ID: 1143090093

View in Genome Browser
Species Human (GRCh38)
Location 17:4444978-4445000
Sequence CTGCCCTGCCACGGTCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143090086_1143090093 -4 Left 1143090086 17:4444959-4444981 CCTGGGCCTGCTGGGCCATCTGC 0: 1
1: 0
2: 9
3: 60
4: 500
Right 1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 102
1143090084_1143090093 1 Left 1143090084 17:4444954-4444976 CCTTCCCTGGGCCTGCTGGGCCA 0: 1
1: 0
2: 4
3: 69
4: 521
Right 1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 102
1143090085_1143090093 -3 Left 1143090085 17:4444958-4444980 CCCTGGGCCTGCTGGGCCATCTG 0: 1
1: 1
2: 1
3: 29
4: 352
Right 1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 102
1143090087_1143090093 -10 Left 1143090087 17:4444965-4444987 CCTGCTGGGCCATCTGCCCTGCC 0: 1
1: 0
2: 1
3: 51
4: 442
Right 1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 102
1143090078_1143090093 27 Left 1143090078 17:4444928-4444950 CCAGCTTGTGGCATCTGAGTCAG 0: 1
1: 0
2: 2
3: 15
4: 147
Right 1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143090093 Original CRISPR CTGCCCTGCCACGGTCGTGG GGG Intronic