ID: 1143091690

View in Genome Browser
Species Human (GRCh38)
Location 17:4452761-4452783
Sequence TGGGATCCCCAGGATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143091686_1143091690 -10 Left 1143091686 17:4452748-4452770 CCCACATGGCCAGTGGGATCCCC 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1143091690 17:4452761-4452783 TGGGATCCCCAGGATGAGACAGG 0: 1
1: 0
2: 4
3: 41
4: 231
1143091682_1143091690 10 Left 1143091682 17:4452728-4452750 CCTGGGGTGCAGGGTGATCACCC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1143091690 17:4452761-4452783 TGGGATCCCCAGGATGAGACAGG 0: 1
1: 0
2: 4
3: 41
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143091690 Original CRISPR TGGGATCCCCAGGATGAGAC AGG Intronic
900545175 1:3224728-3224750 TGGGCTCCACAGGATGACAGGGG + Intronic
901686869 1:10948049-10948071 CGGGATGCCCAGGGTGAGGCTGG - Exonic
901917355 1:12510057-12510079 TGGAAACCCCAGGATGAGAAGGG + Exonic
902513573 1:16978723-16978745 TGGGGTCCCAAGGATGGGCCTGG - Intronic
902881177 1:19372801-19372823 TGACATCCCCTGGATGAGTCAGG + Intronic
903539716 1:24090111-24090133 GGGGATCTCTAGGATGAGAAGGG + Exonic
903709613 1:25313145-25313167 TGGGGCCCCTATGATGAGACTGG + Intronic
903717503 1:25379240-25379262 TGGGGCCCCTATGATGAGACTGG - Intronic
905657351 1:39693171-39693193 TGGGAGGCCCAGAATGAGAAGGG - Intronic
906667498 1:47631997-47632019 TGGGCTCTCCAGGATGAGAAGGG + Intergenic
907277067 1:53322628-53322650 TGGGAGCCCCAGGAGGACTCTGG + Intronic
908141686 1:61191656-61191678 TGGCATCACCAGGCTGAGAAGGG - Intronic
908454621 1:64291094-64291116 TGGGAGCTCAAGGATGAGAATGG + Intergenic
909031836 1:70550443-70550465 TGGAATTTCCATGATGAGACTGG - Intergenic
910629296 1:89339754-89339776 TGGGATCCCAATGATGAGATGGG + Intergenic
911687894 1:100798016-100798038 TGGGGCCCCTATGATGAGACTGG + Intergenic
912078995 1:105912210-105912232 TGGGATCCTAATGATGAGATGGG + Intergenic
912159148 1:106959866-106959888 TGGGTTCCACAGGATGATATAGG - Intergenic
915301337 1:154953263-154953285 TGGGAACCCCTGGAAGAGACCGG - Intronic
915313519 1:155016150-155016172 TGGGATGACCAGGAGGAGCCAGG + Intronic
915482587 1:156197245-156197267 TGGGTCCCCCAGGCTGAGGCTGG + Intronic
920514990 1:206578711-206578733 GGGGGTCCCCAGGATGAGGGTGG - Intronic
922011797 1:221596225-221596247 TGCGATCAGCAGGAGGAGACAGG - Intergenic
923450647 1:234113988-234114010 TCGGCTCTCCAGGAGGAGACTGG + Intronic
924263157 1:242252634-242252656 TGGGATCCCCAGAATCATAAGGG - Intronic
924650868 1:245926119-245926141 TGGGAACCCCATGATGAGATTGG - Intronic
1063902171 10:10745518-10745540 TCGAAGCCCCAGGAGGAGACAGG - Intergenic
1066721632 10:38345802-38345824 TGGGATCCCCAGAATCATAAGGG + Intergenic
1067348640 10:45456226-45456248 TGGGGTCCCCAGGCTGAGAAGGG + Exonic
1067429882 10:46236050-46236072 TGGGACCATCAGGCTGAGACTGG - Intergenic
1067443758 10:46327769-46327791 TGGGACCATCAGGCTGAGACTGG + Intronic
1068395265 10:56453252-56453274 TTGAATCCCAGGGATGAGACAGG + Intergenic
1069526511 10:69176722-69176744 TGGGTCCCCCATGATGTGACTGG + Intergenic
1069626162 10:69868951-69868973 TGGCTTCCTCAGAATGAGACAGG - Intronic
1071423957 10:85529519-85529541 TGGCAACACCAGGATGATACGGG + Intergenic
1075015911 10:118909902-118909924 TGGGCTCACCAGGATGACCCAGG - Intergenic
1075031013 10:119024933-119024955 TGAGATCTCCAGGGTGAGAATGG + Intergenic
1076506042 10:130973299-130973321 TGGGTTCCCCAGGATGGCCCTGG + Intergenic
1077338390 11:2015493-2015515 TGGGATCTCCAGGCTCAGGCGGG + Intergenic
1080163797 11:29212526-29212548 TGGGATCTCAAGGCTGAGCCAGG + Intergenic
1080181451 11:29431125-29431147 TGGTCTCCCCAGGAAGAAACAGG - Intergenic
1080654998 11:34251953-34251975 TGTGACTCCCAGGATGGGACTGG - Intronic
1080693427 11:34579620-34579642 TGTGAACTCCAGGATGAGATTGG - Intergenic
1081640902 11:44753504-44753526 TGGGACCCCCAGGAAGATGCTGG - Intronic
1083636009 11:64121324-64121346 GGTGATCCCCACGATGAGGCAGG - Intronic
1085392789 11:76190997-76191019 TGGGGTCCCCAGGAGGAGATGGG + Intronic
1085520627 11:77137240-77137262 TGGGTTCCCAAGGCTGGGACAGG + Intronic
1085929584 11:81065251-81065273 CAGGACACCCAGGATGAGACAGG + Intergenic
1086410510 11:86540130-86540152 TGTGTTCCACAGGATGGGACAGG - Intronic
1088206906 11:107402948-107402970 TGTGATGACCTGGATGAGACTGG + Intronic
1088751154 11:112843210-112843232 TCCGATCCCTAGGATGAGAGAGG - Intergenic
1089536218 11:119162082-119162104 TGGGATCCCCAGGAGGAGGTTGG - Exonic
1090082519 11:123623525-123623547 TGTGATTTCCAGGATGAGTCAGG + Intronic
1090102820 11:123818846-123818868 TTGGGTCCTCATGATGAGACTGG - Intergenic
1202821374 11_KI270721v1_random:70675-70697 TGGGATCTCCAGGCTCAGGCGGG + Intergenic
1096237932 12:49942498-49942520 TGGGATGCCCAGGCTGAGGGTGG - Intergenic
1096983944 12:55744322-55744344 TGGGATACCCGGTCTGAGACAGG - Intronic
1097747361 12:63315845-63315867 TGGGATCCTAATGATGAGATGGG - Intergenic
1097863304 12:64539292-64539314 TAGGGCCCCCATGATGAGACCGG - Intergenic
1097913709 12:64997887-64997909 GTGGAGCCCTAGGATGAGACTGG - Intergenic
1098012591 12:66070822-66070844 TGGGGCCCCCATGATGGGACTGG + Intergenic
1098757898 12:74388827-74388849 TGGGATCCCAAGGACAAGATTGG - Intergenic
1098761577 12:74431870-74431892 TGAGATCCCAGGGAAGAGACAGG - Intergenic
1100245702 12:92754438-92754460 AGGGTTCGCCAGGATGTGACTGG - Intronic
1102535038 12:113575163-113575185 TGAGATCCACACGATGAGAGAGG + Intergenic
1104316736 12:127710093-127710115 TGCGATACTCAGGATTAGACAGG + Intergenic
1107523490 13:41206185-41206207 TGGGATCCCCATGATGGGACTGG + Intergenic
1109378081 13:61524098-61524120 TGGGATCCCAATGATGAGATGGG - Intergenic
1109560934 13:64049392-64049414 TGGGGTCCCCATGGTGAGACTGG - Intergenic
1110508839 13:76324288-76324310 TGGGATTCCAAGGATAAGAATGG + Intergenic
1113275930 13:108730116-108730138 TGGGAACTCCAAGATGAGATTGG - Intronic
1113420907 13:110170695-110170717 TGGGTTTCCCAGGATTAGCCGGG - Exonic
1113813628 13:113157267-113157289 TGGGATGTCCAGGTGGAGACAGG - Intergenic
1114595363 14:23907504-23907526 TGGGGCCCCCATGATAAGACTGG - Intergenic
1114598392 14:23933874-23933896 TGTGATCCCCAGCCTGAAACTGG - Intergenic
1116870566 14:50065899-50065921 TGACATTCCCAGGAGGAGACAGG + Intergenic
1118716272 14:68562324-68562346 TGTGATCTACAGGGTGAGACAGG + Intronic
1119633124 14:76251267-76251289 TGGGGTCCCCAGGTTGACTCTGG + Intronic
1120354226 14:83408807-83408829 TGGGATCTCAAGCATGAAACTGG + Intergenic
1120960894 14:90123834-90123856 TGTGTTGCCCAGGCTGAGACAGG + Intronic
1121682181 14:95802744-95802766 TGGGGTCCCCAAGATGGAACTGG + Intergenic
1122642227 14:103166650-103166672 TGGGATCCCCATGATGACATGGG + Intergenic
1123019142 14:105389507-105389529 TGGGACTCCCAGGAAGAGCCTGG - Intronic
1126256780 15:46636618-46636640 CTGGACACCCAGGATGAGACTGG - Intergenic
1126434746 15:48624994-48625016 TGGCAGCCCCAGGAAGAGACAGG + Intronic
1128575956 15:68775380-68775402 CGGGACTCCCAGGATGAGAGGGG + Intergenic
1129187818 15:73921229-73921251 TGGTAGTCACAGGATGAGACAGG - Intergenic
1129314865 15:74735772-74735794 TGGTACTCCCATGATGAGACTGG + Intergenic
1130857684 15:87855554-87855576 TGGGATTCCCAGTACGAGGCAGG + Intergenic
1134056565 16:11173936-11173958 TGCAACCCCCAGGATGAGGCAGG - Intronic
1134105189 16:11480357-11480379 TGGGAACACCAGGATGAGCAGGG - Intronic
1134242649 16:12517344-12517366 TGGGGCTCCCAGGAGGAGACAGG - Intronic
1135658358 16:24271539-24271561 TTGGATCTCCAGGCTGAGAAGGG - Intronic
1135825234 16:25721296-25721318 TGGGATCCCTAAGGTTAGACAGG - Intronic
1137564226 16:49523342-49523364 TGGAATCCCCAAGAGCAGACAGG + Intronic
1137889729 16:52146544-52146566 TGGGATCCAGAAGGTGAGACTGG - Intergenic
1139803050 16:69539929-69539951 TGGGGTCCCCAGAGTGGGACTGG - Intergenic
1141155214 16:81592585-81592607 TGGGAGCCCCAGGATGAGCAGGG - Intronic
1142843070 17:2649103-2649125 TGGGATGTCGAGGCTGAGACAGG + Intronic
1143091690 17:4452761-4452783 TGGGATCCCCAGGATGAGACAGG + Intronic
1143891437 17:10105513-10105535 TAGCATTCCCAGGATGAGGCAGG + Intronic
1145974169 17:28974810-28974832 TGGGAGACCCAGGCGGAGACCGG - Intronic
1146315361 17:31802688-31802710 TGGGAGCCCCAGGGAGAAACAGG - Intergenic
1146886224 17:36472745-36472767 TGGGATCCCAATGACAAGACGGG - Intergenic
1149429059 17:56582278-56582300 TGGGGTCCCAAGGATGGGAGTGG + Intergenic
1149535407 17:57429783-57429805 CTGGTTCTCCAGGATGAGACCGG - Intronic
1149594619 17:57857138-57857160 TGGCTTCCCCAGGAAGAGAGGGG - Intergenic
1152573192 17:81129346-81129368 TGGGCGCCCCAGGGTGAGAGAGG - Intronic
1152921882 17:83069949-83069971 TGGGAGCCGCAGGATGTGAGAGG + Intergenic
1152937649 17:83149857-83149879 TGGTATCTCCAGCATGAGTCAGG + Intergenic
1155784131 18:29876427-29876449 TGTAATCCCCAGGCTGATACTGG - Intergenic
1156399761 18:36729663-36729685 TGGGATCCTCATGACGGGACTGG - Intronic
1157486388 18:48090325-48090347 TTGGAACCCCAGGATTAGGCAGG - Intronic
1158189736 18:54813385-54813407 TGTGATCCCCAGGTTGACAGTGG + Intronic
1161998859 19:7730861-7730883 TGGGAGCCGCAGGGTGAGAGGGG + Intronic
1162032026 19:7921623-7921645 GGGGATCCCCAGGAGGAGCAGGG + Intronic
1162448385 19:10738530-10738552 TGGGATCCCCAGGAAGGGCCTGG - Intronic
1163520569 19:17789191-17789213 TGGGAGCCCCAGGAGGAGGGTGG + Intergenic
1163666939 19:18607630-18607652 AGGGATTCCCAGGAGGAGAGCGG + Intronic
1164856360 19:31527652-31527674 AGGGAAGCCCAGGATGAGGCAGG + Intergenic
1165144092 19:33720621-33720643 TGGGAGCCCCAGGAAGAAAAGGG - Intronic
1165710177 19:38005355-38005377 AGGGATCTGCAGGATGAGGCGGG - Intronic
925237178 2:2290008-2290030 TGGGATCCCCAGTGGGAGTCTGG + Intronic
925705867 2:6684361-6684383 TGGAATCCCGAAGATGAGATGGG - Intergenic
926819301 2:16835075-16835097 TAGAATCCCCAGGATAAGCCAGG - Intergenic
927811717 2:26184221-26184243 TGGGATCCCCAGGTGGTGTCGGG + Exonic
929027969 2:37623517-37623539 TGGAGTCCCCATGATGGGACTGG + Intergenic
929449812 2:42029176-42029198 AGGGATCCCCACGAAGAGACAGG - Intergenic
929826422 2:45312090-45312112 TGGGAGCCCAGGGCTGAGACAGG - Intergenic
932129893 2:69178225-69178247 TGCAATCCCCAGGAAGAGAAGGG - Intronic
933646786 2:84819686-84819708 TGGGACCCCCAGGAAGAGTAAGG + Intergenic
935316134 2:101836068-101836090 TGGGTTCCCCAGAATTAGAAGGG - Intronic
937314557 2:120922750-120922772 TGGAATCCCCAGGAGGAGCCTGG - Intronic
939092243 2:137792734-137792756 TGAGTTCCACAGGATGGGACAGG - Intergenic
941230276 2:162903633-162903655 TGGGATCCTCATGATGGGACTGG + Intergenic
942925813 2:181430730-181430752 TGTAAGCCACAGGATGAGACAGG - Intergenic
945956766 2:216093532-216093554 TAGGATCCACAGGATGAAATGGG - Intronic
947076513 2:226351067-226351089 TGGCAACCCCAGGCTGAGAATGG - Intergenic
948912352 2:241010951-241010973 TGGGATCCACAGGGAGAGACTGG + Intronic
1168854784 20:1001088-1001110 TGGGATTCCAAGGCTCAGACTGG - Intronic
1170146961 20:13186125-13186147 TGGGATCCCCAGTCTTAGAAGGG + Intergenic
1170497224 20:16937654-16937676 TGGGACCCCCATGATGAGACTGG - Intergenic
1171936145 20:31277347-31277369 TGGGTCCCCAAGGCTGAGACTGG + Intergenic
1172977849 20:38919967-38919989 TGGGAGCCCCTGGGTGAGGCGGG - Exonic
1173087456 20:39937492-39937514 GGGGATCCCCAGGGAGAGATAGG - Intergenic
1177045116 21:16159734-16159756 TGGGAAGCCCAAGATGAGAAGGG + Intergenic
1177124641 21:17181352-17181374 TGGGATCCCAATGATGAGATGGG - Intergenic
1177275385 21:18906200-18906222 TGAGATCCCATGGAAGAGACAGG - Intergenic
1178799271 21:35777280-35777302 TGACATCCCCAGGCTGAGTCAGG + Intronic
1179925019 21:44529527-44529549 TGGGGTCCCCAGGAAGGGGCTGG + Intronic
1180126067 21:45791032-45791054 TGGGATGCCCAGGATGGGGGTGG + Intronic
1181076674 22:20383002-20383024 TGGGATTACCAGCATGAGCCAGG + Intronic
1181092046 22:20480473-20480495 TGGGACCTCCAGGATGTCACAGG + Intronic
1183206961 22:36426325-36426347 TGGGAGCTCCAGGGGGAGACAGG - Intergenic
1183426744 22:37743957-37743979 AGGAATTCCCAGGATAAGACAGG - Intronic
1185136624 22:49077195-49077217 AGGCCTCCCCAGGAAGAGACTGG + Intergenic
1185156050 22:49194150-49194172 TGGGATCCCCCGGAGGAGGTGGG - Intergenic
949470881 3:4395143-4395165 TGGCATCCCCAAGATCACACAGG + Intronic
949980473 3:9499398-9499420 CGGGAACCCCAGGGTGACACAGG - Exonic
949981335 3:9503534-9503556 TGGCTTCACCAGGTTGAGACAGG + Intronic
952222755 3:31341333-31341355 TGGGATCCCCAGGCTGCCACTGG + Intergenic
952962186 3:38599136-38599158 TGGCATCCCCAGCCTGAGTCTGG - Intronic
953013407 3:39050344-39050366 TTAGAGTCCCAGGATGAGACAGG - Intergenic
953025602 3:39143180-39143202 TGGCATCCCCAGGTGGAGACAGG + Exonic
953465577 3:43116469-43116491 AGGGATCCCCAGATTGGGACTGG + Intergenic
953641327 3:44711048-44711070 TGGGGTCCCCAGGCTCAGTCCGG - Intergenic
956259565 3:67323914-67323936 TGGGAGCCCCTGGAGGAGACTGG - Intergenic
959852762 3:111109166-111109188 TGGGCTCCCCATGATTGGACTGG - Intronic
960053967 3:113263305-113263327 TGTGATCCCCAGGAACAGGCAGG + Intronic
960694782 3:120385569-120385591 TGGGGCTCCCAGGATGGGACTGG - Intergenic
961000229 3:123369128-123369150 TGGGGCCCCCATGATGAAACTGG + Intronic
961661803 3:128473012-128473034 TGGGAGGCCCAGGAGGAGGCTGG + Intergenic
961715015 3:128852101-128852123 TGGGATCCCCAGGATTAGGTAGG + Intergenic
961868980 3:129974791-129974813 TGGGCTCCACAGGATGGGTCCGG - Exonic
962348090 3:134636459-134636481 TGGGATCCCAAGAATGAGAATGG - Intronic
962403901 3:135083898-135083920 AGGGGGCCCCAGGGTGAGACTGG - Intronic
962417090 3:135192997-135193019 TGGGATCCTCAGGAGGAGGATGG + Intronic
963761479 3:149290386-149290408 TGGGATCCCAATGATGAAATGGG + Intergenic
964170579 3:153765493-153765515 TGGGAGCACCAGCAGGAGACTGG - Intergenic
968651194 4:1760924-1760946 TGGGGGCCCCAGGAAGAGAAGGG - Intergenic
969530880 4:7729518-7729540 TGGGGGCCCCAGTATGAGGCAGG + Intronic
971479110 4:27098742-27098764 TGGGATGGACAGGATGGGACAGG - Intergenic
972269541 4:37497228-37497250 TGTGATGACCTGGATGAGACTGG - Intronic
974004363 4:56540938-56540960 TGAAATCCCCAGGATGCAACTGG - Intronic
974250268 4:59376156-59376178 TGGGATCCCAGTGATGAGATGGG - Intergenic
976092071 4:81469423-81469445 TGGGATCCCTAGTATGACTCAGG - Intronic
976194207 4:82517594-82517616 TGGAATCCCAAGGCTGAGACTGG - Intronic
976759755 4:88535710-88535732 TGGGACCCCCATGATGGGACTGG - Intronic
977406693 4:96608621-96608643 TGGGGTCCCCATGATGGGATAGG - Intergenic
977892362 4:102326849-102326871 TAGGATAACCAGGATGAGAAGGG - Intronic
979188887 4:117833310-117833332 TGGGATCCCAATGATGAGATGGG - Intergenic
979919772 4:126481266-126481288 TGGGATCCCAATGATGAGATGGG + Intergenic
980904435 4:138933673-138933695 TGATCTCCCTAGGATGAGACAGG - Intergenic
984109617 4:175596038-175596060 TGGGATCACCAGGATGGGACTGG + Intergenic
985785502 5:1891516-1891538 TGTGATGCCCAGAAAGAGACAGG + Intergenic
987173098 5:15279219-15279241 TGGGATCTCCATGATGGGACTGG + Intergenic
988203339 5:28098737-28098759 GTGGATCCTCATGATGAGACAGG + Intergenic
990943944 5:61230535-61230557 TGGGATCCTCATGATGGGAGTGG + Intergenic
992644756 5:78801623-78801645 TGTGATCCCAAGAAGGAGACAGG - Intronic
994719910 5:103368531-103368553 TGGGATAACCAGGAGGAGAGGGG - Intergenic
994774589 5:104026465-104026487 TGGGATCCCAATGATGAGATGGG + Intergenic
994924301 5:106094396-106094418 TGAAATCCCCAGGCTGAGCCTGG - Intergenic
995536159 5:113138410-113138432 TGGGGTCCTCATGATGGGACTGG + Intronic
996436400 5:123437745-123437767 TGAGATCCCAAGGATAATACAGG + Intergenic
1000320800 5:160133057-160133079 TGGGTTCCCCAGGATCTGATGGG + Intergenic
1001716408 5:173819847-173819869 TGGGGCCCCCATGATGGGACTGG - Intergenic
1004368489 6:15032017-15032039 TGGGATCCCCAGAATGTGCAGGG - Intergenic
1004819617 6:19353142-19353164 TGGTATCCCCAGAAGCAGACAGG - Intergenic
1005011172 6:21337037-21337059 TGGGGGACCCATGATGAGACTGG + Intergenic
1005496649 6:26393346-26393368 AGGGTTCACCAGGATGAGAGAGG + Exonic
1009626608 6:66144314-66144336 CGGGATCCCAATGATGAGAAGGG - Intergenic
1011706214 6:90003865-90003887 TGGCATGACCAGGATGAGAAGGG - Intronic
1011824580 6:91290945-91290967 TGGATTTCACAGGATGAGACTGG - Intergenic
1012113053 6:95260823-95260845 TGGGATCCCGATGATGAGATGGG - Intergenic
1014277034 6:119399124-119399146 TGGGATCCCAATGATGAGATGGG - Intergenic
1015715427 6:136187570-136187592 TGGGAATCCCAGGATGCGGCGGG - Intronic
1015985136 6:138877000-138877022 TGGGTTACACAGGACGAGACCGG - Intronic
1016071237 6:139741601-139741623 TGGGCCCCCCAGGATGGGACTGG - Intergenic
1018845533 6:167552673-167552695 TGGGAACCCCAGGGTGGGTCTGG + Intergenic
1018924133 6:168194778-168194800 TGGCATCCTCAGGATGGGAAGGG + Intergenic
1019278510 7:188551-188573 TGGGCTCCCCAGGATAAGGGGGG - Intergenic
1019295144 7:269918-269940 TGGGCTCCCCGGGCTAAGACGGG - Intergenic
1019353019 7:564054-564076 TGGGAACACCAGGATCAGAACGG - Intronic
1019922042 7:4169258-4169280 TGGGCTCCCCAGAAGGAGACTGG - Intronic
1023388368 7:39683027-39683049 TAGGGCCCCCATGATGAGACTGG + Intronic
1024211871 7:47213061-47213083 TGGGTTCCCCTGGATGGGATAGG - Intergenic
1024533915 7:50414205-50414227 TGGGATCCTAAGGCTCAGACAGG + Intergenic
1025015668 7:55437169-55437191 TGTGATCCCCAGGATAAGAGAGG + Intronic
1028848163 7:95506332-95506354 TGGGAATCCCAGGATGACAGTGG - Intronic
1029902150 7:104052754-104052776 GGGGAGCCCCAAGATGAGAAGGG + Intergenic
1030386937 7:108876697-108876719 TAGGATCCCAATGATGAGATGGG + Intergenic
1031014881 7:116562674-116562696 TGGAAGCCCAAGGCTGAGACTGG + Intergenic
1032021011 7:128407114-128407136 TGGGAGCCACAGGAGGACACAGG - Intronic
1033535217 7:142306120-142306142 TGGGATCCCTGGGAAGAGCCAGG - Intergenic
1033537911 7:142328922-142328944 TGAGGCCCCCAGGATGAAACAGG + Intergenic
1034434998 7:151059360-151059382 TGGGATCCCTAGCGTGAGAAGGG + Intronic
1034536153 7:151727303-151727325 TGGGACCTCCAGGAGGAGGCAGG + Intronic
1034559419 7:151870656-151870678 TGGGAACTCCAGGATGAGGGTGG - Intronic
1035857998 8:2997357-2997379 TGGGAGCCCTAGGATAAGAGAGG + Intronic
1036690254 8:10940633-10940655 TGGGAGCCCCAGGAGGAGGGTGG - Intronic
1037276307 8:17183511-17183533 TCTGATCTCCAGAATGAGACAGG - Intronic
1037761238 8:21743167-21743189 TGGGATCCCCAAGGGGAAACTGG + Intronic
1040845672 8:51836180-51836202 TGGGATCTGAAAGATGAGACAGG + Intronic
1041518954 8:58733560-58733582 TGGAATCCCCATGAGGAGATTGG + Intergenic
1042624424 8:70741236-70741258 TGGGTTCTCCATGATGGGACTGG + Intronic
1044008438 8:86964304-86964326 TGGGACCCCAATGATGAAACGGG - Intronic
1045505707 8:102776942-102776964 TGGGATGCTCAGGCTGACACAGG + Intergenic
1045559682 8:103248872-103248894 TATGTTCCACAGGATGAGACAGG + Intergenic
1048321421 8:133403606-133403628 AGGGTTCCCCAGGATGAGGATGG + Intergenic
1048982068 8:139707854-139707876 TGGGAACCCCTGGATGAGCATGG - Intergenic
1049244955 8:141557458-141557480 AGGGATCTCAAAGATGAGACAGG - Intergenic
1051896117 9:21990573-21990595 TGGTTTCCGCAGGATGAGAGGGG - Intronic
1053397139 9:37785327-37785349 TCGTATCCCCACGATGCGACCGG - Intronic
1055522831 9:77099209-77099231 TGTCATCCCCAGTGTGAGACAGG + Intergenic
1055665592 9:78549757-78549779 TGGGCTCACCTGGATGAGCCAGG - Intergenic
1056207606 9:84335306-84335328 TGGGAAACCCAGGAAGAGATGGG + Intronic
1056800167 9:89685608-89685630 TGGCAACCCCAGGATGACAAGGG - Intergenic
1056859936 9:90171596-90171618 GGGAATTCCCAGGATGAAACTGG - Intergenic
1056887564 9:90457851-90457873 TGGAATCCAAAGGATGAGCCTGG - Intergenic
1057043114 9:91861996-91862018 TGGGGCCCCCATGATGAGATTGG + Intronic
1058605283 9:106715119-106715141 TGGGGTCACCAGGATGAAAAAGG + Intergenic
1058828508 9:108795512-108795534 TGGGATCCCAATGATGAGATGGG + Intergenic
1059876995 9:118645964-118645986 TGGGGTCCCCATGATGAGACCGG + Intergenic
1061001547 9:127905565-127905587 TTGGACACCCAGGATGAGGCAGG + Intergenic
1061664436 9:132152186-132152208 TGGGAGCCCAAGGGTGAGGCTGG - Intergenic
1062268046 9:135696305-135696327 TGGAAGTCCCAGGAGGAGACAGG + Intronic
1062406576 9:136399700-136399722 AGGGAACCCCAGGATGCGCCAGG + Intergenic
1185502700 X:610522-610544 TGGGAGCTCCATGAGGAGACTGG - Intergenic
1197271070 X:124425452-124425474 TGGGGTCCCCATGATGGGACTGG + Intronic
1198455694 X:136815632-136815654 TGGGGCCCCCATGATGGGACGGG - Intergenic
1200045513 X:153398769-153398791 AGGGATACCCAGGATGAGCAGGG + Intergenic
1200046979 X:153408405-153408427 TGGGACCCTCAGGATGAGGCCGG - Intergenic
1200154013 X:153965701-153965723 TGGGTCCCCCAGGACGTGACAGG + Intronic
1200291928 X:154883704-154883726 TGAGACCCCCAGGATGCGACTGG - Intronic
1200338766 X:155379441-155379463 TGAGACCCCCAGGATGCGACTGG - Intergenic
1200347703 X:155461251-155461273 TGAGACCCCCAGGATGCGACTGG + Intergenic
1201242769 Y:11974757-11974779 TGGGATTCCCAGAAGGAGAATGG - Intergenic