ID: 1143092236

View in Genome Browser
Species Human (GRCh38)
Location 17:4455706-4455728
Sequence CTGTGGGTGGGGATGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 596}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143092236_1143092250 5 Left 1143092236 17:4455706-4455728 CCATCTGGCATCCCCACCCACAG 0: 1
1: 0
2: 8
3: 47
4: 596
Right 1143092250 17:4455734-4455756 CCTTGGGGGAGTCAGGGCCCAGG 0: 1
1: 0
2: 2
3: 36
4: 418
1143092236_1143092243 -9 Left 1143092236 17:4455706-4455728 CCATCTGGCATCCCCACCCACAG 0: 1
1: 0
2: 8
3: 47
4: 596
Right 1143092243 17:4455720-4455742 CACCCACAGACTTCCCTTGGGGG 0: 1
1: 0
2: 4
3: 14
4: 166
1143092236_1143092251 6 Left 1143092236 17:4455706-4455728 CCATCTGGCATCCCCACCCACAG 0: 1
1: 0
2: 8
3: 47
4: 596
Right 1143092251 17:4455735-4455757 CTTGGGGGAGTCAGGGCCCAGGG 0: 1
1: 0
2: 3
3: 30
4: 383
1143092236_1143092246 -2 Left 1143092236 17:4455706-4455728 CCATCTGGCATCCCCACCCACAG 0: 1
1: 0
2: 8
3: 47
4: 596
Right 1143092246 17:4455727-4455749 AGACTTCCCTTGGGGGAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 137
1143092236_1143092242 -10 Left 1143092236 17:4455706-4455728 CCATCTGGCATCCCCACCCACAG 0: 1
1: 0
2: 8
3: 47
4: 596
Right 1143092242 17:4455719-4455741 CCACCCACAGACTTCCCTTGGGG 0: 1
1: 1
2: 4
3: 17
4: 171
1143092236_1143092247 -1 Left 1143092236 17:4455706-4455728 CCATCTGGCATCCCCACCCACAG 0: 1
1: 0
2: 8
3: 47
4: 596
Right 1143092247 17:4455728-4455750 GACTTCCCTTGGGGGAGTCAGGG 0: 1
1: 0
2: 2
3: 10
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143092236 Original CRISPR CTGTGGGTGGGGATGCCAGA TGG (reversed) Intronic
900375031 1:2350120-2350142 CTGTGGGTGGGAATTACAAAAGG + Intronic
900734762 1:4291612-4291634 CTGTGCGTGTGTATGCCAGTGGG + Intergenic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902047791 1:13538852-13538874 GTGTGGGAGGGGATTCCACATGG - Intergenic
902179638 1:14678176-14678198 CTGTGGGTGGGTCTTCCTGAGGG - Intronic
902539095 1:17139805-17139827 ATGTGGGTGGGGAAGGCAGGGGG + Intergenic
903502173 1:23806864-23806886 TGGTGGGTGGGGAAGACAGATGG - Intronic
903917314 1:26773842-26773864 CTGGGGAAGGGGCTGCCAGAAGG - Exonic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905240162 1:36576180-36576202 TTGGGGGTGGGGATCCTAGAGGG + Intergenic
905964442 1:42080538-42080560 CTGGGGATGGGGATGCCAGGTGG + Intergenic
906034385 1:42741337-42741359 CTGTGGGGGAGGAAGCCAGCAGG - Intergenic
906296814 1:44653774-44653796 CTTTGTGGGGAGATGCCAGAGGG - Exonic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907405600 1:54251748-54251770 GGGTGGCTGGGGATGCCAGGAGG - Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
907493380 1:54825538-54825560 CTGGGGGTGGGGGTGCCAGGTGG + Intronic
908119199 1:60969876-60969898 CTGTTGGTGGGAATGCCAAATGG - Intronic
909183329 1:72451223-72451245 CTGGGGATGGGGACGCCAGGTGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910783870 1:90972509-90972531 CTGTTGGTGGGAATGTCAAATGG + Intronic
911317336 1:96370926-96370948 CTGGGAGTGGGGATGCCTGTGGG + Intergenic
911648983 1:100365696-100365718 CTGTGGGTGGTTATGCTAAAGGG + Intronic
913033725 1:114938950-114938972 CTGTTGATGGGAATGTCAGATGG + Intronic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
913972167 1:143423696-143423718 CTGGGTGTGGGGATCCTAGAGGG - Intergenic
914066548 1:144249309-144249331 CTGGGTGTGGGGATCCTAGAGGG - Intergenic
914112605 1:144717045-144717067 CTGGGTGTGGGGATCCTAGAGGG + Intergenic
915153149 1:153851389-153851411 CTGTTGGTGGGAATGCAAAATGG - Intronic
916086158 1:161271156-161271178 TTGTTGGTGGGAATGCAAGATGG - Intronic
916328524 1:163591080-163591102 CTGTTGGTGGGGATGTAAGTTGG - Intergenic
916972751 1:170042002-170042024 TTGTGTGTGGGGAACCCAGAAGG + Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918657775 1:187049915-187049937 CTATAGGTGGGAATGCAAGATGG + Intergenic
918961498 1:191283395-191283417 CTGGGGAGGGGGATGCCAGGTGG - Intergenic
919228805 1:194745227-194745249 CTCTGGATGGGGATGCCATTAGG + Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920243447 1:204570599-204570621 CTGACCCTGGGGATGCCAGAGGG - Intergenic
920714803 1:208329746-208329768 CTCCGGGTGGGGATTCCACAGGG + Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921409449 1:214819483-214819505 CTATTGGTGGGAATGCCAAATGG - Intergenic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922670953 1:227508499-227508521 CTCTGGGTGCTGCTGCCAGATGG + Intergenic
922707381 1:227796529-227796551 CTGTGGGTGGGGCCGGCAGTAGG - Intergenic
922985505 1:229863330-229863352 CTGTTGGTGGGAATGCAAAATGG - Intergenic
923360156 1:233203262-233203284 CTGTGGGTGAGAAAGCCAAAAGG - Intronic
923470441 1:234285754-234285776 TTGTGGGTGAGGATTCCTGAGGG + Intronic
923556904 1:235008216-235008238 CTGTTGGTGGGAATGTAAGAAGG + Intergenic
923673532 1:236061967-236061989 TTGTTGGTGGGAATGTCAGATGG + Intronic
924517563 1:244779427-244779449 TTGTGGGTGGGGAGCCAAGAGGG - Intergenic
924539817 1:244970534-244970556 CTGCGGGTGGGAACTCCAGATGG - Exonic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065505214 10:26423553-26423575 TTGTTGGTGGGGATGCAAAATGG + Intergenic
1066043202 10:31573168-31573190 CTGTTGGTGGGAATGCAAAATGG + Intergenic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066411247 10:35171653-35171675 CTGTGGGTTGAGATGGCAGGTGG - Intronic
1067753204 10:48985390-48985412 CTGTGGGTGAGAATGCCCCATGG + Intergenic
1068268507 10:54687197-54687219 CTGTTGGTGGGAATGCAAAATGG + Intronic
1068395631 10:56457348-56457370 CTGGGGATGAGGATGCCAGATGG - Intergenic
1068952851 10:62794513-62794535 CAGTGGGTGGTGATCCCAGGAGG + Intergenic
1070093264 10:73310616-73310638 CTGTGAGTGGGAATGTAAGAAGG - Intronic
1070719256 10:78745054-78745076 CAGTGGGTGGCGACGCCACAGGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG + Intergenic
1071440147 10:85682889-85682911 CCCTGGGGAGGGATGCCAGAAGG - Intronic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071520793 10:86330435-86330457 CTGTGGGTGGGCTTGCTGGAGGG - Intronic
1072514926 10:96171078-96171100 CTGTTGGTGGGAATGCAAAATGG + Intronic
1072635518 10:97175492-97175514 CTGTTGGTGGGGATGTGAAACGG - Intronic
1072733149 10:97861642-97861664 CTGGGACTGGGGAAGCCAGAAGG + Intronic
1073326482 10:102646353-102646375 CTCTGGGTGGGGATCCCTGGAGG + Intronic
1074140529 10:110668241-110668263 CCTTGGGTGGGGAGGCCAAAAGG + Intronic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1075952199 10:126489616-126489638 TTGCTGGTGGGGATGCCAAATGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076633440 10:131867074-131867096 CTGCCGGTGGGGGTGCAAGACGG + Intergenic
1076661009 10:132056181-132056203 CTGAGTGTGGGGGTGACAGAAGG - Intergenic
1076838672 10:133033821-133033843 CTCTGGGTGGGGATGGCCGCTGG - Intergenic
1077184121 11:1228837-1228859 CTGGGGGTGGGGAGGCCTGGGGG + Intronic
1077238808 11:1499795-1499817 CTGCTGGTGGGGATGCAAAATGG + Intronic
1077472898 11:2772550-2772572 CTGTGGGCTGGGATGCCACCGGG + Intronic
1077536251 11:3126063-3126085 CTGTGGGTGGCCATGTAAGATGG + Intronic
1077551962 11:3204398-3204420 CCGTGGGTGGGGGTGCGGGAGGG + Intergenic
1077916683 11:6616123-6616145 ATGTGGGTTCGGATGTCAGAGGG + Intronic
1078250133 11:9609956-9609978 GTGGGGGAGGGGATGGCAGATGG + Intergenic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1079238647 11:18706851-18706873 CTGATGGTGGGGATGACATAAGG - Intronic
1080317949 11:30971035-30971057 CTGGGGATGGGGATACCAGGTGG - Intronic
1080857236 11:36122773-36122795 CTTTGGGAGGGCATGGCAGAAGG + Intronic
1080857911 11:36128425-36128447 TCGTGGGTAGAGATGCCAGAGGG + Intronic
1083272302 11:61578649-61578671 AGGTGGGCAGGGATGCCAGAGGG + Intronic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1084345186 11:68542241-68542263 CTGTAGGTGGGGATGTGATAGGG + Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1085514565 11:77104836-77104858 CTGTGGCTGGGGCTGCCGGGAGG + Intronic
1086314170 11:85572634-85572656 TTGTGGGTGGGCTTCCCAGAAGG - Intronic
1087304605 11:96473418-96473440 CTGAGGATGGGGATGTCAGATGG - Intronic
1088451838 11:109989577-109989599 CTGTTGGTGGGAATGCAAAATGG + Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088484178 11:110325229-110325251 AGGTGGTTGGGGAGGCCAGAAGG + Intergenic
1089004530 11:115079958-115079980 GTTTGGGAGGTGATGCCAGAAGG + Intergenic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089090311 11:115869364-115869386 CTGGGGATGGGGATACCAGGTGG + Intergenic
1089607301 11:119648821-119648843 CTGAGGGTGGGAATTCCAGTGGG + Intronic
1089644445 11:119869405-119869427 GTGTGGAAGGGGATGACAGAGGG - Intergenic
1089695912 11:120216190-120216212 CTGTGGGTGGGGGAGCAACATGG + Intronic
1089736609 11:120554077-120554099 CTGTGGGTGGGGGTGTGAGTGGG - Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089816548 11:121182068-121182090 CTGGGGACAGGGATGCCAGATGG + Intronic
1090403122 11:126461465-126461487 TTGTGAATGAGGATGCCAGAAGG + Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1091202595 11:133793511-133793533 CTGTGGGTGGAGACTCCAGGAGG - Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1091447183 12:550779-550801 CTGTGGCTGAGGCTGCCAGCTGG - Intronic
1091727735 12:2857303-2857325 CTCAGGGTGGGGATGGCAGTGGG + Intronic
1091746130 12:2994380-2994402 CTGTTGGTGGGAATGCAAAATGG - Intronic
1092570439 12:9715712-9715734 CAGTGGGTGGGGATGGCAACTGG - Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093104086 12:15065454-15065476 CTGGGGATGGGGATGTCAGGTGG + Intergenic
1094080113 12:26525416-26525438 CTGTAGGTAGAGATGCCAGTAGG - Intronic
1094603485 12:31931020-31931042 TGGTGGGTGGGGAAGCCAGTGGG - Intergenic
1095802465 12:46282437-46282459 CTGGGGATGGGGATACCAAATGG - Intergenic
1095958741 12:47820529-47820551 GTGTGTGTGGGGGTGCCAGTGGG - Intronic
1096039920 12:48506075-48506097 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1097256451 12:57679231-57679253 TTGTTGGTGGGAATGCCAAATGG + Intergenic
1098734847 12:74087356-74087378 CTGTAGGTGGGAATGCAAAATGG - Intergenic
1099171808 12:79374058-79374080 CCGTGGGGTGGGGTGCCAGAGGG - Intronic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100400943 12:94229002-94229024 CTGTTGGTGGGAATGCAAAATGG - Intronic
1101245662 12:102882058-102882080 CTGCTGGTGGGGATGTCAGTTGG - Intronic
1101849935 12:108393867-108393889 CCGGGGTGGGGGATGCCAGAGGG - Intergenic
1101999771 12:109550034-109550056 CTGCGAGTGGGCATGCCAGGTGG - Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102156135 12:110729649-110729671 CTGGGTGTGGATATGCCAGAAGG + Intronic
1103500917 12:121400698-121400720 CTCAGGGTGGGGATGCCACCCGG + Intronic
1104319651 12:127738623-127738645 CAGTGGGTGGGGGTGCCTTATGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104564326 12:129866663-129866685 CTGTGGGTGGGAATGTAAGTTGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104980601 12:132571678-132571700 CTTGGGGTGGGGACACCAGAAGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105597448 13:21852282-21852304 CTTTGTGTGGGGATGCCAAGAGG + Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105777430 13:23676825-23676847 GTGTGAGTGGGGGTGTCAGAGGG - Intergenic
1107302829 13:38984009-38984031 CTGTGGGGGGGGATGCCTCCAGG - Intronic
1108068093 13:46599447-46599469 CTGTGGGTGGGAATGTAAAATGG - Intronic
1108361905 13:49675791-49675813 CTGTTGGTGGGAATGCAAAATGG - Intronic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1109744111 13:66598126-66598148 CTGTTGGTGGGAATGCAAAATGG + Intronic
1109989955 13:70041603-70041625 CTGTGTCAGTGGATGCCAGATGG - Intronic
1110336985 13:74344864-74344886 CTGGGGATTGGAATGCCAGATGG + Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1111584579 13:90268291-90268313 AGGTGGATGGGGAGGCCAGAAGG + Intergenic
1112588305 13:100739324-100739346 CTGTTGGTGGGGATGTAAAACGG + Intergenic
1112833237 13:103479308-103479330 CTGTTGGTTGGGATGCAAAATGG + Intergenic
1113303014 13:109043744-109043766 CTGGGGGAGGGGATCCCAGATGG + Intronic
1113434042 13:110275446-110275468 TTGCGGGTGGGGATACAAGATGG + Intronic
1114160825 14:20165205-20165227 CTGGGGAGGGGAATGCCAGATGG + Intergenic
1114908081 14:27155275-27155297 TTGTGGGTGGGAATGCATGATGG - Intergenic
1116548695 14:46206028-46206050 CTGTTGGTGGGGATGCAAAATGG + Intergenic
1116715187 14:48417748-48417770 CTGGGGATGGGGTTGCAAGATGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117561445 14:56943578-56943600 CTTTGAATGTGGATGCCAGAGGG - Intergenic
1117660701 14:58001502-58001524 CTGTGGGTGGGAATGTAAAATGG - Exonic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1118724882 14:68621948-68621970 CTCTGGTTGGGGGTGGCAGATGG + Intronic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119801681 14:77450874-77450896 TTGTTGGTGGGAATGCCAAATGG - Intronic
1120253178 14:82085227-82085249 TTGTGAGTAGGGATGCCTGAGGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121657602 14:95609001-95609023 CTGTTGGTGGGGATGTGAAATGG - Intergenic
1122302552 14:100739210-100739232 CCTTGGGTGGGGAGACCAGAGGG - Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122672207 14:103381409-103381431 CTGTTGGTGGGGATGTAAAATGG - Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1124247015 15:28079704-28079726 CTGAGTGTGGAGATGCCAGAAGG - Intronic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1127163070 15:56211918-56211940 CTGCTGGTGGGGATGCAAAATGG + Intronic
1127496775 15:59520237-59520259 CTGTTGGTGGGAATGCAGGATGG - Intronic
1128107137 15:65053479-65053501 CTGTGGGTCGGGAAGCCTGTAGG + Exonic
1128607442 15:69047428-69047450 CTGCGGGTGGGGGTCCCATAAGG - Exonic
1128642375 15:69349147-69349169 TTGTGGGTGGGGATGCTAATTGG - Intronic
1128696372 15:69766492-69766514 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1129455907 15:75676124-75676146 CTGGAGGTGGGCAGGCCAGAGGG - Exonic
1129583621 15:76838840-76838862 TTGTGGGTGTGGCTGCCGGAAGG - Intronic
1129685742 15:77685158-77685180 GGGTGGGTGGGTATGCTAGAGGG + Intronic
1129686974 15:77691899-77691921 GCGTGGGTGGGGGTGACAGATGG - Intronic
1130672184 15:85922410-85922432 CTGTGGCTGGAGCTGCCTGAAGG + Intergenic
1131027980 15:89161353-89161375 CTTTGAGAGGGGATGCCAGAAGG - Intronic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133538192 16:6722246-6722268 CTGTGGGTGGAAATGCAAAACGG - Intronic
1134415733 16:14042050-14042072 CTGTTGGTGGGAATACAAGATGG - Intergenic
1135975722 16:27108095-27108117 CTGTGTGTGGGGGTGCCCCAGGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136228978 16:28876120-28876142 CTGTGGGAAGGGATCCCCGAGGG + Intergenic
1136252625 16:29015933-29015955 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136592034 16:31223351-31223373 CTGTGGCTGGGGAGGCCCAAGGG + Intronic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1138354758 16:56368245-56368267 TTGTGGGTGGGGATGTGAGCTGG - Intronic
1138552757 16:57756442-57756464 CTGTGGGTGTGGATATCAGCAGG + Exonic
1138621584 16:58215675-58215697 CAGTGGGTGGGGATGACAGCAGG - Intergenic
1138830910 16:60373740-60373762 CTGTGGTTGGGGCAGCGAGAGGG - Intergenic
1138942893 16:61811441-61811463 CTGTTGGTGGGAATGCAAAATGG + Intronic
1139468602 16:67166789-67166811 CTGGGAGTGGGGATACCAGGTGG - Intronic
1139775078 16:69311706-69311728 CTGAGGGTGGAGATGCCACCCGG - Intronic
1140250333 16:73289378-73289400 CTTTTGGTGGGGATGTAAGAGGG + Intergenic
1140916702 16:79500291-79500313 ATGTTGGTGGAGATGGCAGATGG - Intergenic
1141473787 16:84258219-84258241 CTGTGAGAGGGGAAGCCAGCTGG + Intergenic
1141667704 16:85474436-85474458 CGGGCAGTGGGGATGCCAGAGGG + Intergenic
1142006444 16:87691593-87691615 CTGGGGGTGGGGCTGGCAGGAGG - Intronic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143519975 17:7439496-7439518 CTGTGGGTGGGGCAGCGAGTCGG + Exonic
1143554072 17:7650179-7650201 GTGGGGGTGGGGGTGCCAGGAGG + Intronic
1144330040 17:14214726-14214748 CTGTGGGTGGGAGAGCCTGAGGG - Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145095973 17:20026883-20026905 CTGTGGGTAGGGATGCAAATTGG - Intronic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1146561582 17:33874685-33874707 AGGAGGGTGGGGATGCCAGTAGG - Intronic
1147656042 17:42091637-42091659 GTGGGGGTGGAGAGGCCAGAGGG - Intergenic
1147968191 17:44205542-44205564 CTGGGGGTGGGGAGGCCTGGGGG - Exonic
1148841335 17:50499497-50499519 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1148863271 17:50615532-50615554 CTGGAGGTGGGGGGGCCAGATGG - Intronic
1149180570 17:53931739-53931761 CAGCAGGTGGGGAAGCCAGACGG + Intergenic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150282102 17:63934685-63934707 CAGGGGGTGGGGAAGCAAGAAGG + Intergenic
1150434155 17:65141107-65141129 CTGTGGGTCGGGATGCCCGCCGG + Intronic
1150955199 17:69850708-69850730 CTGTGGGTGGGAATGCAAAATGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1152025418 17:77805740-77805762 ATGGGGGAGGGGACGCCAGATGG + Intergenic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152727926 17:81956791-81956813 CTGTGGGTGGGGAGCCCCGGGGG - Intronic
1154123054 18:11667017-11667039 CTTTGGGTGGGGACGCATGAGGG - Intergenic
1154941408 18:21116233-21116255 GTGTGGGAGGGAATGCCACAAGG - Intergenic
1154945259 18:21156768-21156790 CTGAAGATGGGGATGCCAGGTGG + Intergenic
1156514936 18:37671394-37671416 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
1157592143 18:48842391-48842413 CTGTGGGTGGGAGTGCTAGAGGG + Intronic
1157948076 18:52003633-52003655 CTGAGGGAGGAGAAGCCAGAAGG - Intergenic
1158140097 18:54246499-54246521 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1158524537 18:58200673-58200695 CTGTTAGTGGGGCTACCAGAGGG + Intronic
1160002788 18:75043113-75043135 CTGCTGGTGGGGATGCGAAATGG - Intronic
1160068618 18:75604110-75604132 CTGGGGTTGGGGGTGGCAGAAGG + Intergenic
1160095095 18:75864010-75864032 CTGTGGGTTGGGATGACCGTGGG + Intergenic
1160561253 18:79757460-79757482 CTGTGGGTGGGAATGCAAAATGG - Intergenic
1160738776 19:676525-676547 CGGTGAGTGGGGCGGCCAGAGGG + Exonic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161087583 19:2342289-2342311 CAGTGGGTGGGGCTGCCATGCGG - Intronic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1162030092 19:7913525-7913547 CTGAGGGTGGGGGTGCGAGGTGG + Exonic
1162363123 19:10231276-10231298 CTGGGGCTGGGGTTGCCAGCCGG + Intronic
1162537829 19:11274224-11274246 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1162743861 19:12788603-12788625 CTGAGGCTGGCCATGCCAGAGGG - Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165984962 19:39760084-39760106 CTGTGGGTAGGAATGCAAAATGG + Intergenic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166622741 19:44317254-44317276 CTGTTGGTGGGGATGTAAGTTGG - Intergenic
1168062428 19:53900386-53900408 GGGTGGGTGGGGACGTCAGAAGG - Intronic
1168267330 19:55230019-55230041 GCGTGGGTGGGGGTGCCAGAGGG - Exonic
925376037 2:3386921-3386943 CTGTTGGTGGGAATGACAAACGG + Intronic
927547096 2:23963687-23963709 CTGTTGATGGGGATGCAAAATGG + Intronic
928096975 2:28410695-28410717 CTCTGGCTGGGGATGAAAGAAGG + Intronic
928341984 2:30451312-30451334 TTGTTGGTGGGGATGTCAAATGG + Intronic
928891449 2:36208347-36208369 CTGTTGGTGGGTATACCAGTTGG - Intergenic
929487000 2:42363602-42363624 GTGTGGGTTGGGATGTCACATGG + Intronic
929546060 2:42855848-42855870 CTGTGTGTGGCCAGGCCAGAGGG - Intergenic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
930601073 2:53443927-53443949 CTGTGGGTGGGAATGCAAAGTGG - Intergenic
931122146 2:59231739-59231761 CTGAGGGTGGAGATGCCAGAGGG + Intergenic
932107805 2:68963192-68963214 TTGCTGGTGGGGATGCAAGATGG + Intergenic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
934176864 2:89584633-89584655 CTGGGTGTGGGGATCCTAGAGGG - Intergenic
934287171 2:91658993-91659015 CTGGGTGTGGGGATCCTAGAGGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934717629 2:96552695-96552717 TTGTGGGTGGGGCTGCCATTAGG + Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936225664 2:110647941-110647963 CTGTTGGTGGGAATGCTAAATGG + Intronic
936491135 2:112973057-112973079 CTCCTGGTGGCGATGCCAGATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936818183 2:116485214-116485236 CTGTGGATGGGGATGCCAGGTGG - Intergenic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
937156463 2:119723286-119723308 AGGTGGGTGGGGGTGCCAAAGGG + Intergenic
937889872 2:126930751-126930773 CTGGGGACTGGGATGCCAGACGG + Intergenic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
939436216 2:142181062-142181084 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941125205 2:161576324-161576346 AGGTGGATGGGGAGGCCAGAAGG - Intronic
941584165 2:167336103-167336125 TTGGTGGTGGGGATTCCAGAGGG + Intergenic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
943647567 2:190423736-190423758 CTGTGGGTGGGGATTTAAAATGG - Intronic
945866428 2:215181869-215181891 CTGGAGATGGGGATGCCAGGTGG + Intergenic
946186219 2:217981956-217981978 GTGTGGGAGGGGACTCCAGAAGG - Intronic
946307853 2:218866152-218866174 CTGTGGGTGGGGGTTGCACAGGG - Intronic
946408882 2:219506793-219506815 CTCTGAGTAGGGCTGCCAGAAGG + Exonic
947043505 2:225950231-225950253 CTGTGGATGGGGATGCCAGGTGG - Intergenic
947749862 2:232526385-232526407 CTGGGAGTGGGGACCCCAGAAGG - Intronic
947947429 2:234118399-234118421 GTGTGGGTGGGGATACAAAATGG - Intergenic
948529104 2:238592387-238592409 CTGTTGGTGGGAATGCGAAATGG - Intergenic
948547124 2:238740703-238740725 CTGCCGGTGGGGATGCAAAATGG + Intergenic
948706565 2:239796915-239796937 CTGTCGGTGGGAATGTCAAATGG - Intronic
948873764 2:240816989-240817011 CTGAGGGTGGGGATCCCAGTGGG + Intronic
1169208461 20:3752905-3752927 GGGTGGATGGGGAGGCCAGAGGG + Exonic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1170443354 20:16400402-16400424 CTGTTGGTGGGAATGCAAAATGG + Intronic
1170547712 20:17449257-17449279 CTGTGGGTGGGGCTGTCTGCTGG - Intronic
1170593683 20:17790087-17790109 ATCTGGGTGGGGATCCCAGCAGG - Intergenic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1172093643 20:32450274-32450296 CTGAGGCTGGGGAGGCCAGTGGG + Intronic
1172097266 20:32466560-32466582 CTGGGGGAGGGGAGGCCAGGAGG + Intronic
1172190976 20:33061727-33061749 ATGTGGGTGCGGCTGCCAGGTGG - Intronic
1172641650 20:36443736-36443758 CTGTCGGTGGGGAGGCCAGCTGG - Intronic
1172886846 20:38237064-38237086 CTGTGGGTACAGATGCCAGCAGG + Intronic
1173384080 20:42572381-42572403 TGGTGGGTGGTGAGGCCAGAGGG - Intronic
1173429012 20:42968957-42968979 CTGTGTGTGTGGATTCCACATGG - Intronic
1173464098 20:43267692-43267714 CGGTGGGTGGGCGTGGCAGAGGG - Intergenic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1173894614 20:46541557-46541579 CTGGGTGTGGGGACGCAAGAAGG + Exonic
1173984465 20:47250374-47250396 GGGTTGGAGGGGATGCCAGAGGG - Intronic
1174101934 20:48134114-48134136 CTGTTGGTGGGAATGCAAAATGG + Intergenic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174661562 20:52218036-52218058 CTTTTGGAGGGGATGCCACAGGG - Intergenic
1174772718 20:53316185-53316207 TTGTGAGTGGGGATGACTGAGGG - Intronic
1174862930 20:54109338-54109360 CTGTTGGTGGGAATGCAAAATGG + Intergenic
1175336834 20:58201804-58201826 CTGCGGGTGGGAATGCAAAAGGG + Intergenic
1175429626 20:58891997-58892019 CTGTGGGGGGCGAGGCCGGAAGG + Intronic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1175835310 20:61989948-61989970 CTGTGGGTGGAGGTGCGATAAGG + Intronic
1176149925 20:63585440-63585462 TTGCGGGTGGGAATGCGAGATGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176385786 21:6138038-6138060 CTGTGGATGCGTAGGCCAGAGGG - Intergenic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1177204383 21:17994736-17994758 GTGTGGGTGCCGATGGCAGAAGG + Intronic
1179403261 21:41103670-41103692 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179737687 21:43400214-43400236 CTGTGGATGCGTAGGCCAGAGGG + Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179876854 21:44273036-44273058 CCAGGGGTGGGGGTGCCAGAGGG + Intergenic
1179916342 21:44480512-44480534 CCATGGGTGGGGTTGGCAGATGG + Intergenic
1180611005 22:17097942-17097964 CGGTGAGTGGGCATGCCAGCAGG + Exonic
1181007196 22:20019518-20019540 CTGGGGGTGGGGATGGCCCAAGG + Intronic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181967813 22:26668850-26668872 CTCTGGGAGGGGCAGCCAGAGGG + Intergenic
1182370288 22:29805815-29805837 CTCTGGGTGGGGGTCTCAGATGG - Intronic
1182445972 22:30389919-30389941 CTGTTGTTGGGGCTGACAGATGG - Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183724804 22:39582602-39582624 CTGAGAGTGGGGATCCCTGAAGG + Intronic
1184547455 22:45181125-45181147 GGGGGGGGGGGGATGCCAGAAGG - Intronic
1184861661 22:47176233-47176255 CTGAGGGTGGGGCACCCAGACGG - Intergenic
1185151161 22:49164691-49164713 CTGTGGGTGGGGCTGTAAGTGGG - Intergenic
1185151196 22:49164777-49164799 CTGTGGGTGGGGCTGTAAGTGGG - Intergenic
1185186104 22:49401394-49401416 CCGTGAGTGGGACTGCCAGAGGG + Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
949793238 3:7816732-7816754 GTGTGGGTGGGGGTGACAGGAGG + Intergenic
949888326 3:8713734-8713756 CTGTGTGCTGGGCTGCCAGAGGG + Intronic
949978751 3:9485504-9485526 TTGTTGGTGGGAATGCAAGATGG + Intergenic
950451062 3:13066067-13066089 CAGGGGCTGGGGATGCAAGATGG + Intronic
950453820 3:13080650-13080672 CTGTGGGTAAGGATGCCTGCTGG - Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951528979 3:23681380-23681402 CTGTGGGTGGGTCTTCCTGAGGG - Intergenic
951541176 3:23783439-23783461 CTGTGTGAGGTGATGCCAGGGGG + Intergenic
952962188 3:38599141-38599163 CTCAGGCTGGGGATGCCACAGGG + Intronic
954317195 3:49807529-49807551 TTGGGGGTGGGGATGGCTGACGG + Intronic
954472190 3:50707604-50707626 GTGGGGATGGGGATGTCAGATGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955661689 3:61306389-61306411 CTGTTGGTGGGAATGCAAAATGG - Intergenic
955887279 3:63614027-63614049 CTGTGGGTAGTGGTGGCAGAGGG - Intronic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
959526928 3:107388044-107388066 CAGTGGGTGGGGGTCCCAGTTGG + Intergenic
959628151 3:108476862-108476884 TTGTGGGTGGGAATGCAAAATGG + Intronic
960108149 3:113819959-113819981 GTGTGGGTGGGGAAAACAGAGGG - Intergenic
960224039 3:115148174-115148196 CGGTGGGTGGGAAAGCCGGAGGG + Intergenic
960455003 3:117860204-117860226 ATGTGGGAGGGGACGTCAGAAGG - Intergenic
960621254 3:119638766-119638788 CTGAGGGGGGCGATCCCAGAGGG + Intronic
961468315 3:127095119-127095141 CTGTTGGTGGGAATGTCAAATGG - Intergenic
961506669 3:127374858-127374880 CTGTGGGTGGAGATGCTCCATGG - Intergenic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961736613 3:129005671-129005693 CTGGGGGTGGAGCAGCCAGAAGG + Intronic
961967413 3:130919791-130919813 CTGTTGGTGGGAATGCAAAATGG - Intronic
962488417 3:135866957-135866979 CTGTAGGTGGGACTGCTAGAAGG + Intergenic
962565608 3:136655816-136655838 CTGTTGGTGGGGATGTAAAATGG + Intronic
962882184 3:139588622-139588644 CTCCAGGTGGGGGTGCCAGAGGG + Intronic
963758491 3:149259978-149260000 CTGGGGATGGGGATGCCAGATGG - Intergenic
963928863 3:150980924-150980946 ATATTGGTGGGAATGCCAGATGG + Intergenic
964344761 3:155744663-155744685 CTGTGCGTGGGGATCCCCTAAGG - Intronic
965231023 3:166052770-166052792 CTTAGGATTGGGATGCCAGAGGG - Intergenic
966089501 3:176115673-176115695 ATGTGTGTGGAGATGCCAAATGG + Intergenic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
966443477 3:179974276-179974298 CTGTGGGAGGAGAAGCCACAGGG + Intronic
966590569 3:181678124-181678146 CTGTTGGTGGGAATGCAAAATGG - Intergenic
966749840 3:183311471-183311493 CTCTGTATGTGGATGCCAGACGG + Intronic
968280568 3:197473835-197473857 CCGTGGGTGGAGATGCTAGGAGG - Intergenic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
968484608 4:853071-853093 CTGTGGGAGGTGAGGCCAGCGGG - Intronic
969304969 4:6320488-6320510 CAGTGGGTGGGGATGCCCATGGG - Intergenic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969915411 4:10485972-10485994 TTGTTGGTGGGAATGCCAAATGG - Intergenic
970062939 4:12055569-12055591 CTGTTGGTGGGAATGCTAAATGG - Intergenic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970748102 4:19324286-19324308 CTGTTGGTGGGAATGTGAGATGG - Intergenic
971244738 4:24917503-24917525 CTGTTGGAGGGGTTCCCAGAAGG + Intronic
971593459 4:28497911-28497933 CTGTAGGTGGGGAATCCTGATGG - Intergenic
973634789 4:52851987-52852009 CTGGTGGTGGGGAAGTCAGAGGG - Intergenic
973876652 4:55226822-55226844 CTGGGGGTGGGGGTGACAGGTGG - Intergenic
974986975 4:69040258-69040280 CTGTTGGTGGGAATGACAAATGG - Intronic
976140330 4:81984930-81984952 CTGTGGGTTGGGGTGACAGATGG - Intronic
976620610 4:87123374-87123396 CTGTGGCTGCAGCTGCCAGATGG + Intronic
977551336 4:98447035-98447057 CTGTGGGCAAGCATGCCAGAAGG - Intergenic
977977533 4:103284837-103284859 CTTTTGGTGGGGATGCAAAATGG + Intergenic
978259520 4:106737736-106737758 CTGTTGGTGGGAATGCAAAATGG + Intergenic
980438303 4:132809546-132809568 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
980797991 4:137710848-137710870 CTGAGGACTGGGATGCCAGATGG + Intergenic
980935216 4:139219624-139219646 CGGGGGGTGGGGATGGCAGTGGG + Intergenic
982415389 4:155125305-155125327 CTGTTGGTGGGGATGTAAAATGG + Intergenic
982583847 4:157212372-157212394 CTGTTGGTGGGAATGCTAAATGG - Intronic
983886004 4:172981299-172981321 CTGTTGGTAGGAATGCCAAATGG - Intronic
983917200 4:173305120-173305142 CTGTTGGTGGGAATGCAAAATGG - Intronic
984076724 4:175190938-175190960 CTGTTGGTGGGAATGCAAAATGG + Intergenic
984263644 4:177471092-177471114 CAGCGGATGGGGAAGCCAGAAGG + Intergenic
984467233 4:180116139-180116161 CTGCTGGTGGGAATGCCACAGGG + Intergenic
985482911 5:128582-128604 CTGGAGGTGGGGCTGCCAGTGGG + Intergenic
985500828 5:243953-243975 CAGTGAGTGAGGGTGCCAGATGG + Intronic
985615379 5:916934-916956 CAGGGGCTGTGGATGCCAGATGG + Intronic
985760905 5:1747982-1748004 GTGTCTGTGGGGATGCAAGAGGG - Intergenic
986484020 5:8217295-8217317 CTGCGGATGGGGGAGCCAGAAGG - Intergenic
986623603 5:9702831-9702853 TTGGGGGTGGGGGTGTCAGATGG + Intronic
986678552 5:10212174-10212196 CTGTTGGTGAGAATGCCAAAGGG + Intergenic
986973730 5:13370607-13370629 CTGTTGGTGGGGATGTCAATTGG + Intergenic
989102278 5:37834583-37834605 CTGCGGGTGGGGGTGCGAGGGGG + Intronic
990289600 5:54334662-54334684 CTGAGAATGGGGATGTCAGATGG - Intergenic
990680190 5:58233950-58233972 CTGTGATTGGGGTTGCCAGCAGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992948024 5:81828713-81828735 CTGTTGGTGGGAATGCAAAATGG + Intergenic
993035569 5:82752964-82752986 CTGTTGGTGGGAATGTCAAATGG - Intergenic
993087843 5:83385804-83385826 CTGTTGGTGGGGGTGCAAAATGG + Intergenic
994016960 5:94978243-94978265 CTGTTGGTGGGAATGCAAAATGG + Intronic
994591884 5:101783892-101783914 CTGGGAGTGGGGCTGCAAGAAGG + Intergenic
996615580 5:125437172-125437194 CTGTAGGGGGGGAAGCCTGAGGG - Intergenic
997871366 5:137508085-137508107 CTGTTGGTGGGAATGCAAAATGG - Intronic
998038361 5:138935448-138935470 CTTAGGGTGGGGATGCCAGCTGG - Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998951376 5:147395975-147395997 ATGGGGTTGGGGTTGCCAGAGGG + Intronic
999151674 5:149430444-149430466 CTGGGGGTGGGGGCGCCAGAGGG + Intergenic
999309282 5:150541427-150541449 CTGGGGGTGGGGATGTGACAAGG + Intronic
999363750 5:151007708-151007730 CAGTGGGATGGGCTGCCAGAGGG + Intergenic
1001528340 5:172444942-172444964 CTGTGGGTAGAGGGGCCAGAAGG - Intronic
1001550582 5:172599415-172599437 CTGCTGGTGGGGATGTCAAATGG + Intergenic
1001748351 5:174109241-174109263 CTGGGGGTGGGGGTCCCGGAGGG + Intronic
1002431718 5:179207958-179207980 CTGTGGCTGGGGTTGCCACCAGG - Intronic
1002469868 5:179428826-179428848 CAGCCGGTGGGGATGACAGAGGG + Intergenic
1002762250 6:211004-211026 CTGCGGGTGGTCATTCCAGAGGG - Intergenic
1002842774 6:920801-920823 CAGTGGATGGGGGAGCCAGAAGG - Intergenic
1003130136 6:3388447-3388469 CTGCTGGTGGGAATGTCAGATGG + Intronic
1003255877 6:4474506-4474528 TTGTGGGTGGAGATGTCAGCAGG - Intergenic
1003685722 6:8300063-8300085 CTGTGGGGGAGTATGGCAGAGGG - Intergenic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1004459019 6:15818227-15818249 CTGTGGGGTGGCAGGCCAGAGGG - Intergenic
1005570588 6:27141815-27141837 TAGTAGGTGGTGATGCCAGAAGG + Intergenic
1005959323 6:30684710-30684732 CTGGGGGTGGGGGAGACAGAGGG + Exonic
1006093495 6:31641982-31642004 TTGTGGGTGGGCAGGCCAGGTGG - Intronic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1006639318 6:35480996-35481018 CTGTGGTTGGGGTTGACAGGAGG - Intronic
1007282111 6:40720440-40720462 GTGGGGGTGGGGAGGCCTGAGGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1012606813 6:101167937-101167959 CAGCAGATGGGGATGCCAGAAGG - Intergenic
1016002217 6:139053234-139053256 CTATGGGTAGGGATACCAGTAGG - Intergenic
1016247149 6:141995520-141995542 CTGAAGACGGGGATGCCAGATGG - Intergenic
1017078800 6:150646461-150646483 ATGTTGGTGCGAATGCCAGAAGG + Intronic
1017590162 6:155970476-155970498 TTGTGGGTGGGAATGCAAAATGG + Intergenic
1018213101 6:161501221-161501243 CTGTTGGTGGGAATGCAAAATGG - Intronic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431399 7:1001423-1001445 CTGTGGGTGGGGATTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431542 7:1001897-1001919 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431755 7:1002631-1002653 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019639497 7:2095871-2095893 GGGTGGGTGGGGGTGCCTGAAGG + Intronic
1019693010 7:2427566-2427588 CTGTAGGGGGGGGTGGCAGATGG - Intronic
1019978462 7:4603284-4603306 CTGTGGCTTGGGCTGCTAGAAGG - Intergenic
1022216512 7:28267950-28267972 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1022283762 7:28935615-28935637 CTGGGGGTGGGGCAGGCAGAGGG + Intergenic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023689645 7:42772827-42772849 CTGTGGGAGGGGCTGTCCGAGGG - Intergenic
1023921890 7:44636252-44636274 CTGGGGGAAGGGATGTCAGATGG + Intronic
1024456803 7:49617781-49617803 CTGTAGTTGGGAATGACAGAGGG + Intergenic
1025018618 7:55463614-55463636 CTGGGGATGGGGATGCCAGGTGG + Intronic
1027231708 7:76276520-76276542 CTGAGGGTAGGGATGCCAATAGG + Intronic
1028520225 7:91721409-91721431 CTGGGGGTGGGGATTCCAAGTGG - Intronic
1028582669 7:92423395-92423417 CTGGGTTTGGAGATGCCAGAGGG - Intergenic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1029495122 7:100892451-100892473 CTGTGGATGGGGGTGCCCCACGG - Exonic
1029620573 7:101687959-101687981 CTGTGGCAGAGGATCCCAGAAGG - Intergenic
1030097991 7:105918309-105918331 CTGTTGGTGGGAATGTCACATGG - Intronic
1031686949 7:124742154-124742176 TTGTGGGTGGGAATGCAAAATGG + Intergenic
1032399857 7:131617185-131617207 CTGTGGGTGGGGTCTCCAGCAGG - Intergenic
1032547451 7:132755720-132755742 CTGTGGGTGGGGTTGGCACCAGG - Intergenic
1033278783 7:139991383-139991405 CTGGGGGTGGAGAAGCCAGGAGG - Intronic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1034298339 7:149993662-149993684 CTGTGGGTGGGGATTGCAAAGGG - Intergenic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034527548 7:151675381-151675403 CTGTGGGTGGGGCTGCCGGGTGG - Intronic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1034807675 7:154103120-154103142 CTGTGGGTGGGGATTGCAAAGGG + Intronic
1034990190 7:155543082-155543104 CTGAGGGTGCTGATGCCACAGGG - Intergenic
1035251165 7:157598187-157598209 CGCTGGGTGGGGAAGACAGAGGG - Intronic
1035361492 7:158316579-158316601 CTGAGGGAGGAGATGCCAGGAGG - Intronic
1036447782 8:8837817-8837839 CTGTGGGTGGGAATGTAAAATGG + Intronic
1037551788 8:19981384-19981406 TCGTTGGTGGGGATGCCAGATGG + Intergenic
1038154611 8:24977039-24977061 CTGTTGGTGGAGATGCAAAATGG - Intergenic
1040063732 8:43127612-43127634 CTGGGGAAAGGGATGCCAGAGGG + Intergenic
1041113922 8:54515679-54515701 CTGTGTGTGGTGTTGGCAGAGGG + Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042448672 8:68919901-68919923 CTGTGAGTAGGTTTGCCAGATGG + Intergenic
1042616871 8:70659276-70659298 CTGTGGGTAGGGAGACCAAAAGG + Intronic
1043851868 8:85225114-85225136 CTGTGGTAGGGGGTGCCACAGGG - Intronic
1044737264 8:95291881-95291903 CTGTAGGTGGGAATGCAAAATGG + Intergenic
1045139258 8:99261663-99261685 CTGTTGGTGGGAATGCAAAATGG - Intronic
1045268852 8:100644581-100644603 CTGCAGGTGAGGATGACAGAGGG + Intronic
1045337765 8:101224032-101224054 CTGACGGTGGAAATGCCAGAGGG + Intergenic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1046565773 8:115898841-115898863 ATGTGGGTGGGGATGCGGGTAGG + Intergenic
1047888179 8:129276576-129276598 CTATGGGAGGGGAGGCCATAAGG - Intergenic
1047982651 8:130198962-130198984 CTGTGGGTTGAGAAGCCAAAAGG - Intronic
1048434451 8:134403045-134403067 ATGTGGGTGTGGATACCAGAAGG - Intergenic
1049606593 8:143532521-143532543 CTGTGGATGGGGCAGCCAGGTGG - Intronic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050219803 9:3374217-3374239 CTGTTGGTGGGGATGTGAAATGG + Intronic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050809000 9:9719695-9719717 CTGAGGTCGGGGATCCCAGAAGG - Intronic
1052052086 9:23860136-23860158 CTGTGCATGGGGATACCAGTAGG - Intergenic
1052254671 9:26441073-26441095 TGGGGGGTGGGGATGGCAGATGG - Intergenic
1052879226 9:33590474-33590496 CTGGGGGTGGGGGTGAAAGATGG + Intergenic
1052990617 9:34517513-34517535 AGGAGGGTGGGGATGACAGAAGG + Intronic
1053411146 9:37916799-37916821 CTGTTTGGGGGGCTGCCAGAAGG + Intronic
1053496752 9:38553745-38553767 CTGGGGGTGGGGGTGAAAGATGG - Intronic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1054473509 9:65557005-65557027 CTGGGGGTGAGGATGCCAAACGG - Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1054998408 9:71420259-71420281 CTGAGGCTGGGGATGCTACATGG + Intronic
1055054371 9:72010542-72010564 CAGCAGATGGGGATGCCAGAAGG + Intergenic
1055771461 9:79721270-79721292 CTGTGGGTGGCTGTGCAAGACGG - Intronic
1056479127 9:86983202-86983224 CAGTTGGAGGGGATGCGAGACGG - Intergenic
1056672657 9:88644188-88644210 TTGTGGGTGGGAATGTAAGATGG - Intergenic
1056809678 9:89754577-89754599 CTGTGGGTGGGGATTCCCTGAGG - Intergenic
1057676667 9:97141301-97141323 CTGGGGGTGGGGGTGAAAGATGG - Intergenic
1057823409 9:98352526-98352548 ATGTGGGTGGTGATGGCAGCAGG + Intronic
1059053451 9:110953293-110953315 CTGGGGCCGGGGATGTCAGATGG - Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059531049 9:115036045-115036067 CTGTGGGTGGGCACCCCAGAAGG + Intronic
1059557214 9:115293301-115293323 GTGGTGGTAGGGATGCCAGAGGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060977256 9:127771795-127771817 ATGTAGGAGGGGATGACAGAAGG + Intronic
1061504123 9:131021353-131021375 CTGTGGGTGGGAATGTGAAATGG - Intronic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062562358 9:137147093-137147115 CCGTGGGTGGACATGCCAGAAGG - Intronic
1186264750 X:7820100-7820122 CTGTTGGTGGGAATGTAAGATGG - Intergenic
1186767414 X:12785219-12785241 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1186997658 X:15140862-15140884 CTGGGGATGGGGAACCCAGAAGG + Intergenic
1187326601 X:18295765-18295787 CTGTGGATGAGGACGCCAGGTGG - Intronic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187492604 X:19766111-19766133 CTGTCGGTGGGGATGTAAAATGG - Intronic
1187911272 X:24113484-24113506 TTGTGGGTGGGAATGCAAAATGG - Intergenic
1188181586 X:27062960-27062982 CTGTTGGTGGGAATGCAAAATGG + Intergenic
1188938697 X:36210303-36210325 CTGTTGGTGGGAATGTAAGATGG - Intergenic
1189120599 X:38390293-38390315 ATCTGGGTAGAGATGCCAGAGGG + Intronic
1189532724 X:41902953-41902975 GTGTGGGTGGGGATTAAAGAAGG + Intronic
1189535639 X:41932672-41932694 CTGTTGGTGGGGATGTAAAATGG + Intergenic
1191710747 X:64148142-64148164 CTGTGTGTTGGGCTGCCATAGGG - Intergenic
1192149134 X:68701104-68701126 CTGTGGGTGGGCATGGCCAAAGG - Intronic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1193836335 X:86349174-86349196 AGGTGGATGGGGAGGCCAGAAGG + Intronic
1193865429 X:86725494-86725516 CTGGGGACTGGGATGCCAGATGG + Intronic
1196006650 X:110843908-110843930 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
1197684805 X:129427757-129427779 CTGTGGGTGGAGATGTCAATGGG + Intergenic
1197960405 X:131999088-131999110 CTGTTGGTGGGAATGCAAAATGG - Intergenic
1197985352 X:132260929-132260951 CTGTTGGTGGAGATGCCAATTGG + Intergenic
1198684969 X:139218874-139218896 CTGTTGGTGGGGTTGCAAGGGGG + Intronic
1199733999 X:150667201-150667223 TTGTTGGTGAGGATGCCAGGAGG - Intronic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200765264 Y:7075614-7075636 CTGTAAGTGGGGTTGCCAGGGGG - Intronic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1202119277 Y:21507806-21507828 GTGTGGGTGATGATGGCAGAGGG + Intergenic
1202121729 Y:21531346-21531368 GTGTGGGTGATGATGGCAGAGGG + Intronic
1202157276 Y:21898036-21898058 GTGTGGGTGATGATGGCAGAGGG - Intronic
1202159723 Y:21921577-21921599 GTGTGGGTGATGATGGCAGAGGG - Intergenic