ID: 1143080845

View in Genome Browser
Species Human (GRCh38)
Location 17:4380338-4380360
Sequence TTTTATTTTTAGTAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143080832_1143080845 28 Left 1143080832 17:4380287-4380309 CCTCCCGAGTAGCTGGGAATAAA No data
Right 1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG No data
1143080835_1143080845 24 Left 1143080835 17:4380291-4380313 CCGAGTAGCTGGGAATAAAAGGA No data
Right 1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG No data
1143080837_1143080845 -3 Left 1143080837 17:4380318-4380340 CCACCATGCCTGGCTAATTTTTT 0: 14129
1: 68768
2: 138540
3: 195157
4: 181262
Right 1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG No data
1143080833_1143080845 25 Left 1143080833 17:4380290-4380312 CCCGAGTAGCTGGGAATAAAAGG No data
Right 1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG No data
1143080838_1143080845 -6 Left 1143080838 17:4380321-4380343 CCATGCCTGGCTAATTTTTTTAT 0: 659
1: 28889
2: 70588
3: 139099
4: 172898
Right 1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143080845 Original CRISPR TTTTATTTTTAGTAGGTGGG GGG Intergenic
No off target data available for this crispr