ID: 1143090941

View in Genome Browser
Species Human (GRCh38)
Location 17:4448873-4448895
Sequence CTGGAGAATGTGATGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143090941 Original CRISPR CTGGAGAATGTGATGCTGGA TGG Intronic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
902708437 1:18222413-18222435 CTGGAGAGTGGAATGCTGGAGGG + Intronic
904686446 1:32264274-32264296 TAGGAGAATGTGAGGCAGGAAGG - Intronic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
906112661 1:43334729-43334751 CAGGAGAATGTGACATTGGAAGG + Intergenic
907796035 1:57718370-57718392 ATGGATGATGTGATGCTGAACGG + Intronic
909697519 1:78484165-78484187 CTGGAGCCAGTGAGGCTGGATGG + Intronic
910536184 1:88300489-88300511 CAGGAGAGAGAGATGCTGGAGGG - Intergenic
910906164 1:92181480-92181502 CTGAAGACTATGATGCTGGAGGG + Exonic
911242767 1:95483469-95483491 CTGGAGCTGGGGATGCTGGATGG + Intergenic
912750252 1:112281558-112281580 CCTGAGAAAGTGATGTTGGAAGG - Intergenic
912839350 1:113025336-113025358 CTGGAAAATGTGGGGCTGGTGGG + Intergenic
915033172 1:152901582-152901604 CTGGGGATTCTAATGCTGGAGGG - Intergenic
915597202 1:156902452-156902474 CTGGAGATTTGGCTGCTGGAGGG + Intronic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
917951013 1:180036381-180036403 CTGGAGCATGTAATGCTGTTTGG - Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920050101 1:203159230-203159252 GTGGAGAATGTGTTGCAGCAGGG - Intronic
920099609 1:203508659-203508681 CTGGAGAATGTGATGCCCGCTGG - Exonic
920850424 1:209624546-209624568 GTGGAGAATGTGAGGCTTGGAGG - Intronic
921283826 1:213591477-213591499 TGGGATAATGTGCTGCTGGAGGG - Intergenic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
921608160 1:217179104-217179126 GTGGGGAATGTGAAACTGGAAGG - Intergenic
922954185 1:229585523-229585545 CTGTAGAATGTGATGCAAGGAGG - Intergenic
923334431 1:232954941-232954963 CTGGAGAAGATGATGTTGGAAGG + Intronic
924741110 1:246794598-246794620 CGGGAGAATGAGAGGCTGCATGG - Intergenic
1062933227 10:1366393-1366415 CTGGTGAATGTGCTTCTGGAAGG + Intronic
1063699874 10:8373850-8373872 CTGGAGAATATTATGCTAGATGG - Intergenic
1063722077 10:8594288-8594310 CTTGAGAATGAGTTTCTGGAAGG - Intergenic
1064268494 10:13844703-13844725 CTGGAGAATGTGTTTCTCCAGGG + Intronic
1066616198 10:37297475-37297497 CTGTAGAATGTGACACTGAAAGG + Intronic
1066696856 10:38086686-38086708 CTGGAGACTGAGATGCTTCAGGG + Intergenic
1066995704 10:42561032-42561054 CTGGAGACTGAGATGCTGCAGGG - Intergenic
1068813504 10:61283326-61283348 CGGGAGGAAGTGATGGTGGAGGG + Intergenic
1068931525 10:62595346-62595368 GTGGAGGATGTGTGGCTGGAAGG - Intronic
1069853154 10:71423578-71423600 CTGGAGAATGGGATGAGGGGAGG + Intronic
1074636339 10:115322680-115322702 TAGGAGAATGAGATGCTAGAAGG - Intronic
1075155286 10:119971193-119971215 CTGCAGAGTGTGGGGCTGGAGGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1075847888 10:125560833-125560855 CTGTAGCATGTGATGCTGTTTGG - Intergenic
1075874452 10:125794950-125794972 CTAAAAAATGTGATGCTGGCTGG + Exonic
1075911530 10:126129293-126129315 CTGGAGCATGAGCTCCTGGAGGG - Intronic
1076854618 10:133109693-133109715 CTGGAGAATATGAACCAGGAGGG - Intronic
1077347138 11:2066803-2066825 GTGGAGAATGTTATGTTGAATGG - Intergenic
1078137054 11:8660242-8660264 CTGGAGTATGGGATGCTTGAAGG - Intronic
1078175867 11:8969956-8969978 CTGGAGGACGTTATGCTGAATGG - Intergenic
1078325713 11:10379105-10379127 CTGGGGAATGTGGTGGTGGTAGG + Intronic
1079374314 11:19878647-19878669 CTGGAGAAAGGGATGCTCCAAGG + Intronic
1079858801 11:25641702-25641724 CTGGAGAATGGGCTGCAGGCAGG - Intergenic
1081944831 11:46982177-46982199 CTTGAGATTGAGATGCTGGATGG - Intronic
1083547470 11:63559559-63559581 TTGGAGAATTTAAAGCTGGAGGG - Intronic
1083921705 11:65784543-65784565 CGAGAGAATGTGATGGTGGCAGG - Intergenic
1084672322 11:70614667-70614689 CTGGAGGATGGGATGAAGGAAGG - Intronic
1084872595 11:72108224-72108246 CTGGGGACTGTGATGCTGGATGG + Intronic
1085714051 11:78856114-78856136 CTGGAGAAATTGATGTGGGAAGG - Exonic
1085715909 11:78873091-78873113 CTGGAGACTGGGAAGCTGTAGGG - Intronic
1085927862 11:81043548-81043570 CTGTAGAATGTGATGTTGTTTGG + Intergenic
1086105110 11:83139010-83139032 CTGGAGAAGGTGATGATTAAGGG - Intergenic
1086846444 11:91755582-91755604 CTAGTTAAGGTGATGCTGGAGGG - Intergenic
1086959620 11:92969267-92969289 CTGGAGAAGGTGCTGATGGTAGG - Intergenic
1088316317 11:108510291-108510313 CTGGTGAATGTGATGGGTGATGG + Exonic
1088544520 11:110946174-110946196 CTTGAGAAAGTGCTGCTGGCTGG - Intergenic
1088993834 11:114978510-114978532 GTGGAGGATGTGTGGCTGGATGG + Intergenic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1089717491 11:120375957-120375979 CTGGAGTATGGGTTGTTGGAAGG + Intronic
1091579703 12:1776660-1776682 CTCTAGAATCTGATGCGGGAGGG + Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092993180 12:13922957-13922979 CTGGAATAAGTGATGCTAGATGG - Intronic
1095466611 12:42494305-42494327 CTGTAGCATGTGATGCTGTTTGG + Intronic
1095605860 12:44066874-44066896 CTGTAGCATGTGATGCTGTTTGG + Intronic
1096263711 12:50108036-50108058 CTGGAGAAAGAGTTGCTGAATGG + Exonic
1098583735 12:72132221-72132243 CTGGAGACTGTGAGGCTAGCTGG + Intronic
1099567891 12:84276348-84276370 CTGCCAAATGGGATGCTGGAGGG - Intergenic
1099648953 12:85399589-85399611 GAAGAGAATGTGGTGCTGGACGG + Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1100916979 12:99435314-99435336 CTAAAGAATGAGATGCTTGAAGG + Intronic
1101011281 12:100452568-100452590 ATGGAGAATGGGATCCGGGAGGG + Intergenic
1101716071 12:107313693-107313715 CTGGTGTAAGTGATGCTGGGAGG - Intergenic
1101782741 12:107850029-107850051 CTGGAGAATCTGGGGCAGGAGGG - Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102846411 12:116189145-116189167 CTGGAGAGGATGTTGCTGGAGGG - Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1104399215 12:128461828-128461850 CTGGAGAATGGAGTTCTGGAAGG - Intronic
1105480444 13:20770953-20770975 CTGGGGAATTTGAGGCTGCAGGG - Intronic
1105707889 13:22979848-22979870 TTGGAGAATTTAATGCTGGGAGG - Intergenic
1106171737 13:27294576-27294598 CTCCAAAATGTGATTCTGGAGGG - Intergenic
1106239932 13:27903394-27903416 TTGGAGTATGTGATGCTTGGGGG + Intergenic
1106758363 13:32844430-32844452 CTAGAGAAAGTGATACTGAAAGG - Intergenic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1111949003 13:94694951-94694973 CTGAAGAAAGTGTTTCTGGAAGG + Intergenic
1113045736 13:106152785-106152807 GTGGAGAATGTGAGGCTGAGGGG + Intergenic
1113098839 13:106695448-106695470 CTGGAGAATGGGATGATAGAGGG + Intergenic
1113445504 13:110363244-110363266 CTGGAGACTATGCTTCTGGAAGG + Intronic
1114080730 14:19200086-19200108 CTGGACAATGTGCTGTAGGAAGG - Intergenic
1114490087 14:23095081-23095103 CTGGAGGAGGTGACTCTGGACGG - Exonic
1114704259 14:24709509-24709531 CTGGAGACTGTAATTCTGAAAGG + Intergenic
1115107025 14:29773900-29773922 TTGGAGAATGAGGTCCTGGAGGG - Intronic
1116802885 14:49461816-49461838 CTACAGAATGTGCTTCTGGAAGG - Intergenic
1117518609 14:56527888-56527910 CTGGCCAATGAGATGCTGGATGG + Intronic
1117688836 14:58284192-58284214 CTGCAGCATATGATGCTTGAAGG + Intronic
1118767714 14:68921279-68921301 CTGGAGAATGTCACCCTGGCAGG + Intronic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121924684 14:97916946-97916968 CTGCAGAATGTTGTGCTGGCTGG - Intergenic
1122468546 14:101950528-101950550 CTGAAGGATGGGATCCTGGATGG - Intergenic
1122932823 14:104942606-104942628 CTGGACAGTGTGCGGCTGGAGGG - Exonic
1122934568 14:104950031-104950053 CTGGACAGTGTGCGGCTGGAGGG - Exonic
1123450009 15:20353836-20353858 CAGGGGAATGTGATTCCGGATGG - Intergenic
1126240470 15:46436691-46436713 CTGTAGCATGTGATGCTGTTTGG - Intergenic
1128801193 15:70498151-70498173 CTGGACGGTGAGATGCTGGAGGG + Intergenic
1129355272 15:74986638-74986660 CTGGAGAATGTGATACTTTTGGG + Intronic
1130175942 15:81570919-81570941 CTGAAGAATGGGTTGCAGGAGGG - Intergenic
1130973348 15:88752950-88752972 CTTGAGAATGTTATGTTGGGTGG - Intergenic
1132565247 16:619475-619497 CTGGCGAATGTGAGGCCGGAAGG + Intronic
1135407862 16:22210964-22210986 ATGGAAAATGGGCTGCTGGACGG + Intronic
1136173247 16:28500769-28500791 CAGGAGAATGTGAAGATTGAGGG + Intronic
1136472832 16:30493367-30493389 CAGGAGAATGTGAACCTGGGAGG - Intronic
1137828781 16:51524315-51524337 CTGGAAAATGTGGTCCTGGAAGG - Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140170414 16:72598736-72598758 CTGGAGAATGGGAGGAGGGAGGG + Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1140510237 16:75502322-75502344 CTGGACCACGGGATGCTGGAGGG + Intergenic
1140516003 16:75542388-75542410 CTGGACCATGGGATGCTGGAGGG + Intronic
1140668257 16:77247946-77247968 CTGGGGAATCTGCTTCTGGAAGG + Intronic
1140728521 16:77835431-77835453 CTGGACCATGGGATGATGGATGG - Intronic
1141447237 16:84068980-84069002 CTGGAGTCTGTGCTGCTGGGAGG - Intronic
1141461992 16:84183251-84183273 CTGGAGAATTTCAAGCTGGAGGG - Exonic
1142278449 16:89135353-89135375 CTGGAGCATGTGCTGCTGTGAGG + Intronic
1142494170 17:297529-297551 CTGGAGAATGTGCTGCGGATCGG + Intronic
1142551259 17:741439-741461 CAGTAGAATGGGATGCTGAAGGG - Exonic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143864040 17:9911186-9911208 CTGCTGCAGGTGATGCTGGAAGG + Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144390865 17:14792183-14792205 CTGGAGGAGGTGATGCTTCAAGG - Intergenic
1144575930 17:16429510-16429532 CAGGACAATGTGATGCAGAATGG + Intronic
1145979407 17:29002954-29002976 CTTGAGAATGTGGTGATAGAGGG - Intronic
1146563091 17:33888577-33888599 GTTGAAAATGTGATGCTGGCAGG + Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1147656914 17:42096339-42096361 ATGGAGAATGTGGTCTTGGAGGG + Intergenic
1148868249 17:50640425-50640447 CTGGCCAATGTGCTTCTGGAAGG - Intronic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1149688239 17:58551339-58551361 CTGTTGAATGTGAGACTGGATGG + Intergenic
1151275398 17:73030296-73030318 CAGCTGAATGTGATGTTGGACGG - Intronic
1151936654 17:77266098-77266120 CTGGAGGATGAGATTCTAGATGG + Intergenic
1152338634 17:79712051-79712073 CAGGGGAATGTGATTCTGGATGG + Intergenic
1153288386 18:3477350-3477372 CTGTAGCATGTGATGCTGTTTGG - Intergenic
1153749753 18:8216900-8216922 CTGGAGAATCTGTTGAAGGAGGG + Intronic
1154315818 18:13302453-13302475 CTGGGGAATGGGATACTTGAGGG + Intronic
1155618303 18:27746522-27746544 GTGGGGAATGAGATACTGGAAGG + Intergenic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1158395673 18:57077103-57077125 CTGGAGAGTGAGCTGCTGCAGGG + Intergenic
1158729181 18:60003803-60003825 CTGGAGACAGGGAAGCTGGACGG - Intergenic
1160719829 19:592233-592255 CTGTCGAAGGTCATGCTGGAGGG - Intronic
1162573224 19:11484199-11484221 CTGCAGACTCTGATGCTAGAAGG + Intronic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1164163871 19:22650752-22650774 CTGGAGCCAGGGATGCTGGACGG - Intronic
1164576426 19:29407966-29407988 CTCGAGATTGTGTGGCTGGAAGG + Intergenic
1165470844 19:36003622-36003644 CTCCAGGATGTGAGGCTGGAGGG - Exonic
1165738069 19:38189959-38189981 CTGGAGGGTGTGATTCTGGGTGG + Intronic
1166010062 19:39935217-39935239 CTGGAGAGTTTGGTCCTGGAAGG + Intergenic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166852150 19:45766174-45766196 GTGGAGACTGTGCAGCTGGAGGG + Intronic
1167348730 19:48962445-48962467 CTGGCGACTGAGAGGCTGGAGGG + Intergenic
1167769915 19:51508659-51508681 CTGGAGCATCTGAGGCTGGAAGG - Intergenic
1168479038 19:56701809-56701831 CTGTAGCATGTGATGCTGTTTGG + Intergenic
926395503 2:12438300-12438322 CTGGAGATTCTGATTCAGGAGGG + Intergenic
926844784 2:17124209-17124231 CTGGAGTGTATGATGTTGGATGG + Intergenic
927459771 2:23287963-23287985 GAGGAGAATGTGCTTCTGGAAGG + Intergenic
927664978 2:25025124-25025146 CTGGAGAAATTGATGAGGGAAGG + Intergenic
928408812 2:31038004-31038026 CTGGAGAATGAGATGCCACAGGG - Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929252305 2:39772427-39772449 GTGTAGAATGTGATGCTAGAGGG + Intronic
929669107 2:43855029-43855051 CAGGAGAATGTCTGGCTGGAGGG - Intronic
929842303 2:45480780-45480802 CTGTAGCATGTGATGCTGTTTGG - Intronic
929842309 2:45480891-45480913 CTGTAGCATGTGATGCTGTTTGG - Intronic
931160690 2:59687124-59687146 CAGGTGACTGTGCTGCTGGAGGG + Intergenic
931431134 2:62209790-62209812 CTGCAGGCTGTGATGTTGGAGGG + Intronic
931905576 2:66839191-66839213 CAGGAGAATGTAATCCAGGAGGG + Intergenic
932445809 2:71780432-71780454 CTGGAGAATATGATCCTGACTGG - Intergenic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
933121057 2:78539004-78539026 CTGGAGAAGGAAATGATGGAAGG + Intergenic
934726567 2:96624283-96624305 CTTGAGAATTTGATGGTGGTAGG + Intronic
936271551 2:111053133-111053155 TTGCAGAGTGTGATGCTGGAAGG - Intronic
937299544 2:120830672-120830694 CTGGAGAATGTGCAGGTGGCTGG + Intronic
938172172 2:129088842-129088864 CTGGAAAATGTGAGGCTGGGAGG - Intergenic
941662437 2:168209045-168209067 GTGGAGAATGTGATTCTGGGTGG - Intronic
942284218 2:174397686-174397708 CTGGACAATGAGATCCTTGAGGG - Intronic
944219152 2:197285124-197285146 CTGCAGAATGTGATGTGGGTGGG - Intronic
944317951 2:198303496-198303518 CTGGACCATGTGAAGCTGGAAGG - Intronic
946901410 2:224376119-224376141 CTGGAGCATGTGATGCTGTTTGG - Intergenic
948184982 2:236013975-236013997 GTGGAGAATGTGTCTCTGGAGGG + Intronic
948405521 2:237715542-237715564 GTGTAGAATGTGAAGCTAGAAGG + Intronic
948988824 2:241541637-241541659 CTGGAGAGCGAGATGCTGGACGG - Intergenic
1168900947 20:1364335-1364357 CTGGAAAAAGTGATGGTTGATGG + Intronic
1169298781 20:4423871-4423893 CAGGAGAAGGTGATGCTGAGTGG + Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169523527 20:6398707-6398729 CTGGAGAAAGTTTTGCTGGTTGG - Intergenic
1169869238 20:10233594-10233616 TTGGATAATGGGATGCAGGAAGG + Intronic
1171148988 20:22810377-22810399 CTGGAGAGTTTGATGCTCGGTGG + Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1174907417 20:54566073-54566095 CTGGAGGATGTGATTATGAAAGG - Intronic
1175242045 20:57556904-57556926 CTGTAGAATGCCATGCAGGATGG - Intergenic
1175544408 20:59768973-59768995 TGGGAGAATGTGCTGCTGGGTGG + Intronic
1175801979 20:61806093-61806115 CTGCAGGATGTCATTCTGGAAGG + Intronic
1176428594 21:6563148-6563170 CTGGAGAAGGTGGTGCTGGGGGG + Intergenic
1178373349 21:32046314-32046336 CTGGAGAACGTGATGATTCAGGG - Intergenic
1178400915 21:32283874-32283896 CTGGTGACTGTGACCCTGGATGG - Intergenic
1178502159 21:33134476-33134498 CTGCAGACTATGCTGCTGGAAGG + Intergenic
1179027017 21:37687186-37687208 CTGGAAAATTGGCTGCTGGAAGG + Intronic
1179051731 21:37894218-37894240 CTGGTGATTGTGATGTTGCAAGG - Intronic
1179314308 21:40227915-40227937 ATGTAGAATGGGATCCTGGATGG - Intronic
1179704084 21:43171464-43171486 CTGGAGAAGGTGGTGCTGGGGGG + Intronic
1180614690 22:17119881-17119903 CTGGTGGAGCTGATGCTGGAGGG - Exonic
1181062204 22:20286895-20286917 CTAGAGAATGTGCTGTTGGTAGG + Intergenic
1182328892 22:29536313-29536335 CTGGAGATTGTGAGGCCGGTGGG + Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950580851 3:13861226-13861248 GTGGAGGATCTGATCCTGGAGGG - Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950691241 3:14659852-14659874 CTGGAGAAAGGGATCCTGCAGGG + Intronic
950891109 3:16405177-16405199 CTGGAGACTGTGTGGCTGGCAGG - Intronic
951120484 3:18921072-18921094 CTGGAGAGTGGGATTCTGGGAGG + Intergenic
951994252 3:28709420-28709442 CTGGAGAAAGTGATGCTCAACGG + Intergenic
952210149 3:31222273-31222295 CTGGAGAATATGGTGGCGGATGG - Intergenic
952307572 3:32159580-32159602 TTGGAGAAGGAGATGCTGAATGG + Exonic
952989812 3:38821839-38821861 CTGGAGAATGTGCTGCAGAGTGG - Intergenic
954327905 3:49873552-49873574 CTGGCCAATGTGGTACTGGACGG - Intergenic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
955240443 3:57173525-57173547 CTGGAGAGTGAGTTCCTGGAGGG - Intergenic
956039718 3:65133113-65133135 CAGAAGAATATAATGCTGGATGG - Intergenic
956167280 3:66406212-66406234 GTGGAGATTCTGCTGCTGGAAGG + Intronic
956784953 3:72634875-72634897 CTGCTGGATATGATGCTGGATGG - Intergenic
956810866 3:72862811-72862833 CTGGAGAAAGTAACCCTGGAAGG + Intergenic
958539297 3:95449706-95449728 CTGGAGGATGTAATTCTGGTTGG - Intergenic
958698919 3:97563259-97563281 TTGGAGAATTTGATGTTGGAGGG + Intronic
961384743 3:126517171-126517193 CTGGAGAACGTGCGGCTGCATGG - Intronic
962876717 3:139540950-139540972 CTGGGGAAGGTGGTGCTAGAGGG - Intergenic
963004092 3:140710005-140710027 CTGGAGGCTGTGATGCATGAGGG + Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
964831208 3:160886017-160886039 CTGGAGCCAGTGAGGCTGGATGG + Intronic
966437396 3:179904207-179904229 ATGGAGAAAGCAATGCTGGAGGG - Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967683695 3:192395617-192395639 CTGGAGAGTGAGTTCCTGGAGGG - Intronic
967787632 3:193514631-193514653 CTGGACAATGTGTTACGGGATGG - Intronic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
971906806 4:32736569-32736591 CTTGATAATATGTTGCTGGATGG + Intergenic
972228336 4:37041134-37041156 CTGAATTATGTGAGGCTGGATGG - Intergenic
975489238 4:74970366-74970388 GTGGACCATGTGAGGCTGGACGG + Intronic
976475645 4:85479592-85479614 AAGGAGAATGTGGAGCTGGATGG + Intronic
977257424 4:94756968-94756990 CTGGAGAGTGGGAAGCTGAAAGG + Intergenic
978325862 4:107553577-107553599 CTTCAGAATGTGATGTGGGAAGG - Intergenic
978530387 4:109706593-109706615 CTGTAGCATGTGATGCTGTTTGG - Intergenic
981412307 4:144446984-144447006 CTGTAGCATGTGATGCTGTTTGG + Intergenic
983214160 4:164987424-164987446 CTGGAGGATTTGATGCTGGCAGG + Intergenic
984603630 4:181758142-181758164 CTCCAGAATGTGACGATGGATGG + Intergenic
985514606 5:335034-335056 CTGGGGACTGGGATGCTGGGTGG + Intronic
985539110 5:479612-479634 CTGGTGACTGTGGTGCTGGTGGG - Intronic
985811050 5:2085928-2085950 CAGTAGAAAGTGATACTGGATGG + Intergenic
987238710 5:15970393-15970415 ATGGTGAGTGTGTTGCTGGAGGG - Intergenic
988059495 5:26148866-26148888 CTGGAGCCAGGGATGCTGGACGG + Intergenic
988077196 5:26367857-26367879 CTGCAGCATGTGAAACTGGATGG - Intergenic
988329876 5:29822425-29822447 CTGAACAATGTAACGCTGGAGGG - Intergenic
989457111 5:41657231-41657253 CTGGAAAATTTGTTGCTGGTAGG - Intergenic
993277280 5:85876872-85876894 CTGGAGAATCTGAACCTGGGAGG - Intergenic
993674702 5:90802775-90802797 CTGGTGACTGTGATGCTTGTCGG + Exonic
993752498 5:91688368-91688390 CTGAAGAATGTGATGAAGAATGG + Intergenic
996847482 5:127915978-127916000 CTGTAGCATGTGATGCTGTTTGG + Intergenic
996914504 5:128695988-128696010 AGGGAGACTGTGAGGCTGGAAGG - Intronic
997109028 5:131054100-131054122 CTTGAGAATGTGATGCTTCGGGG + Intergenic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998189185 5:140007979-140008001 CTGGTGACTGAGATGCTGTAAGG - Intronic
998402551 5:141855585-141855607 CGGGAGCATGTGAAGCTTGAGGG - Intronic
999458323 5:151736614-151736636 CTGGGGAATGTGGCTCTGGATGG - Intergenic
1000178249 5:158780148-158780170 CTGTAGAATTTATTGCTGGAAGG + Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001817366 5:174681199-174681221 AAGGAGAATGGGTTGCTGGAAGG - Intergenic
1004020961 6:11775226-11775248 GTAGAGAAGGTGATGCAGGAGGG - Intronic
1004288380 6:14344166-14344188 CTGTAACATGTGATCCTGGAGGG + Intergenic
1005276481 6:24224688-24224710 CTGGAGAAAGGAATGCTTGAAGG - Intronic
1006155360 6:32010443-32010465 GTGGTGAAGGTGATGCTGGCTGG + Intergenic
1006161666 6:32043177-32043199 GTGGTGAAGGTGATGCTGGCTGG + Exonic
1006888326 6:37400765-37400787 CTGGAGAAAATGCAGCTGGATGG + Intergenic
1006906132 6:37535101-37535123 CTGCAGAATGTTCTGCGGGAAGG + Intergenic
1008437783 6:51496458-51496480 CTGGAGAAGGGGATACTGGCAGG - Intergenic
1010116845 6:72322844-72322866 CTGGAAATTGTGAGGGTGGAAGG + Intronic
1011324137 6:86130115-86130137 CTGGGGATTGTGGTGCTGGGTGG - Intergenic
1012468679 6:99545398-99545420 CTGAAAAATGAGATGCTAGAAGG - Intronic
1013191292 6:107806295-107806317 CTGGAGGAGGTGATCCTTGAAGG + Intronic
1015606006 6:134955294-134955316 CTGGAGGATCTGCTGCTGCATGG - Intergenic
1015991241 6:138945620-138945642 CTGAAGAATATGAGGCTGCATGG + Exonic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016931684 6:149417337-149417359 CTGTAGAATGTGATGCTGTTTGG - Intergenic
1017821713 6:158053836-158053858 CAGGTGAATGTGAGGATGGATGG - Intronic
1018460543 6:163994668-163994690 CTGAAGAATGTGGAGCTGGCGGG - Intergenic
1018764734 6:166924646-166924668 CTGGTGCATTTGATGCTGGTAGG - Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018935120 6:168269201-168269223 CTGGTGACTGCGATGCAGGAAGG + Intergenic
1019612607 7:1944623-1944645 CTGGGAAATGTGAGGCTGAAGGG + Intronic
1022472527 7:30690623-30690645 GTGGAGAACGTGATGTTTGAGGG - Intronic
1029083594 7:97994154-97994176 CTGGGCAAGGTGATGCTGGTTGG - Intergenic
1029512486 7:101004823-101004845 CTGGAGCTTGTCATGCTGGCAGG - Exonic
1030531830 7:110720641-110720663 CTGGGGAATATGATACTGGCTGG + Intronic
1032933686 7:136703960-136703982 CAGGAGAATCTGATGATGGCAGG + Intergenic
1033375363 7:140756359-140756381 CTGTAGAATGAAAGGCTGGAAGG + Intronic
1033582784 7:142752056-142752078 CTGGAAATTGTGAGGATGGAGGG - Intronic
1033584341 7:142762976-142762998 CTGGAAATTGTGAGGATGGAGGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034838460 7:154373907-154373929 CTGGAGGATGTTATGCTACACGG - Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035491683 7:159284830-159284852 CTGGAGCCAGAGATGCTGGATGG + Intergenic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1037346285 8:17904868-17904890 CTGCAGAAGGTAATGATGGATGG + Intronic
1037928402 8:22863192-22863214 ATGGAGAATGAGATGCAGAAAGG + Intronic
1038839315 8:31166303-31166325 CAGAAGAATGTGATGTTGGAAGG + Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039196367 8:35035929-35035951 AGGGAGATTGTGATGATGGATGG + Intergenic
1040663120 8:49598258-49598280 CTGAAGCATGTAACGCTGGACGG - Intergenic
1040784511 8:51149669-51149691 CTGGACTATTGGATGCTGGAAGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1043277536 8:78418635-78418657 CTAGTGAATGGAATGCTGGACGG - Intergenic
1044529302 8:93289749-93289771 CTGGGGAGTGTGAGCCTGGAGGG + Intergenic
1044889331 8:96816101-96816123 CTGGAGTATGTGATGGTGTTTGG + Intronic
1045037336 8:98185797-98185819 CTGGAGAGTGAGATTTTGGATGG + Intergenic
1047806465 8:128366220-128366242 ATTGAGGAAGTGATGCTGGAAGG - Intergenic
1048260279 8:132939328-132939350 CTGGAGAATCACATGCTGTAGGG + Intronic
1050595970 9:7205075-7205097 CTGCAGGATGTGAATCTGGAAGG - Intergenic
1050669950 9:7984761-7984783 CAAGAGAATGTGATGTTGGTAGG + Intergenic
1051484503 9:17593413-17593435 CTGCAGAATGGGTTGCTGGTAGG + Intronic
1051601574 9:18879823-18879845 CTGTAGCATGTGATGCTGTTTGG + Intronic
1054803419 9:69375636-69375658 CTGTAGAATGAGATGATGGCAGG - Intronic
1056781846 9:89556328-89556350 CTGGAGGAGGTGGTCCTGGAAGG + Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057838770 9:98468168-98468190 CTGAAGAACGTGCTTCTGGAGGG + Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1058823417 9:108753740-108753762 ATGGAGACTGGGATGATGGATGG - Intergenic
1059596286 9:115724142-115724164 CTGGAGCCAGTGATGCTGGATGG + Intergenic
1060182026 9:121541062-121541084 CTGGAGCTAGTGATGCTGGAAGG - Intergenic
1062025843 9:134340273-134340295 CAGGAGAATGAGAAGCTGTAGGG + Intronic
1062097776 9:134711831-134711853 CTGGAGAACGAGACGCTGAAAGG - Intronic
1186666114 X:11719404-11719426 CTGGAAAAGGTAATGCTGGGTGG + Intergenic
1187176144 X:16897915-16897937 ATGGAGAGAGTGAGGCTGGAGGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1189624674 X:42883773-42883795 CTGGAGAACATGATGATGCATGG + Intergenic
1192746652 X:73945469-73945491 CTAGAGAATCTTATGATGGATGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1196484015 X:116182629-116182651 CTGGGGAATGGAATGCTTGATGG - Intergenic
1198878610 X:141254545-141254567 CTAGGGAATGTGATGCTTTATGG - Intergenic
1198952331 X:142085795-142085817 ATGGAGAATATTATGTTGGAAGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1200978427 Y:9238623-9238645 CTGGAGAATGTGAAACTAGCTGG + Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic