCTGGGG + Intronic
1189625144 X:42888884-42888906 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1189832486 X:44988997-44989019 CTCTGTAGACTCCACCTCTGGGG - Intronic
1189930458 X:46003930-46003952 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1189939275 X:46104397-46104419 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1190209595 X:48433984-48434006 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1190358184 X:49625644-49625666 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1190494733 X:51018246-51018268 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1190587831 X:51964966-51964988 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1190621599 X:52292320-52292342 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1190683390 X:52849162-52849184 CTCTGTAGACTTAACCTCTGGGG - Intergenic
1190720768 X:53145550-53145572 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1190840832 X:54142639-54142661 CTCTGTAGACTCCACCTCTGGGG + Intronic
1190962901 X:55269631-55269653 CTCTGTAGACTCCACCTCTGGGG + Intronic
1190966110 X:55303234-55303256 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1190968167 X:55322987-55323009 TTCTGGAGCCTGAAGCTGTGAGG + Intergenic
1191012412 X:55774503-55774525 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191016069 X:55811638-55811660 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191017692 X:55827626-55827648 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1191023629 X:55889583-55889605 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191048229 X:56162359-56162381 CTCTGTAGACTACAGCACCGGGG - Intergenic
1191049639 X:56177692-56177714 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191050154 X:56183060-56183082 CTCTGTAGACTCCCGCTCTGGGG - Intergenic
1191072921 X:56421225-56421247 CTCTGTGGACTCCAGCTCTGAGG - Intergenic
1191076649 X:56460790-56460812 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191113000 X:56822190-56822212 CTCTGGAGTCTAAGTCTATGAGG - Intergenic
1191134532 X:57049453-57049475 CTCTGTAGACTCCACCTCTGAGG + Intergenic
1191138330 X:57090589-57090611 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191170676 X:57444199-57444221 CTCTGTAGACTCCACCTCTGGGG - Intronic
1191172899 X:57467651-57467673 CTCTGTAGACTCCACCTCTGGGG + Intronic
1191208879 X:57863709-57863731 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1191592827 X:62906565-62906587 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191643325 X:63451950-63451972 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191745645 X:64483959-64483981 CTCTGTAGGCTACAGCTCTGGGG - Intergenic
1191748268 X:64513505-64513527 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1191765621 X:64695431-64695453 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191782034 X:64879227-64879249 CTCTGTAGACTCAACCTCTGGGG + Intergenic
1191799195 X:65058666-65058688 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1191809469 X:65171632-65171654 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191828252 X:65389226-65389248 CTCTGTAGACTCCACCTCTGGGG - Intronic
1191834980 X:65454530-65454552 CTCTGTAGACTCCACCTCTGGGG + Intronic
1191907365 X:66107903-66107925 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1191938731 X:66454378-66454400 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1191990191 X:67026718-67026740 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1192045175 X:67664706-67664728 CTCTGTAGACTCCACCTCTGGGG - Intronic
1192049288 X:67709230-67709252 CTCTGTAGACTCCACCTCTGGGG - Intronic
1192097237 X:68225272-68225294 CTCTGTAGACTCCACCTCTGGGG + Intronic
1192101079 X:68265080-68265102 CTCTGTAGACTCCACCTCTGGGG + Intronic
1192287658 X:69755654-69755676 CTCTGTAGACTCCACCTCTGGGG - Intronic
1192352501 X:70368839-70368861 CTCTGTAGACTCCACCTCTGGGG - Intronic
1192371821 X:70520734-70520756 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192385235 X:70661426-70661448 CTCTGTAGACTCCACCTCTGGGG + Intronic
1192390011 X:70716380-70716402 CTCTGTAGACTCCACCTCTGGGG - Intronic
1192391066 X:70728714-70728736 CTCTGTAGACTCCACCTCTGGGG + Intronic
1192406446 X:70890750-70890772 CTCTGTAGACTCCACCTCTGGGG + Intronic
1192525856 X:71843512-71843534 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192674912 X:73185383-73185405 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1192683751 X:73281901-73281923 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1192685921 X:73305173-73305195 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192755125 X:74039529-74039551 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192802510 X:74480073-74480095 CTCTGTAGACTCCACCTCTGGGG - Intronic
1192871780 X:75191553-75191575 CTCTGTAGACTTCACCTCTGGGG - Intergenic
1192900305 X:75489142-75489164 CTCTGTAGACTCCACCTCTGGGG + Intronic
1192910779 X:75602086-75602108 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192912222 X:75616937-75616959 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1192919005 X:75685980-75686002 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192931405 X:75810389-75810411 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192985639 X:76396036-76396058 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1192987457 X:76415367-76415389 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1192993540 X:76488136-76488158 CTCTGTAGACTCAACCTCTGGGG - Intergenic
1193011014 X:76674937-76674959 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1193017856 X:76756111-76756133 CTCTGTAGGCTCCAGCTCTGGGG + Intergenic
1193050046 X:77089811-77089833 CTCTATAGACTCAACCTCTGGGG + Intergenic
1193066792 X:77268611-77268633 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1193088729 X:77471168-77471190 CTCTGTAGACTTCACCTCTGGGG + Intergenic
1193267837 X:79494360-79494382 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1193316033 X:80066162-80066184 CTCTGCAGACTCCACCTCTGGGG - Intergenic
1193338602 X:80319791-80319813 CTCTGTAGACTCCACCTCTGAGG + Intergenic
1193367377 X:80651114-80651136 CTCTGTAGACTCCACCTCTGCGG + Intergenic
1193452170 X:81684477-81684499 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1193544353 X:82808388-82808410 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1193613019 X:83655186-83655208 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1193770668 X:85583698-85583720 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1193869764 X:86782508-86782530 TTTTGGACACTATAGCTCTGTGG - Intronic
1194648458 X:96486979-96487001 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1194658138 X:96598167-96598189 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1195203775 X:102574839-102574861 CTCTGTAGACTACACTTCTGGGG + Intergenic
1195215081 X:102691471-102691493 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1195261059 X:103131932-103131954 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1195276212 X:103283042-103283064 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1195340559 X:103902710-103902732 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1195572048 X:106407560-106407582 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1195603122 X:106771344-106771366 CTCTGTAGACTCCACCTCTGGGG - Intronic
1195723550 X:107890708-107890730 CTCTGTAGACTCCATCTCTGGGG - Intronic
1195735887 X:108011948-108011970 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1195787925 X:108547699-108547721 CTCTGTAGACTCCACCTCTGGGG - Intronic
1195826803 X:109010918-109010940 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1195912283 X:109901070-109901092 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1195932831 X:110096277-110096299 CTCTGTAGACTCCACCTCTGGGG - Intronic
1195987418 X:110645606-110645628 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1196139571 X:112246316-112246338 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1196156933 X:112440345-112440367 CCCTGCAGACTGAATCTCTGAGG + Intergenic
1196474704 X:116069037-116069059 CTCTGTAGACTTCACCTCTGGGG - Intergenic
1196658263 X:118242237-118242259 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1196863740 X:120051960-120051982 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1196879359 X:120184370-120184392 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1196901738 X:120390663-120390685 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1196944695 X:120812054-120812076 CTCTGTAGACTGCACCTCTGGGG + Intergenic
1197123340 X:122916257-122916279 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1197239665 X:124109980-124110002 CTCTGTAGACTCCACCTCTGGGG - Intronic
1197241992 X:124129846-124129868 CTCAGGGGCCTAAAACTCTGAGG - Intronic
1197432497 X:126383684-126383706 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1197478024 X:126947304-126947326 CTCTGTAGACTTTATCTCTGGGG + Intergenic
1197486373 X:127056423-127056445 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1197542988 X:127789320-127789342 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1197667726 X:129241392-129241414 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1197678059 X:129352354-129352376 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1197713236 X:129687167-129687189 CTGTGGTGATTAATGCTCTGAGG + Intergenic
1197909201 X:131462131-131462153 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1197915019 X:131525017-131525039 CTCTGTAGACTCAACCTCTGGGG + Intergenic
1198123794 X:133621702-133621724 CTCTGCAGACTCCACCTCTGGGG + Intronic
1198165306 X:134049751-134049773 CTCTGTAGACTGCACCTCTGGGG - Intergenic
1198166421 X:134062243-134062265 CTCTGTAGACTCAATCTCTGGGG - Intergenic
1198172173 X:134117715-134117737 CTCTGTAGACTGCACCTCTGGGG + Intergenic
1198474481 X:136982714-136982736 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1198489334 X:137122959-137122981 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198584542 X:138105805-138105827 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198592436 X:138198826-138198848 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198615698 X:138456381-138456403 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198689043 X:139260076-139260098 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198712835 X:139524086-139524108 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198819632 X:140633438-140633460 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198858543 X:141044830-141044852 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1198904154 X:141542558-141542580 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1199098298 X:143767837-143767859 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1199286112 X:146056136-146056158 CTCTGCAGACTGATGGTCTGAGG - Intergenic
1199302884 X:146233559-146233581 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1199449932 X:147967945-147967967 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1199481705 X:148305307-148305329 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1199486348 X:148352489-148352511 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1199637079 X:149824424-149824446 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1199884610 X:152007306-152007328 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1200269702 X:154670931-154670953 CTCTGTAGACTCCACCTCTGTGG - Intergenic
1200318749 X:155162776-155162798 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1200390123 X:155936289-155936311 CTCTGTAGACTCCACCTCTGGGG - Intronic
1200426991 Y:3032436-3032458 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1200734023 Y:6774575-6774597 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1200751955 Y:6954263-6954285 CTCTGTAGACTCCACCTCTGGGG - Intronic
1200778759 Y:7195560-7195582 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1200833489 Y:7710709-7710731 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1200879143 Y:8194006-8194028 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1201067534 Y:10112540-10112562 CTCTGTAGACTCTACCTCTGGGG - Intergenic
1201245829 Y:12003036-12003058 CTCTGTAGACTCCACCTCTGAGG - Intergenic
1201263318 Y:12181375-12181397 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1201347884 Y:13004765-13004787 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1201393086 Y:13519896-13519918 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1201522217 Y:14888119-14888141 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1201602599 Y:15747919-15747941 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1201620045 Y:15946548-15946570 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1201690806 Y:16762591-16762613 CTCTGTAGACTCCAGCTCTGGGG + Intergenic
1201916787 Y:19190704-19190726 CTCTGGAGACTCCACCTCTGGGG - Intergenic
1201945888 Y:19509669-19509691 CTCTGCAGACTCCAACTCTGGGG - Intergenic
1202022258 Y:20477695-20477717 CTCTGTAGACTCCACCTCTGGGG + Intergenic
1202040236 Y:20675011-20675033 CTCTGTAGACTCCACCTCTGTGG + Intergenic
1202055560 Y:20826464-20826486 CTCTGTAGGCTCCAGCTCTGGGG - Intergenic
1202085176 Y:21129112-21129134 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1202242073 Y:22781243-22781265 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1202395057 Y:24414987-24415009 CTCTGTAGACTCCACCTCTGGGG - Intergenic
1202475727 Y:25255105-25255127 CTCTGTAGACTCCACCTCTGGGG + Intergenic