ID: 1143097294

View in Genome Browser
Species Human (GRCh38)
Location 17:4485105-4485127
Sequence CAGCTGGACCAGAGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143097289_1143097294 14 Left 1143097289 17:4485068-4485090 CCGAAACGTAAGTCCTAAATGAC 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG 0: 1
1: 0
2: 0
3: 44
4: 380
1143097290_1143097294 1 Left 1143097290 17:4485081-4485103 CCTAAATGACAAATATAGATGCT 0: 1
1: 0
2: 1
3: 28
4: 296
Right 1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG 0: 1
1: 0
2: 0
3: 44
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143097294 Original CRISPR CAGCTGGACCAGAGAGTGGA AGG Intronic
900721300 1:4177519-4177541 GAGCTGGGCCTGAGAATGGAGGG - Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901508426 1:9701218-9701240 CAGCTGGAGCAGGGGGTGGTGGG - Intronic
901750613 1:11405094-11405116 AATCAGGACCAGAGAGTGAACGG - Intergenic
903482038 1:23660845-23660867 CAGCTGGAGCTGAGAGTCCAGGG - Intergenic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
903846432 1:26282196-26282218 CAGCTGGGCCAGGGAGGGGGCGG - Intronic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
904615676 1:31748287-31748309 GAGCTGGGCCAGAGAGGGGAAGG + Intronic
904983043 1:34522825-34522847 CATCTGGAACAGAGAGGGAAGGG - Intergenic
905051876 1:35058700-35058722 CACCTGGACAAGGGAGCGGAAGG - Intergenic
906506552 1:46383895-46383917 CGGCTGGACAAGGGAGGGGAAGG + Intergenic
906507874 1:46393641-46393663 CACCTGGACAAGGGAGGGGAAGG + Intergenic
906699705 1:47849039-47849061 CAGCTGTACCAGAGACTGAAAGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
910864107 1:91771934-91771956 CAGCTGGGCCAGAGGGTGAATGG + Intronic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
912989712 1:114473351-114473373 CACCTGGACAAGGGAGGGGAAGG + Intronic
914918446 1:151832117-151832139 CAGATTGATCAGTGAGTGGAGGG + Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915515346 1:156409456-156409478 CAGCTGGACCAGACCATGAACGG + Intronic
917542514 1:175928287-175928309 CAGCTGGACCAGGGAGAATAGGG - Intergenic
918047096 1:180948114-180948136 CAGCAGGACCAGGGAGTGCCTGG - Exonic
919944106 1:202307380-202307402 CAGCTTGACCAGGGAGTGCAGGG - Exonic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
922165535 1:223112816-223112838 CAGCTGTTCCAGAAAGGGGAAGG + Exonic
923497308 1:234536834-234536856 AAGCTGGCCCGGGGAGTGGATGG + Intergenic
1062820001 10:527840-527862 CAGCTGGCCCAGGGACGGGAAGG - Intronic
1062842525 10:681991-682013 CAGTTGGAACTTAGAGTGGAAGG - Intronic
1063326255 10:5106078-5106100 CACCTGGACCACAAAGTTGATGG - Intronic
1064213884 10:13383570-13383592 CAGGAGGACCTGAGAGTGGCCGG + Intergenic
1064573770 10:16723740-16723762 AAGATGGACTAGAGGGTGGAGGG + Intronic
1065653908 10:27926111-27926133 CAGCTGTGGCAGAGAATGGATGG - Intronic
1066760197 10:38741881-38741903 GCGCTGGACCAGAGAATGGTGGG - Intergenic
1067224904 10:44369283-44369305 CAGAGGGAGCAGAGAGTGAATGG + Intergenic
1068039120 10:51800631-51800653 CATCTGTACCATAGACTGGATGG + Intronic
1068242174 10:54317294-54317316 CAGCTTGATAAGTGAGTGGACGG + Exonic
1068315965 10:55342878-55342900 CAGAAGGACCTGAGAGTGTAAGG + Intronic
1070195296 10:74151214-74151236 GGGCGGGACCAGAGAGTGGATGG + Exonic
1070656095 10:78272470-78272492 CAGCTGGAAGAGAGCATGGAGGG + Intergenic
1070746246 10:78935749-78935771 CTGATGGACCAGAGAGGGGTGGG + Intergenic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1073017813 10:100415854-100415876 GAGCTGGGGCAGAGAGTGAAGGG - Intergenic
1074203282 10:111258602-111258624 CAGCGGGGCCAGACTGTGGAGGG - Intergenic
1074219284 10:111420558-111420580 TAGCTGGAGCAGATAATGGAAGG + Intergenic
1074912665 10:117925601-117925623 CTGGTGGCCCAGAGAGTGGGAGG - Intergenic
1075539627 10:123301233-123301255 CAGCTGGACCAGAAAGGGGCGGG - Intergenic
1075946439 10:126437308-126437330 CAGCTGGTTCAGGGACTGGAAGG - Intronic
1076160129 10:128237343-128237365 AAGCTGGATCTGGGAGTGGAGGG - Intergenic
1076495870 10:130897594-130897616 CAGGTGGAACAGAGAGCTGAAGG - Intergenic
1076788866 10:132765901-132765923 CAGATGCACCAGAGACTGGGAGG - Intronic
1077279248 11:1734639-1734661 CAGCTGTGCCAGACAGTGAATGG - Exonic
1077888197 11:6401543-6401565 CAACTAGTCCAGGGAGTGGAGGG + Intronic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078644597 11:13128870-13128892 TAGCTGGACCAGAGGCTGTATGG - Intergenic
1079860979 11:25670451-25670473 CAGCTAGACAAAAGAGTAGAGGG + Intergenic
1079874711 11:25842401-25842423 CAGCTGTGACAGAGACTGGATGG - Intergenic
1081565436 11:44258104-44258126 AAGCTGGAGTTGAGAGTGGAGGG + Intergenic
1081632986 11:44701922-44701944 CAGAAGGAACAGAGAATGGAAGG - Intergenic
1082116761 11:48337447-48337469 CAGCTGGAACAGATGGTGGCTGG - Intergenic
1082257036 11:50042863-50042885 CAGCTGGAACAGATGGTGGCTGG + Intergenic
1083172288 11:60930194-60930216 TAGCTGAAGCAGAGAGTGCATGG + Intronic
1083430463 11:62611553-62611575 CCGCTGGCTCAGAGACTGGAGGG + Exonic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083621987 11:64053728-64053750 CAGCAGTCCCAGAGAGCGGAAGG - Intronic
1083765621 11:64840134-64840156 CAGCTGGTGCAGCGAGTGGATGG + Exonic
1084613022 11:70216050-70216072 CAGCTGGATCAGAGAGATGAAGG + Intergenic
1085196680 11:74676874-74676896 GAGCTGGAGCAGAGAGGAGACGG - Intergenic
1085408583 11:76278379-76278401 CAGCTGGGACAGAGAGGTGAAGG - Intergenic
1087063972 11:94010225-94010247 GAGCTTGAGGAGAGAGTGGAGGG + Intergenic
1087640542 11:100750507-100750529 CACCTGGACAAGGGAGGGGAAGG + Intronic
1088074280 11:105827063-105827085 CACCTGGAACAGTGAGTGGTAGG - Intronic
1089135697 11:116247293-116247315 CAGCTGAACCAGAGTCTCGATGG - Intergenic
1089345640 11:117789764-117789786 CATCAGGACCAGTGAGTAGAAGG + Intronic
1089607019 11:119647404-119647426 CAGCTGGGCCTGAGCTTGGAGGG - Intronic
1089625449 11:119748210-119748232 CAGCTGGACCACAAAATGGGAGG - Intergenic
1089951938 11:122536109-122536131 CTGCTGGTCCACAGAGTGCAAGG + Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1091195148 11:133724448-133724470 CAGCTGGGTCAGAGAGGGAAAGG - Intergenic
1091671261 12:2453781-2453803 TAGCTGGAACAGAGACTGCATGG - Intronic
1092260778 12:6952285-6952307 CAGCTGGTGCAGGGAGGGGAGGG - Intronic
1092847312 12:12595836-12595858 CATCTGGACAAGGGAGGGGAAGG + Intergenic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1097320486 12:58220473-58220495 CAGCTGGAGCTTAGAGAGGAGGG - Intergenic
1097360916 12:58656723-58656745 CAACTGCACCTGAGAGTGCAGGG + Intronic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1100487593 12:95045277-95045299 CAGCTGGGTCAGAATGTGGAGGG + Intronic
1100791595 12:98136262-98136284 CAACTGGAACCAAGAGTGGATGG + Intergenic
1101565191 12:105898281-105898303 CAGTTGGACAAGGGAGGGGAAGG + Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102042478 12:109809491-109809513 CAGATGGAGGAGTGAGTGGATGG - Intronic
1102175422 12:110870581-110870603 CAGATGGAGCAGAGGATGGAGGG - Intronic
1103651668 12:122437705-122437727 CAGCTGTGCCAGCGATTGGAGGG + Intergenic
1103686043 12:122732695-122732717 CAGCTGGAGCTTAGAGTAGATGG + Intergenic
1104695079 12:130857304-130857326 CACCTGGACAAGGGAGGGGAAGG - Intergenic
1105305975 13:19169519-19169541 CAGATGCCCCAGAGAGTGGCAGG - Intergenic
1105402069 13:20104935-20104957 CAGCCTGCCCAGAGAGTGCAGGG + Intergenic
1106222118 13:27754931-27754953 CACCTGGACAAGGGAGGGGAAGG - Intergenic
1106674615 13:31945273-31945295 CAGCTGGAGCACAGGATGGAAGG + Intergenic
1107868553 13:44726946-44726968 CAGCTGGTGCAGCGAGTGCAGGG - Intergenic
1107933951 13:45329239-45329261 CAACTGCACCAGTGTGTGGATGG + Intergenic
1110898875 13:80794890-80794912 TAGCTGTACCAGAGACTGGGAGG + Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1114171289 14:20274470-20274492 GAGCAGGAACAGAGAGTGGTGGG + Intronic
1114889175 14:26895279-26895301 TACTTGGACCAGAAAGTGGAAGG + Intergenic
1115541551 14:34425867-34425889 CACCTGAACAAGAGAGGGGAAGG - Intronic
1117830066 14:59741300-59741322 CAGCTTGAGCAGAGACTGAATGG - Intronic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1118900201 14:69980037-69980059 CAGCTGGACCAGTGAGAGCCTGG - Intronic
1119442570 14:74638104-74638126 AGGCTGGGCCAGAGAGTGGGTGG + Intergenic
1119526054 14:75323384-75323406 CAGCTGGAGCAGGGAGGGGTGGG - Intergenic
1121438266 14:93932910-93932932 AAACTGGCCCAGAGAGGGGAAGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122414636 14:101543012-101543034 GAGGTGGACCAGAGAGGGCAGGG - Intergenic
1122449840 14:101796817-101796839 GCGCTGGACCAGACAGAGGACGG - Intronic
1122764270 14:104054715-104054737 CGGCTGGCACAGAGTGTGGAGGG + Intergenic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124605071 15:31163491-31163513 GAAGTGGACCAGAGAGTGGTGGG - Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1126368423 15:47920293-47920315 AAGGTGGACAAGAGAGTGGAAGG - Intergenic
1126821614 15:52509999-52510021 CAGCTGGAGCTGAAAGTAGAAGG - Intronic
1127029745 15:54848876-54848898 GAGCTGGATGAGAGAGTGGAAGG + Intergenic
1127267111 15:57371336-57371358 CAGCAGGCCCAGAGTGTGGATGG + Intergenic
1127360546 15:58241217-58241239 CAGCTGGGCCTGACAGTGGCAGG + Intronic
1127827755 15:62719788-62719810 CAGCTGGTCCAGGGAGTGAGGGG + Exonic
1128292639 15:66489858-66489880 CAGCTGGACCACAGTGGGCAGGG - Intronic
1128537314 15:68500911-68500933 CATCTGGGCCAGAGAGGAGAGGG + Intergenic
1128591979 15:68906223-68906245 AAGCAGGCCCAGGGAGTGGAGGG - Intronic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1129152768 15:73699496-73699518 CTCCTGGACCAGAGTGGGGAAGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129880026 15:79000204-79000226 CTGCTGGACCTGAGAGGTGAAGG - Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1131084678 15:89566423-89566445 CAGCTTCTCCGGAGAGTGGAAGG - Intergenic
1133185864 16:4098032-4098054 AAGCTGGAAAAGAGAGTGGCTGG + Intronic
1133562897 16:6966200-6966222 AAGCTGGGACAGAGAGGGGAAGG - Intronic
1133877810 16:9751375-9751397 TAGCTAGATGAGAGAGTGGATGG - Intergenic
1134690606 16:16188828-16188850 CACCTGGACGAGGGAGTGGATGG + Exonic
1136133989 16:28242942-28242964 CACCTGAACCAGGGAGTCGAAGG + Intergenic
1138296623 16:55891247-55891269 CACCTGGACAAGGGAGGGGAAGG - Intronic
1138597203 16:58035356-58035378 CACCAGGACCCCAGAGTGGAGGG - Intronic
1138943889 16:61823808-61823830 CAGCTGGAGCAGAGAGTGCCAGG - Intronic
1139377475 16:66509171-66509193 CATCTGGATTAAAGAGTGGATGG + Exonic
1140114863 16:72033126-72033148 CCACTAGACCACAGAGTGGAGGG + Intergenic
1140282633 16:73568591-73568613 CAGTTGGACAAGAAAGGGGAAGG + Intergenic
1140647575 16:77049795-77049817 CAGCTGGACAAAAAAATGGAAGG - Intergenic
1140890495 16:79280715-79280737 GGGCTGGACAAGACAGTGGATGG - Intergenic
1141297788 16:82785896-82785918 CATTTGGACAAGAGAGGGGAAGG + Intronic
1141597338 16:85105358-85105380 CAGCTGGAGGAGACTGTGGATGG - Exonic
1142711651 17:1726894-1726916 TAGCTGGACCAGAGACAGGCCGG + Exonic
1143048807 17:4105103-4105125 TGGCTTGACCAGAGAGTTGAGGG + Intronic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1143423119 17:6811745-6811767 AAGCTGAAACAGAGAGGGGAAGG - Intronic
1143795786 17:9335231-9335253 CAGCTGAACAAGAGAGGGGAAGG - Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144304701 17:13957732-13957754 CAACAGGCCCAGAGAGGGGATGG - Intergenic
1146305266 17:31725549-31725571 CACCAGGACCAGAGAGGAGAAGG + Intergenic
1147353713 17:39873825-39873847 GAACTAGACCAGAGAGTGAAGGG - Intronic
1148228608 17:45916917-45916939 CAGGTGGCCCAGACACTGGAGGG - Intronic
1149067633 17:52499141-52499163 CAGCTGGAGAAGAGAATCGAGGG - Intergenic
1149612639 17:57968717-57968739 CTGCTGGACCAGTCATTGGAAGG + Intergenic
1150222800 17:63506745-63506767 CAGTTGGACCAGGAGGTGGATGG + Intronic
1151179163 17:72313247-72313269 CAGGTGGATCAGAGAGTTGCTGG - Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151359040 17:73577477-73577499 CAGCTGGTGTGGAGAGTGGAGGG + Intronic
1151499259 17:74478420-74478442 CAGCTGGACTAGAGATTGCCTGG - Intronic
1152104282 17:78319562-78319584 CAGCTGGAGCAGAGAAGGGAAGG - Intergenic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1154015170 18:10609583-10609605 CAGCTGACCCAGTGGGTGGAGGG - Intergenic
1154157735 18:11957041-11957063 CACCTGGACAAGGGAGGGGAAGG - Intergenic
1154190350 18:12226061-12226083 CAGCTGACCCAGTGGGTGGAGGG + Intergenic
1155212341 18:23612844-23612866 TAGCTGGACCACGGAGAGGAGGG + Intronic
1155245390 18:23904077-23904099 CAGCTGGAAGAGTGAGTGCATGG + Exonic
1157294927 18:46435539-46435561 CATCTGGCCCAGAGGGTGGCTGG - Intronic
1157297246 18:46455273-46455295 CTGCTGGGCCTGAAAGTGGAGGG + Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1159557065 18:69956625-69956647 CAGCAGGACAAGAGAGTTGCCGG - Intronic
1159954946 18:74512675-74512697 CAGAGGGACAAGTGAGTGGAAGG - Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161857106 19:6772396-6772418 GGGCTGGACCAGACAGAGGAGGG + Intergenic
1161885153 19:6988835-6988857 GACCTGGAACAGAGAGAGGAGGG + Intergenic
1162507113 19:11092261-11092283 CAGTTGGGACAGAGTGTGGAAGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163702398 19:18792578-18792600 CAGCTGGAGCACAGTTTGGAAGG - Intergenic
1163730078 19:18943877-18943899 CAGCTGCAGCAAAGAGTGGCAGG - Intergenic
1163800170 19:19359848-19359870 CACTTGCACCAGGGAGTGGAGGG + Intergenic
1164813640 19:31177482-31177504 AAGATGGAACAGAGAGTGGAGGG - Intergenic
1165013373 19:32864336-32864358 CACCTGGAACACAGAGAGGAAGG + Exonic
1165060271 19:33201724-33201746 CAGATGGACCAGCGTGGGGAAGG + Intronic
1165452261 19:35890422-35890444 CAGCTGAACCAGAGTGGGGTTGG + Exonic
1166461681 19:42993381-42993403 GACGTGGACCAGTGAGTGGAAGG + Intronic
1167256961 19:48436377-48436399 CAGCTGATCCATAGAGTGTAGGG + Intronic
1167260318 19:48454425-48454447 CAGATGGATCAGAGGCTGGATGG - Exonic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925414613 2:3660613-3660635 CACCTGGACAAGGGAGGGGACGG + Intronic
926298984 2:11588908-11588930 CAGCTGGACCAGGTAGTAGACGG - Exonic
926496246 2:13592433-13592455 CAGCTGGGCTAGAGAGTCCAAGG + Intergenic
929213136 2:39381810-39381832 GAGCTGGAACAAAGCGTGGATGG - Intronic
929507775 2:42541850-42541872 CATCTGGACAAGAGACTGAAGGG - Intronic
929799198 2:45085021-45085043 CAGCTGGGCCAGTATGTGGAAGG + Intergenic
930923348 2:56784691-56784713 CAACTGGACCACAGAGGAGAAGG - Intergenic
931171734 2:59810522-59810544 TAGCTGCAACAGAGATTGGATGG + Intergenic
931191301 2:60002922-60002944 TAGCTGCAACAGAGAATGGATGG + Intergenic
931767824 2:65472544-65472566 CAGTTGGACTTTAGAGTGGAGGG + Intergenic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932668830 2:73719346-73719368 CAGGTGGACCTGATGGTGGATGG + Intergenic
935211111 2:100939987-100940009 CACCTGCACCAGGGAGTTGAGGG - Intronic
936852084 2:116912494-116912516 CAGATGGAAGAGAAAGTGGAAGG + Intergenic
936891043 2:117370643-117370665 CAGCTGGTCCATAGAGTGCAGGG + Intergenic
936946475 2:117935517-117935539 CAGATGGAACAGATTGTGGAAGG - Exonic
937126534 2:119478387-119478409 CAGCAGGGCCTGACAGTGGAAGG + Intronic
937204423 2:120226328-120226350 CACCTGGGCTGGAGAGTGGAGGG - Intergenic
937784648 2:125881918-125881940 GAGGTAGACCACAGAGTGGAGGG - Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
943309459 2:186308602-186308624 CAGCAGGCCCACAGGGTGGAAGG + Intergenic
943864705 2:192915129-192915151 CACCTGGACAAGGGAGGGGAAGG + Intergenic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
945532767 2:210976749-210976771 CAGCTGGAACAATGAGTGAAGGG + Intergenic
946148329 2:217747579-217747601 CACCTGCATCAGAGAGTGGCTGG - Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
947498030 2:230653023-230653045 CACCTGGACAAGGGAGGGGAAGG - Intergenic
948220779 2:236268011-236268033 CAGCTGACCCAGAGTGGGGAGGG - Intergenic
948649290 2:239430037-239430059 TTGCTGGACCAGTGAGTGGGTGG + Intergenic
949015127 2:241704703-241704725 GAGCTGGACCAGAGGACGGAAGG + Exonic
1170393712 20:15903415-15903437 CAGCAGCAACAGAGAGTGAAGGG + Intronic
1170570599 20:17630063-17630085 CACATGGACCAGAGACTGCACGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1171435132 20:25116359-25116381 AAGCTGGATAGGAGAGTGGAAGG - Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172627811 20:36358267-36358289 CAGCTGGAGGAGTGAGAGGAGGG - Intronic
1172977987 20:38920606-38920628 TGGCTGGACCAGAAAGTAGAGGG + Exonic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1173686085 20:44924330-44924352 CTGCTGGGCGAGAGGGTGGAGGG - Intronic
1173788846 20:45814460-45814482 CAGCTGGAACAGTAAGTGTAGGG + Exonic
1173869451 20:46332386-46332408 CAGTTGGGCCAGTGAGGGGAAGG - Intergenic
1174400818 20:50274950-50274972 CAGTTGGGCCAGGGAGGGGAAGG + Intergenic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1175071531 20:56337982-56338004 CAGGTGTACCTGAGAGTGGTGGG + Intergenic
1175189477 20:57201552-57201574 CAGCTGGAGAAGAAAGTGGGAGG + Intronic
1175286494 20:57840288-57840310 GAGCTGGACCTGAGAGCGGACGG + Intergenic
1176134881 20:63518148-63518170 CAGCTGGACGAGGGCGGGGACGG - Intergenic
1176136380 20:63523860-63523882 CACCTGGACAAGGGAGGGGAAGG + Intergenic
1176286868 21:5023030-5023052 CAGCAGTGCCAGGGAGTGGAAGG - Intronic
1177926742 21:27226362-27226384 CAGCTGGGCAAGAGAGCAGAGGG - Intergenic
1178589917 21:33900943-33900965 CACACAGACCAGAGAGTGGATGG + Intronic
1178886523 21:36489362-36489384 CAGCTGGAACTGAGAAGGGAGGG - Intronic
1179675909 21:42981999-42982021 CAGATGGAACAGACAGTGGAGGG - Intronic
1179870313 21:44240445-44240467 CAGCAGTGCCAGGGAGTGGAAGG + Intronic
1180010770 21:45049852-45049874 CAGCTGCAGCAGAGCCTGGATGG - Intergenic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1180215212 21:46319136-46319158 AAGCTGGACCAGTGAGTGATTGG + Intronic
1180560115 22:16609162-16609184 GAGCCGGACCGGATAGTGGAGGG - Intergenic
1181114081 22:20620497-20620519 CAGATGCCCCAGAGGGTGGAGGG - Intergenic
1182067327 22:27439828-27439850 CTGCAGCCCCAGAGAGTGGATGG + Intergenic
1182522196 22:30891005-30891027 CAGCTTGGCCAGAGTGTGGGTGG - Intronic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183525207 22:38318552-38318574 AAACTGGCCCAGAGAGGGGAAGG + Intronic
1183705123 22:39471204-39471226 CATCTGGACAAGAGAAGGGAAGG - Intronic
1183951584 22:41355754-41355776 CAGCTGGACCAAGGAGCGGCGGG + Exonic
1184387049 22:44182264-44182286 CATCAGGACCAGAGAGGGCAGGG + Intronic
1184488403 22:44795474-44795496 CAGCTGGCCCAGAGGGTAGAGGG - Intronic
1184839391 22:47043668-47043690 CAGCTGAACAGGAGGGTGGAAGG + Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
949682281 3:6527954-6527976 CAGCTAGACCTGACTGTGGATGG + Intergenic
950709414 3:14804120-14804142 CATCTGGACCACACAGTGCAAGG - Intergenic
950855554 3:16101444-16101466 CACCTGGACAAGGGAGGGGAAGG + Intergenic
951651590 3:24956883-24956905 AAGCTGGACCAGAGAGAAGGAGG + Intergenic
951918974 3:27832571-27832593 CAGCTGGATGGGAGAGTGGTGGG + Intergenic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
953887486 3:46723729-46723751 CAGGAGCACCAGAGAGTGGGGGG + Intronic
954197103 3:49003392-49003414 AATCTGGGCCAAAGAGTGGAAGG + Intronic
954480978 3:50801178-50801200 CACCTGGACAAGGGAGGGGAAGG + Intronic
955518624 3:59752731-59752753 CAGGAGGAAGAGAGAGTGGAGGG - Intronic
956268276 3:67422916-67422938 CTTCTGGACCTGAGAATGGAAGG + Intronic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
958180852 3:90059030-90059052 AAGCAGGATGAGAGAGTGGAAGG + Intergenic
960457580 3:117891871-117891893 CAGCTGGACCAGACATGGTAAGG + Intergenic
961468002 3:127093001-127093023 CAGCTGCACCAGCCAGTGGGAGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961581999 3:127890959-127890981 CACCTGGACAAGGGAGGGGAAGG - Intergenic
962024203 3:131529718-131529740 CAGCTGGGCAAGAAAGTAGAGGG - Intergenic
962310652 3:134324589-134324611 CAGGTGGACCTGATAGTGGCTGG + Intergenic
962951025 3:140219059-140219081 CAAATGGACCAGGGCGTGGATGG - Intronic
962967287 3:140366646-140366668 GAGCTGGTGCAGAGAGTGGAGGG - Intronic
964659677 3:159106403-159106425 AAGCTAGAGAAGAGAGTGGAGGG + Intronic
967639700 3:191847111-191847133 AAGCTGGGCCAGACTGTGGAGGG - Intergenic
968226564 3:196976059-196976081 CAGCTGGGCCAGAGAAAAGAAGG - Intergenic
968490681 4:889125-889147 CAGCAGGAGCAGGGAGTGGGTGG + Intronic
968665813 4:1821850-1821872 CAGCTTGCCCAGACAGTGAAGGG - Intronic
969596238 4:8150831-8150853 CAGCAGGACCAGAGAAGGGGAGG + Intronic
970279327 4:14436700-14436722 CAGGTGGACAAGAGAATGGAAGG + Intergenic
970403804 4:15742943-15742965 CAGCTGCAGCAGAGATGGGATGG + Intergenic
973100007 4:46254839-46254861 CAGCAGGAAGTGAGAGTGGATGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974644288 4:64672021-64672043 CAGCTGCACCTGAGAGGGCAGGG + Intergenic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
977247238 4:94647191-94647213 CAGCTAAAAGAGAGAGTGGAAGG + Intronic
978963375 4:114711518-114711540 CAGCTGTGCCTAAGAGTGGAAGG - Intergenic
979712974 4:123802666-123802688 CAGCTGTACCATAGAGAGCAAGG - Intergenic
980744873 4:137000678-137000700 CAGCTGTACCTGAGAGGGCAGGG - Intergenic
981476908 4:145196462-145196484 CAGGTGGACAAGGGAGGGGAAGG + Intergenic
981907209 4:149935060-149935082 CATCTGAACCTGAGAGCGGAAGG - Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984361131 4:178733855-178733877 CAGCTGGACCTCGGAGGGGAAGG - Intergenic
984576229 4:181451621-181451643 CAGCTGGATCAGAAAGAGAATGG + Intergenic
984624949 4:181996486-181996508 CAGCTGAAGCAGAGAGTGAAAGG + Intergenic
986204169 5:5607950-5607972 ATGCTGGACTTGAGAGTGGATGG + Intergenic
989107861 5:37880363-37880385 CAGATGGGACAGAAAGTGGATGG + Intergenic
989388599 5:40877617-40877639 CAGCTGGACAAGGGAGGGGAAGG + Intergenic
993054781 5:82969241-82969263 CACCTGGACAAGGGAGGGGAAGG + Intergenic
994622627 5:102180919-102180941 CACCTGGACAAGAGGGGGGAAGG + Intergenic
994680995 5:102887721-102887743 CAGCTGGAACAGAGAGGAAAAGG - Intronic
995407704 5:111819403-111819425 CACCTGGACAAGGGAGGGGAAGG - Intronic
995835970 5:116399846-116399868 CACCAAGACCAGAGTGTGGATGG + Intronic
997587015 5:135049220-135049242 CAGGCCCACCAGAGAGTGGAAGG - Intronic
999324358 5:150634267-150634289 GATCTGGACCAGAGAGGGGAAGG + Intronic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1002774843 6:320019-320041 TAGCAGGACCAGCCAGTGGAGGG - Intronic
1002837613 6:878402-878424 TAGCTCAACCAGAGAGGGGAAGG + Intergenic
1002992410 6:2250059-2250081 CAGTTGGACCAGAAAGCAGAAGG - Intergenic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1005080366 6:21951132-21951154 CAGCTGAAACAGAGACTGTACGG + Intergenic
1006151476 6:31992383-31992405 CAGCTGGAGCTCAGCGTGGACGG + Exonic
1006157777 6:32025121-32025143 CAGCTGGAGCTCAGCGTGGACGG + Exonic
1006191132 6:32210267-32210289 TTGCTGGAGCAGAGAGTAGAAGG + Intronic
1006959963 6:37919035-37919057 CACCTGAACCAGAGAGTCGGAGG - Intronic
1009195826 6:60683354-60683376 GAGATGGGCCAGAGAGTGAAGGG + Intergenic
1011118581 6:83924651-83924673 CAGTTGTACCAGAGTTTGGAAGG + Intronic
1011342228 6:86329186-86329208 CAGCTGGACCAGATATTACAAGG + Intergenic
1011575797 6:88797498-88797520 CAGCAGGACTAAAGAATGGAAGG + Intronic
1012205770 6:96458630-96458652 CAACTGGAAGAGAGAGTGGGTGG + Intergenic
1013604199 6:111732828-111732850 CAGCAGGACCACAGGATGGAAGG + Intronic
1013692971 6:112667545-112667567 CAGCTGCACCAGAGATGGCAGGG - Intergenic
1014110251 6:117612714-117612736 CACCTGGACAAGGGAGGGGAAGG + Intergenic
1014471494 6:121820522-121820544 CAGCTGAACAAGGGAGAGGAAGG - Intergenic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1016785865 6:148010497-148010519 CAGCTGGAGCTGGGAGTGGCTGG - Intergenic
1016986158 6:149897542-149897564 CAGCTGGGGCAGGGAGAGGACGG - Intronic
1017520338 6:155196175-155196197 GAGCTCGCCCAGAGACTGGAAGG + Intronic
1017533487 6:155321538-155321560 CAACAGGACCTCAGAGTGGAAGG - Intergenic
1018181228 6:161225363-161225385 CACTTGGACAAGAGAGGGGAAGG - Intronic
1018191118 6:161309781-161309803 CACTTGGACCAGGGAGGGGAAGG + Intergenic
1018191775 6:161315245-161315267 CACTTGGACCAGGGAGGGGAAGG + Intergenic
1018709252 6:166486006-166486028 CACCAGGACCAGCGAGTGAAGGG + Intronic
1021279691 7:18702385-18702407 CAGCACCTCCAGAGAGTGGATGG + Intronic
1022659791 7:32356111-32356133 CAGCTCAATCAGAAAGTGGATGG + Intergenic
1023306972 7:38840896-38840918 GAACTGGACTAGAGAGTGGGTGG - Intronic
1023351921 7:39328825-39328847 CAGCTGGACCAGATAGGGCATGG + Intronic
1023436073 7:40141883-40141905 CACCTGGACAAGGGAGGGGAAGG + Intronic
1023799764 7:43823745-43823767 CACCTGGACAAGGGAGGGGAAGG - Intergenic
1023981658 7:45074022-45074044 GAGCTGGAACACAGAGTGCATGG - Intronic
1024338931 7:48237641-48237663 CAGCAGGCCCAGAGAGTGACAGG - Intronic
1024857141 7:53794970-53794992 CAGCTGCACCTGGGAGTGCAGGG + Intergenic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1026073446 7:67143475-67143497 CAGCTGGAGGTCAGAGTGGAGGG - Intronic
1026406947 7:70075939-70075961 TAGCTGTACCAGAGACTGTATGG - Intronic
1026703440 7:72668703-72668725 CAGCTGGAGGTCAGAGTGGAGGG + Intronic
1027729942 7:81858788-81858810 CACTTGGACCAGGGAGGGGAAGG + Intergenic
1027995687 7:85423476-85423498 CAGCTGCACCAGGGAGTGAGGGG - Intergenic
1029121421 7:98270676-98270698 GGGCTGGGCCAGAGAGAGGATGG + Intronic
1029869758 7:103677952-103677974 TAGTTGGACCAGAGAGAGCAGGG - Intronic
1031365434 7:120895405-120895427 CCTCTGGACCAGTGATTGGAGGG - Intergenic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031561927 7:123249087-123249109 CAGGTGGACCAGTGCCTGGAGGG + Intergenic
1032540292 7:132697345-132697367 GAGCTCCACCAGGGAGTGGAGGG + Intronic
1032751526 7:134846378-134846400 CTGCCAGACCAGAGAGTGGAGGG + Intronic
1037643972 8:20773498-20773520 CAGCTGGACCTGGGCGGGGAGGG + Intergenic
1039831962 8:41222547-41222569 CAGCTAGTCCACAGAGGGGAAGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042910139 8:73817921-73817943 CAGCAGGAGATGAGAGTGGAAGG - Intronic
1044061091 8:87636569-87636591 CACCTGGACAAGGGAGGGGAAGG - Intergenic
1044589076 8:93896281-93896303 CATCTGGACCAGAGATGGCATGG - Intronic
1045509998 8:102806661-102806683 GAGCTGGGCCAGGGAGTGCAGGG + Intergenic
1046768521 8:118096515-118096537 CACTTGAACCAGGGAGTGGAAGG + Intronic
1048668557 8:136691348-136691370 CAGCTGGAGCAGAGTGTACAGGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049156288 8:141068770-141068792 CCGCTGGAAGAGAGAGTGGCAGG - Intergenic
1049280451 8:141741460-141741482 CAGCTGGAACATAGAGAGGAAGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051392665 9:16582501-16582523 CAGGTGGACGAGAGAGTGAACGG - Intronic
1053392617 9:37746510-37746532 CAGCTGGACCAGGTGCTGGAAGG - Exonic
1056641902 9:88378688-88378710 CTGCTGAACCAGGGAATGGAAGG + Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057865586 9:98677827-98677849 GTGCTGGAGCAGAGATTGGATGG - Intronic
1058800069 9:108537163-108537185 CAGCTGGAATAGAGAATGCAAGG + Intergenic
1058893741 9:109382610-109382632 CAGCTGAGCCTGAGAGGGGATGG - Intronic
1058910015 9:109512318-109512340 CAGCTGGTCCACAGATTGGAGGG + Intergenic
1059133241 9:111777149-111777171 CAGCTGATCCATAGAGTGCAGGG + Intronic
1060942293 9:127549927-127549949 CACCTGGGACAGAGAGTGGGAGG - Intronic
1060968932 9:127727054-127727076 CAGCTGGAGCAGATGGTGGAGGG + Exonic
1061205208 9:129159049-129159071 CAACTGGAACAGAGGGCGGATGG - Intergenic
1061821028 9:133227232-133227254 CATCTGGCCCAGAGAGGGAAAGG + Intergenic
1062238238 9:135522821-135522843 CATCTGGCCCAGAGAGGGAAAGG - Intronic
1062246628 9:135571711-135571733 CACCTGGACAAGGGAGGGGAAGG + Intergenic
1062312383 9:135945877-135945899 CAGCTGAACCAGTGCGTGGGGGG - Exonic
1062644939 9:137543081-137543103 GAGCTGGGCCAGGGAGCGGAAGG + Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185554850 X:1013107-1013129 CAGCGGGACGTGAGTGTGGATGG + Intergenic
1185582614 X:1222571-1222593 TAGCTGGACAAGGGAGGGGAAGG + Intergenic
1187201299 X:17135929-17135951 CAGCTGGAACAGGTATTGGAGGG + Intronic
1190633374 X:52411108-52411130 AAGGTGGGCCACAGAGTGGAGGG - Intergenic
1190992291 X:55565150-55565172 CTGCTTGACTGGAGAGTGGAGGG - Intergenic
1191889705 X:65927416-65927438 CATCTGGACAAGGGAGGGGAAGG + Intergenic
1193145963 X:78076015-78076037 CACCTGGACAAGGGAGGGGAAGG + Intronic
1193820709 X:86160927-86160949 CAGTTGGACCAGATGGTGGTAGG + Intronic
1194263968 X:91733413-91733435 CAGCTGAACCACAGAGTTGGTGG + Intergenic
1196704522 X:118705411-118705433 TAGCTGCAGCAGAGAGTGTATGG - Intergenic
1196706810 X:118724173-118724195 CTGCAGGACTAGACAGTGGATGG + Intergenic
1196708884 X:118742169-118742191 CAGCAGGACAAGGGAGAGGAAGG - Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201474193 Y:14363224-14363246 CACCTGGACAAGAGAGGGGATGG + Intergenic