ID: 1143096639

View in Genome Browser
Species Human (GRCh38)
Location 17:4481761-4481783
Sequence CATTGACACCCCAGGCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143096635_1143096639 3 Left 1143096635 17:4481735-4481757 CCAGTAGGTAGAGCGGTGGCAAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1143096639 17:4481761-4481783 CATTGACACCCCAGGCTATAAGG 0: 1
1: 0
2: 1
3: 14
4: 84
1143096633_1143096639 8 Left 1143096633 17:4481730-4481752 CCTGTCCAGTAGGTAGAGCGGTG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1143096639 17:4481761-4481783 CATTGACACCCCAGGCTATAAGG 0: 1
1: 0
2: 1
3: 14
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143096639 Original CRISPR CATTGACACCCCAGGCTATA AGG Intronic
901887659 1:12234278-12234300 TATTGAGAACCCAGGCTACAAGG - Exonic
903803725 1:25989347-25989369 CCTGGACACTGCAGGCTATAAGG + Intronic
903942797 1:26943082-26943104 CATCAACACCCCAGGCTAGAAGG - Intronic
904964813 1:34363523-34363545 CAGTCACACCCCAGGGAATAAGG + Intergenic
913264356 1:117030005-117030027 AATTGATAGGCCAGGCTATAAGG + Intronic
917583924 1:176405753-176405775 CATTACCACCCCAGGCCATGAGG + Intergenic
919911067 1:202111011-202111033 CCCTGAAACCCCAGGCTAGAGGG - Intergenic
922007420 1:221545918-221545940 CATTACCACCCCAGGCTTAAAGG - Intergenic
922045863 1:221945861-221945883 CAGTGCCACCCCAGGCCACAAGG + Intergenic
922316122 1:224443845-224443867 CACTGAATCCCTAGGCTATAGGG - Intronic
922904898 1:229166684-229166706 CATTGACCCCACAGGCTAGAGGG - Intergenic
924444551 1:244117000-244117022 CATTCCCTCCACAGGCTATAGGG - Intergenic
1076091098 10:127686336-127686358 CATTGTTAGGCCAGGCTATAGGG + Intergenic
1077970310 11:7182099-7182121 CATTGCCATCCCAGGCCACAAGG - Intergenic
1079625960 11:22618060-22618082 CACTGCCACCCCAGGCCATGAGG + Intergenic
1080608514 11:33884637-33884659 CAAGGTCACCCCAGGCTACAGGG + Intronic
1081030568 11:38076499-38076521 CATTAACAACCCAGGCTACCTGG + Intergenic
1081250904 11:40832094-40832116 AGTTCACCCCCCAGGCTATATGG + Intronic
1084467430 11:69334211-69334233 CATGGTCACCCCAGGGTATGGGG - Intronic
1088058473 11:105612994-105613016 CATTTACACCCCAGAATATAAGG - Intronic
1090269053 11:125373077-125373099 CATTTGCACCTCTGGCTATAGGG - Intronic
1092108775 12:5944642-5944664 CATTTACACCCCAGGCTGCAGGG - Intronic
1097579837 12:61441554-61441576 CATTGAGATCACAGGATATAAGG + Intergenic
1100360751 12:93877625-93877647 CACTGCCACTCCAGGCCATAAGG + Intronic
1105413183 13:20188629-20188651 CACTGAGACCCCAGGCTGTTAGG - Exonic
1105542586 13:21327809-21327831 CACTGACACCCCAGGCTCCTGGG - Intergenic
1115821039 14:37212445-37212467 CACTGCCACCCCAGGCCATGAGG - Intronic
1121626301 14:95387820-95387842 CATTCCCAGCCCAGGCTAGAAGG - Intergenic
1126503851 15:49380155-49380177 CACTGACACCCCAGGCCATGGGG + Intronic
1127009466 15:54606759-54606781 GTTTGACACCACAGGCTGTAGGG - Intronic
1128495557 15:68196560-68196582 CCTAGAAACCCCAGGCTCTAAGG + Intronic
1129926376 15:79368008-79368030 CACTGAGACCCCAGGCAATGGGG - Intronic
1134125805 16:11615200-11615222 CATTTACACCCCAGGGTAGATGG - Intronic
1138602265 16:58063106-58063128 CATTGTCACCCCAGGCTTAGAGG - Intergenic
1140515136 16:75535785-75535807 CTTTGACATCCCCGGCTAAAAGG - Intronic
1142262085 16:89047859-89047881 CAGTGAGACCCCAGGCTTTGTGG + Intergenic
1143096639 17:4481761-4481783 CATTGACACCCCAGGCTATAAGG + Intronic
1146672550 17:34751623-34751645 AAATGATGCCCCAGGCTATAGGG + Intergenic
1147445896 17:40475155-40475177 CCTTGACCCCCCAGGCTCAAGGG + Intergenic
1150002263 17:61448656-61448678 CAAAGCCACCCCAGGCTCTAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1161025831 19:2036514-2036536 CATTCACAGCCCAGGCTGGATGG - Intergenic
1162163550 19:8737400-8737422 CCTTGACATCCCAGGCTCAAGGG - Intergenic
1162171389 19:8791982-8792004 CCTTGACATCCCAGGCTCAAGGG + Intergenic
1162768467 19:12934586-12934608 CCTTGACTTCCCAGGCTCTAAGG + Intergenic
1165198095 19:34122443-34122465 CATTGACAAGCCAGGCGCTATGG + Intergenic
1165236736 19:34428144-34428166 AGTTGAAACCCCAGGCTAGAAGG + Intergenic
1166841421 19:45699402-45699424 CCTTGACCTCCCAGGCTCTAAGG - Intronic
929057859 2:37893977-37893999 CAATGACACTCCAGGCTCAATGG - Intergenic
937552143 2:123107577-123107599 CACTGCCACCCCAGGTTATGAGG + Intergenic
940599451 2:155839403-155839425 CATTGCCGCCCCAGGCAATATGG + Intergenic
941560619 2:167040297-167040319 AATGCACACCCCAGGCTAAAAGG + Intronic
943118910 2:183710007-183710029 CACTGCCACCCCTGGCCATAGGG + Intergenic
1169415055 20:5408985-5409007 CAGTGACATCCCAGTCCATATGG - Intergenic
1182060546 22:27394078-27394100 CATTGTGACCTCAGGCAATATGG - Intergenic
1182989551 22:34754047-34754069 CAAAGAAACCCCAGGCTTTAGGG - Intergenic
1183755721 22:39762327-39762349 TTTTGACACTCCAGGCTATGAGG + Intronic
1184357695 22:43993549-43993571 CATTTAAAGACCAGGCTATAAGG + Intronic
1184972810 22:48039025-48039047 CATCAACACCACAGGCTACATGG - Intergenic
951454567 3:22875817-22875839 ACTTGACACCCCAGGCCACATGG + Intergenic
959521370 3:107326354-107326376 CATTGACACCATATGCTGTAGGG - Intergenic
962688416 3:137869155-137869177 CACTGCCACCTCAGGCCATAAGG - Intergenic
964172883 3:153791358-153791380 CAATGACACTTCAGACTATAGGG + Intergenic
964318170 3:155465851-155465873 CACTGCCACCCCAGGCCATGAGG - Intronic
965016713 3:163167804-163167826 CACTGCCACCCCAGGCCAAAAGG + Intergenic
970363141 4:15330364-15330386 CTTTGACACACCAGAATATATGG - Intergenic
975942734 4:79667631-79667653 CATTGACATGCCAAGCCATATGG - Intergenic
976567105 4:86563756-86563778 CATTCACATCCCAGGCCAGATGG + Intronic
979413512 4:120407147-120407169 CACTGCCACCCCAGGCCACAAGG - Intergenic
980960510 4:139470327-139470349 CATTGCCACTCCAGGCCATGAGG + Intronic
986657532 5:10030360-10030382 CATTGCCACCCCTGGCAACAAGG + Intergenic
991205295 5:64042642-64042664 CATTGCCACCGCAGGCCATGAGG - Intergenic
994428695 5:99628034-99628056 CACTGCCACCCCAGGCCACAAGG + Intergenic
997084439 5:130781426-130781448 CATTGAAACACAAGGCTATCAGG + Intergenic
1003409424 6:5850007-5850029 CACTGACACCCCAGGCTCCTGGG + Intergenic
1008312212 6:49990083-49990105 CATTGCCAACCCAGGCCATAAGG - Intergenic
1009245494 6:61231958-61231980 CATTGCCACCTCTGGTTATAAGG - Intergenic
1009887314 6:69639232-69639254 CATTACCACCCCAGGCAAGAAGG - Intergenic
1016643769 6:146380418-146380440 CACTGCCACCCCAGGCCATAAGG + Intronic
1028339083 7:89695400-89695422 CACTGCCACCCCAGGCCATGAGG - Intergenic
1031058433 7:117020803-117020825 CATTGACATCCCTGGCCTTAAGG - Intronic
1033233858 7:139622966-139622988 CATTAAAGCCCCAGGCTTTATGG + Intronic
1038871845 8:31503787-31503809 CACTGCCACCCCAGGCCATAAGG + Intergenic
1040442273 8:47456158-47456180 CCATTACACCTCAGGCTATATGG + Intronic
1040958827 8:53008979-53009001 CATTGACATGCCAGGCCATATGG + Intergenic
1042356209 8:67830800-67830822 CACTGACACTCCAGGCTTCAAGG + Intergenic
1042457279 8:69019758-69019780 CATTGACACCTCACGCTGCAGGG + Intergenic
1059127833 9:111710651-111710673 ACTTCCCACCCCAGGCTATAAGG - Intronic
1060956133 9:127641548-127641570 CTTTGCCTCCCCAGGCTACAAGG + Intronic
1185876248 X:3704581-3704603 CATTGACGTCCCAGGCTCAAGGG - Intronic
1186745425 X:12563128-12563150 CATTGACAGCCCATGCTCCAAGG - Intronic
1190748560 X:53341514-53341536 CTCTGACACCCCAGGCTATATGG + Intergenic
1193691914 X:84656635-84656657 CATAGCCACCCCTGGCTATGAGG + Intergenic
1194274765 X:91865775-91865797 CACTGCCACCCCAGGCCACAAGG + Intronic
1194495541 X:94613068-94613090 CACTGTCACCCCAGGCCATAAGG + Intergenic
1196101263 X:111849574-111849596 CATTGAACCCCCAGGCTCTAAGG - Intronic
1196877691 X:120169944-120169966 CACTGACACCCCTGGCCACAAGG + Intergenic
1196922175 X:120595429-120595451 CATTGCCACCCCAGGCCACAAGG - Intronic
1199439602 X:147853882-147853904 CACTGCCACCCCAGGCCATGAGG + Intergenic
1200789340 Y:7285836-7285858 CATTGACGTCCCAGGCTCAAGGG + Intergenic