ID: 1143092210

View in Genome Browser
Species Human (GRCh38)
Location 17:4455612-4455634
Sequence GCTCAGATGGACACCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143092210_1143092217 -3 Left 1143092210 17:4455612-4455634 CCCTCCACGGTGTCCATCTGAGC 0: 1
1: 0
2: 1
3: 5
4: 159
Right 1143092217 17:4455632-4455654 AGCCCTGTAGGATGTCGGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 135
1143092210_1143092218 -2 Left 1143092210 17:4455612-4455634 CCCTCCACGGTGTCCATCTGAGC 0: 1
1: 0
2: 1
3: 5
4: 159
Right 1143092218 17:4455633-4455655 GCCCTGTAGGATGTCGGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1143092210_1143092216 -7 Left 1143092210 17:4455612-4455634 CCCTCCACGGTGTCCATCTGAGC 0: 1
1: 0
2: 1
3: 5
4: 159
Right 1143092216 17:4455628-4455650 TCTGAGCCCTGTAGGATGTCGGG 0: 1
1: 0
2: 2
3: 16
4: 219
1143092210_1143092221 1 Left 1143092210 17:4455612-4455634 CCCTCCACGGTGTCCATCTGAGC 0: 1
1: 0
2: 1
3: 5
4: 159
Right 1143092221 17:4455636-4455658 CTGTAGGATGTCGGGAAGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 239
1143092210_1143092215 -8 Left 1143092210 17:4455612-4455634 CCCTCCACGGTGTCCATCTGAGC 0: 1
1: 0
2: 1
3: 5
4: 159
Right 1143092215 17:4455627-4455649 ATCTGAGCCCTGTAGGATGTCGG 0: 1
1: 0
2: 1
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143092210 Original CRISPR GCTCAGATGGACACCGTGGA GGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903001849 1:20272002-20272024 GGGCAGATGGACACCCAGGATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905187657 1:36208158-36208180 GCTCACATGGGCAGCCTGGAGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907398692 1:54210673-54210695 GCTCATGAGGACACAGTGGATGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
918441004 1:184567112-184567134 GCTCTGTTGGAGACTGTGGAAGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922471101 1:225877806-225877828 GATCAGATGGTCAGAGTGGATGG + Intronic
923679803 1:236110399-236110421 TTTCAGATGGTCACAGTGGATGG - Intergenic
924567916 1:245213290-245213312 GCTCACATGGAGACCCTGGTGGG + Intronic
924776105 1:247115229-247115251 GCTGGGATGGACACGGTGGGGGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063775807 10:9262550-9262572 GTTCAGATGGACACAGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064431856 10:15278167-15278189 GCTCAGATCTACACCCTGGGTGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074781749 10:116807256-116807278 GCTCACAGTGACCCCGTGGAAGG - Intergenic
1075778214 10:125001528-125001550 GCTCGGAAGGACGCCGTGGCTGG + Intronic
1076890835 10:133282528-133282550 AATCAGCTGGTCACCGTGGAAGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078286413 11:9959773-9959795 GCTGAGATGGTCATGGTGGAAGG + Intronic
1084330533 11:68427304-68427326 CCTCAGATGGTTACCATGGAGGG - Intronic
1085048774 11:73368682-73368704 GCACATATGGTCACCTTGGAGGG + Exonic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085509981 11:77083275-77083297 GCACAGATGGACAGCAGGGAGGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091087683 11:132738613-132738635 CCTCACATGGACACTGTAGAAGG - Intronic
1091664888 12:2411939-2411961 GCTCAGAGGGACAGCCAGGAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094755964 12:33468665-33468687 GAACACATGGACACCGTGGGAGG + Intergenic
1095971735 12:47906079-47906101 GCTCAGAGGGACAAGGTGAAAGG + Intronic
1096521280 12:52186134-52186156 GCTCGGCTGGACAGGGTGGAGGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1105236752 13:18563770-18563792 GATTAGATGGTCACCGTTGAAGG + Intergenic
1112611956 13:100964008-100964030 GAACACATGGACACCGGGGAGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1124251631 15:28110070-28110092 GCTCTCATGGACACCCTGAAAGG + Intergenic
1124688651 15:31803732-31803754 TCTCAGATGGTCACAGTGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127839901 15:62822110-62822132 GCTCAGAAGGACCCTGCGGAAGG - Intronic
1132494337 16:253954-253976 GCACACATGGACTCCCTGGAGGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1135815394 16:25627927-25627949 GTTCTGATGGAGACCATGGAAGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092210 17:4455612-4455634 GCTCAGATGGACACCGTGGAGGG - Intronic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152471019 17:80490055-80490077 GAGAAGATGGACACAGTGGAGGG + Intergenic
1154512784 18:15126142-15126164 GATTAGATGGTCACCGTTGAAGG - Intergenic
1161294266 19:3511774-3511796 GCTCACACGGGCACCCTGGAAGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1165931646 19:39362980-39363002 GCTCACATGGACACAGGGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925188052 2:1863034-1863056 GCCCAGATGGACACTGGGAATGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927214190 2:20657526-20657548 GCTCAGATGGAGACTGGTGATGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
935331057 2:101978474-101978496 GCCCAGATGTAAACAGTGGAGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938513035 2:131970777-131970799 GATTAGATGGTCACCGTTGAAGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
943042320 2:182818615-182818637 GCTCCATTTGACACCGTGGAAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945274733 2:207976938-207976960 GTCCAGATGGACAACCTGGATGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1173647867 20:44644764-44644786 GCTCCGAGGTACACAGTGGAAGG + Intronic
1176780740 21:13192058-13192080 GATTAGATGGTCACCGTTGAAGG + Intergenic
1177978423 21:27881170-27881192 GATTAGATGGTCACCGTTGAAGG + Intergenic
1181214116 22:21311268-21311290 GCTCAGGTGGAGAACGTGAAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182972477 22:34590893-34590915 AATCAGATGGTCACAGTGGATGG + Intergenic
1183975197 22:41507985-41508007 AATCAGATGGTCACAGTGGATGG - Exonic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184756717 22:46520248-46520270 GCTCAGAAGGAGGCCCTGGATGG + Intronic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952268634 3:31811139-31811161 GCTCAGATGTAGCCTGTGGATGG + Intronic
952437755 3:33289015-33289037 GCTGAGATGAAGACCATGGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954409273 3:50363334-50363356 GCTCAGATGGACTGGGAGGAGGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962344402 3:134608913-134608935 GGTCCTATGGACACCCTGGATGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973572408 4:52253786-52253808 GCTCAGATGAACACTGCTGATGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978398203 4:108305063-108305085 GAACAGATCGAGACCGTGGATGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986943444 5:12985449-12985471 GCACAGGTGGAAAACGTGGAAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
994009257 5:94880968-94880990 CCTCTGCTGGACACTGTGGATGG + Intronic
1003336711 6:5180266-5180288 GCACAGGTGTACACCGTGGCAGG + Intronic
1006741574 6:36312727-36312749 GCTGAGATGCTCACCCTGGAAGG - Intergenic
1007987616 6:46223139-46223161 GCTCAGTTGGACACGGAGGGTGG + Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1013409723 6:109873124-109873146 GGCCAAGTGGACACCGTGGAAGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019684409 7:2372973-2372995 GCTCAGAGAGACACCCTGCAAGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021392430 7:20109891-20109913 TCTCAGATGGATACCATGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021859312 7:24890489-24890511 GCCAAGGTGGACCCCGTGGATGG + Intronic
1024273399 7:47659096-47659118 GCTCAGCTGGGCACGGTGCAAGG + Exonic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1032410864 7:131692556-131692578 GCTCAGATGAACGCAGAGGATGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034893206 7:154858554-154858576 GCTCGGATGGACCCCGGGGGTGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035569598 8:663252-663274 GCTCAGATGGGCAGCATGGAGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048823216 8:138398463-138398485 GCACAGATGCACACAGTGCACGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051231777 9:14962727-14962749 GCTCAGCTGAACACAATGGATGG + Intergenic
1052452638 9:28651514-28651536 GCTCTGATGGACATGGTGGCTGG - Intronic
1052591994 9:30509821-30509843 GCTTAGATAGACACCATGCAGGG - Intergenic
1052715735 9:32114857-32114879 GCACAGACGGACAAGGTGGAGGG + Intergenic
1056667159 9:88589989-88590011 CCTCAGATGGGCACAGTGGGTGG - Intergenic
1062531531 9:137003094-137003116 GCTCAGAGGGGCCCCGGGGAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1195354081 X:104022056-104022078 GCTCAAATGGAGACCGAGTAAGG + Intergenic