ID: 1143099879

View in Genome Browser
Species Human (GRCh38)
Location 17:4499111-4499133
Sequence GAGCGGCGGCGCCGGCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 1, 2: 17, 3: 140, 4: 855}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143099866_1143099879 21 Left 1143099866 17:4499067-4499089 CCTCGGCGGCGGCGGGCGGCGCG 0: 2
1: 3
2: 11
3: 121
4: 647
Right 1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG 0: 1
1: 1
2: 17
3: 140
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143099879 Original CRISPR GAGCGGCGGCGCCGGCGCCG GGG Exonic
900105844 1:980666-980688 GAGGGCTGGCGCCGGGGCCGAGG + Exonic
900171994 1:1273798-1273820 AGGCGGCGGCGGCGGCGCTGCGG - Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900349814 1:2228939-2228961 GGGCACCGGCGCCGGCACCGCGG - Exonic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901109551 1:6784685-6784707 GGCGGGCGGCGCCGGGGCCGTGG + Intergenic
901443399 1:9292947-9292969 AGGCGCCGGCGCCGGGGCCGGGG + Exonic
901443430 1:9293044-9293066 CAGCGGCGGCGGCGGCACCCCGG + Exonic
901483174 1:9539848-9539870 GAGCGCCGGCGCCGTAGCCCGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901673039 1:10867101-10867123 GAGCGGCTGCGGGGGCGGCGGGG - Intergenic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
902951016 1:19882749-19882771 GAGCGAGGGAGGCGGCGCCGGGG + Intronic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903724550 1:25431053-25431075 GAGAGACGGCGGCGGCGGCGCGG + Exonic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903828649 1:26161963-26161985 GGGCGGCGGCGGCGGCTCGGAGG + Exonic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
903950600 1:26993991-26994013 GAGCTGCAGCGCTGGCGCCAGGG + Exonic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904528809 1:31155026-31155048 GAGGGGCGGAGCCCGGGCCGGGG + Intergenic
905107681 1:35573991-35574013 GAGCGGGGGCGCCGGCCCGTAGG - Exonic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905580772 1:39081631-39081653 GAGCTGGGGCGCGGCCGCCGGGG - Intronic
905819808 1:40980291-40980313 GGGCGGCTGAGCCCGCGCCGAGG - Intronic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906960989 1:50419382-50419404 GTGAGGCCGCGCCGGCGCCAGGG - Exonic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278101 1:53327991-53328013 CAGCGGCAACCCCGGCGCCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
908355845 1:63324099-63324121 CAGCGGCCGCGGCGGCGCCCAGG - Exonic
908501219 1:64745225-64745247 GCGCGGCGGGGCTGGGGCCGGGG + Exonic
910676499 1:89821378-89821400 GGGCCGCGGCGCCTGCGCCAGGG - Intronic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
912337561 1:108876969-108876991 GAGCCGGGGCGCAGGCGCAGAGG + Exonic
912619519 1:111140564-111140586 GAGCGCCGGCGCGGGAGCCGGGG + Intronic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913144614 1:115976789-115976811 GACCGCCGGGGCCGGGGCCGAGG + Intronic
913250633 1:116909955-116909977 GATCGGCGGGGCCGGCTCCCGGG + Intergenic
913518263 1:119623290-119623312 GCGCGGGGGCGGCGGCGCTGCGG - Exonic
914197335 1:145454426-145454448 GGGCGGCGGGGCCGGCGGGGCGG - Intergenic
914919596 1:151838408-151838430 GAGCGGCGGCGTGGGCGGCCCGG + Exonic
914937452 1:151993542-151993564 GGGCGGCCGCGCCCGGGCCGGGG + Intronic
915165699 1:153946648-153946670 TAGCGGCGGCGCCCGCGGCCCGG - Exonic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
915503682 1:156338496-156338518 GAACGTCGGCGCAGGCGCCAAGG + Intronic
915908924 1:159900211-159900233 GAGGGGCGGGGCCGGGGGCGGGG - Intergenic
916107305 1:161441294-161441316 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916108892 1:161448712-161448734 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916110480 1:161456093-161456115 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916112065 1:161463503-161463525 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916113652 1:161470884-161470906 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916694397 1:167221320-167221342 GGGCGGCGGGGCCGGGGCAGAGG + Intronic
916773634 1:167937011-167937033 GAGCGGGGGCCCCGGGGCGGAGG + Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
917817503 1:178725501-178725523 GAATGGCGGCGGCGGCGCTGCGG + Intronic
919678516 1:200410101-200410123 AAGCTGCGGCGCAGGCGCCCTGG - Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919929939 1:202214495-202214517 AAGCGGCGGCCCCGGGGGCGGGG - Intronic
920171530 1:204074934-204074956 CAGCGCCAGCGCCAGCGCCGAGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
920511787 1:206557240-206557262 GAGGGAGGGCGCTGGCGCCGGGG + Intronic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
920528505 1:206685321-206685343 CGGCGGCGGCGGCTGCGCCGGGG - Exonic
921010192 1:211133731-211133753 GAGCCGCGGCGCGGGCACCCAGG - Intronic
921217705 1:212951363-212951385 GAGCGGCGGCGGGAGCTCCGCGG - Exonic
922730728 1:227947738-227947760 GGGCGGGGGCGGCGGGGCCGGGG - Intronic
922817111 1:228457670-228457692 GCGCGTGGGCGCCGGCGCCCCGG - Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
924706586 1:246507323-246507345 GAGGGGCGGGGCGGGCGCGGTGG + Intergenic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
924816701 1:247448215-247448237 CGGCGGCGGCGACGGCGGCGAGG + Intronic
1062759938 10:10736-10758 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1062759945 10:10765-10787 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1063165122 10:3454647-3454669 GAGCGACCGCGCCGGCACAGTGG + Intergenic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209034 10:13347975-13347997 AAGCGGCGGGCCCGGCGCGGGGG - Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064231050 10:13529226-13529248 GGGCGGCGGCGTCGTCCCCGGGG - Intergenic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065022240 10:21510046-21510068 GAGCGGCAGGGCCAGCGCCGCGG - Intergenic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1065140529 10:22714650-22714672 GGGAGGCGGCTGCGGCGCCGCGG + Intergenic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066220672 10:33334804-33334826 GAGCCGCGGAGCTGGCGCCCAGG + Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464238 10:35639521-35639543 GGGCGGGGGCGCGGGCGCCACGG - Exonic
1067110625 10:43397160-43397182 GAGCCGCCGCGCGGGCGCCCCGG - Intronic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1070954260 10:80454219-80454241 GAGGGGCGGGGCCGGAGGCGCGG - Exonic
1071526654 10:86363325-86363347 GGGCGGAGGCGCCGCCGCCTGGG - Intronic
1071532560 10:86400944-86400966 GGAAGGCGGCGCCGACGCCGCGG + Intergenic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072454105 10:95561261-95561283 GCTCGGCGGCGGCAGCGCCGGGG - Intronic
1073363556 10:102918850-102918872 GAGCGGCGGCGCCACAGCCCGGG + Exonic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1075031830 10:119029401-119029423 GAGCGGCGCCCGAGGCGCCGGGG + Intergenic
1075501723 10:122980705-122980727 GAGGGGCGGGGCCTGGGCCGCGG + Intronic
1075587156 10:123666311-123666333 GCCGGGCGGCGGCGGCGCCGAGG + Intergenic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1076306136 10:129467000-129467022 GTGCGGCGGCGCCGGGCCTGAGG - Intergenic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076546186 10:131246914-131246936 GTGCCGCAGCGCCGGCGTCGTGG - Intronic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1076890704 10:133281834-133281856 GCCCTGCGGCGCCGGCTCCGGGG - Intronic
1076905020 10:133357299-133357321 GACGGGCGGCGCCGACCCCGAGG - Intronic
1077008068 11:368564-368586 GAGTGGTGGGGCCGGCTCCGCGG - Intergenic
1077253786 11:1571876-1571898 GAGCGGAGGCGCCGGCGGGGCGG - Intronic
1077492759 11:2869786-2869808 CAGCGGCGGGGCCGGCTCTGCGG + Intergenic
1078057551 11:8019694-8019716 GAGGGGCGGGGCAGGGGCCGGGG + Intronic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078210289 11:9265045-9265067 GAGTGGCGGCGGCGGCGGAGGGG - Exonic
1078246098 11:9574144-9574166 GAGCGGCGGCGCTCGGGCCCGGG - Exonic
1078334088 11:10450603-10450625 GGGCTGCGGCGCGGGCCCCGCGG + Intronic
1078631732 11:13009712-13009734 CAGCGGCGGAGCCGGCGGCTGGG + Intergenic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1080801956 11:35618191-35618213 GACTGGCTGCGCCCGCGCCGGGG - Intergenic
1080836293 11:35944029-35944051 GAGGGGCGGGGTCAGCGCCGAGG + Intronic
1081870728 11:46381555-46381577 GAGCGGGGGCGGGGACGCCGGGG + Intronic
1082025111 11:47565821-47565843 GAGCGGCGGGGACGGGGCAGGGG - Intronic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1082807296 11:57459290-57459312 GAGCCGCGGCGCGGGCAGCGGGG + Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083289177 11:61680390-61680412 GGGCGCCGGCGCCGGCGCGAAGG - Intergenic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083658484 11:64241503-64241525 GAGCGGAGGCGCTGGGGGCGGGG + Intronic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083669330 11:64291576-64291598 TTGGGGCGGCGCCGGCGGCGAGG + Intronic
1083672035 11:64305298-64305320 GAGGGGCGGGGCCGGAGACGCGG - Intergenic
1083766461 11:64843754-64843776 GGGCTGTGGCGCCGGGGCCGGGG - Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1084180572 11:67443600-67443622 GAGCGGGGCCGCCGGGGACGGGG + Intronic
1084265678 11:68004023-68004045 GAGCGGCGGCTCCGCCTCCATGG + Exonic
1084420092 11:69056178-69056200 GAGCGGCAGGGCTGGCGCTGAGG - Intronic
1084968111 11:72754926-72754948 GATGGGCGGCGCGGGCGGCGAGG - Exonic
1085011244 11:73142710-73142732 GAGCGGAGACGCGCGCGCCGGGG - Intergenic
1085197890 11:74683369-74683391 GCGCGGCCGGGCGGGCGCCGTGG + Intergenic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1086341784 11:85854968-85854990 GAGCGCCCGCGCCGCCGCCTTGG - Intergenic
1086666569 11:89491243-89491265 GCGCGGCGGGGCCGGCGGCATGG - Exonic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087761811 11:102110659-102110681 GGGCGGGGGCGGAGGCGCCGGGG + Exonic
1087761815 11:102110665-102110687 GGGCGGAGGCGCCGGGGCGGGGG + Exonic
1088920630 11:114257848-114257870 TCGCGGCGGCGCGGGCGCTGGGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238208 11:125164816-125164838 AGGCGGCGGCGGCGGCGCGGCGG + Intronic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1091474085 12:754117-754139 CAGCGGCGGCGGCAGCGCCAAGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091558669 12:1594415-1594437 GCGCGGCGGCGCGGGCGGAGCGG - Intronic
1091740829 12:2959451-2959473 ACGCGGCGGCGCCGGAGCTGCGG - Exonic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1094375402 12:29783748-29783770 CAGCGGCGGCGGCGGCGCGATGG - Exonic
1094682683 12:32679683-32679705 CAGGGGCGGAGCCGGCGCGGCGG + Intronic
1095752372 12:45727543-45727565 GTGAGGCGGCGGCGGCGCGGCGG + Intergenic
1096482416 12:51951587-51951609 TCCCGGCGGAGCCGGCGCCGCGG - Intergenic
1096491360 12:52014889-52014911 GGGCGGCAGCGCCGGCGGCTCGG - Exonic
1096977518 12:55707943-55707965 GAGGGGCGGGGCCGGAGGCGGGG - Intronic
1097190395 12:57216790-57216812 GAGGCGCGGAGCCGGCGCTGGGG - Exonic
1097190406 12:57216829-57216851 GAGCGGCGGGAGCGGCGGCGCGG - Exonic
1097232383 12:57520651-57520673 GAGCGACGGGGGCGGTGCCGCGG - Intergenic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101606009 12:106248048-106248070 GGGAGGCGGGGTCGGCGCCGCGG - Intronic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102853952 12:116277494-116277516 AGGCGGCGGCGGCGGCTCCGGGG - Intergenic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1103120039 12:118372668-118372690 CGGCGGCGGCGCCGGGCCCGGGG - Exonic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103547521 12:121712714-121712736 GTGGGGCGGGGCGGGCGCCGGGG + Intergenic
1103563408 12:121804118-121804140 AAGGGGGGGCGCCGCCGCCGCGG - Intergenic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103828733 12:123762220-123762242 CAGCGCCGGCGCCGTCGGCGGGG + Intergenic
1104001598 12:124863896-124863918 GTCCGGCGGCGCCGGCGATGGGG - Intronic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104376284 12:128267422-128267444 CAGCGGCGCCGCCGGCCCGGGGG - Exonic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104899634 12:132181925-132181947 GAGCGGAGGTGCAGGCACCGTGG - Intergenic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1105022817 12:132828695-132828717 GAGGGGCGGCGGCGGGGCCTGGG - Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1105678079 13:22696628-22696650 GAGCGGCGGCGGGGGCCCTGGGG + Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1107468173 13:40667266-40667288 GAGCCGCGGCGCCGGGGGTGGGG - Intergenic
1107605097 13:42048824-42048846 GGCCGCCGGAGCCGGCGCCGCGG + Exonic
1107851413 13:44576560-44576582 TGGCGGCGGCGGCGGCCCCGGGG - Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108313948 13:49220352-49220374 GAACGGCAGCGACGGCCCCGAGG + Exonic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1108603198 13:52012089-52012111 GAACGGGGGCGCAGGCGCCCAGG + Intergenic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG + Intergenic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1113480408 13:110616006-110616028 GAGCGGCGGAGCCCGCGCGGTGG + Intronic
1113493996 13:110713864-110713886 AGGCGGCGGGGCTGGCGCCGGGG - Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1113861502 13:113490482-113490504 GAGCGGTGGCGTCGGAGGCGCGG - Intronic
1113954933 13:114094861-114094883 GAGCGGGGGAGCCCGCGCCTCGG - Intronic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115474569 14:33800608-33800630 GGGCGGGGGCGGCGGCGCGGGGG + Exonic
1115754638 14:36519156-36519178 AGGCGGCGGTGACGGCGCCGTGG + Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1115993136 14:39170168-39170190 CAGCGACTTCGCCGGCGCCGCGG + Exonic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1117176685 14:53153026-53153048 AGGCGGCGGCGGCGGCGCCTGGG - Exonic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117424472 14:55580407-55580429 GGGAGGCGGCGCCGGCCGCGGGG + Intronic
1117602581 14:57390672-57390694 GAGTGGCGGCAGCGGCGGCGGGG + Exonic
1117898204 14:60509113-60509135 GATTGGCGGCGCGGGCGCCATGG - Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118339102 14:64879833-64879855 TGGCGGCGGCGGCGGCGCAGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1119219364 14:72893587-72893609 CAGCGGCGGGGCGGGGGCCGCGG + Intronic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119438526 14:74612806-74612828 GAGCGAAGGCGGCGGCGCCAGGG - Intergenic
1119519700 14:75277102-75277124 GAGCGGCCGCGGCCGGGCCGGGG + Intergenic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1120993574 14:90398189-90398211 GGGAGGAGGCGGCGGCGCCGCGG + Intronic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1122081691 14:99271293-99271315 CAGCGGCGGCAGCGGCGCGGCGG - Intronic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221171 14:100239802-100239824 CAGCGGCGGGGCCGGCGCGGCGG + Exonic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1202899789 14_GL000194v1_random:28390-28412 CAGCGCCGGCGCAGGCGCGGGGG - Intergenic
1202899805 14_GL000194v1_random:28426-28448 CAGCGCCGGCGCAGGCGCAGGGG - Intergenic
1202929127 14_KI270725v1_random:23293-23315 CAGCGCCGGTGCCGGCGCGGCGG - Intergenic
1124453718 15:29822074-29822096 GAGCGGGCGGGCCAGCGCCGCGG - Exonic
1124696798 15:31870453-31870475 GGGCGGCGGGGCCGGGCCCGCGG - Intronic
1124957179 15:34367176-34367198 CAGCGGCGGCGGCGGCGCTCTGG + Exonic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125429528 15:39581179-39581201 GAGCGGTGGCGAGGGCGGCGAGG - Exonic
1125677858 15:41512073-41512095 ATGGGGCGGCGCCGGCGCCGGGG - Intronic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1125903649 15:43370988-43371010 GAGAGCCGGGGCCGGGGCCGGGG - Intronic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1126668474 15:51094868-51094890 GAGGGGAGGCGCGAGCGCCGAGG + Intronic
1126738050 15:51751614-51751636 CAGGGGCGGCGCCGTGGCCGGGG - Exonic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1128153539 15:65377850-65377872 GTCCCGCGGGGCCGGCGCCGGGG + Exonic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1128992567 15:72272805-72272827 GGGGGGTGGCGCCTGCGCCGTGG + Intronic
1129082467 15:73052632-73052654 CAGCGGCGGCGACAGCGCCGCGG - Exonic
1129189136 15:73927407-73927429 GGGCGGCGGCGTGGGCGCGGGGG + Exonic
1129742122 15:77994367-77994389 GAGCGGCGGCGGCAGAGCTGGGG - Intronic
1129823645 15:78620591-78620613 GAGGGCTGGCGCCGTCGCCGGGG - Intronic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1130040856 15:80404405-80404427 GTGTGGCGGCGGCGGCGCCTGGG + Exonic
1130152783 15:81324142-81324164 GAGCGGCGGCGCTGGATCCCGGG + Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130656422 15:85794706-85794728 GAGCGGGGGCGCGGGTGCTGCGG + Intronic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132111593 15:99105703-99105725 GCGCGGCGGGGCCGGTGGCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132383122 15:101380341-101380363 GAGCGGAGGCGCCGGGGCAGAGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132594111 16:740524-740546 GGGCGGCGGGGCCCGGGCCGGGG - Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132839488 16:1972146-1972168 GAGCGGCGGCGGCGGCAACATGG + Exonic
1132841158 16:1979104-1979126 GAGCGGCGCCCACGGCGCCAGGG - Exonic
1132889380 16:2196485-2196507 CAGAGGCGGCGGCGGCCCCGCGG + Exonic
1132947137 16:2537959-2537981 GCGGGGCGGCGCCGGGGGCGGGG + Exonic
1133020563 16:2965036-2965058 GAGGGGCGGGGCCTGCGCTGGGG + Intronic
1133156422 16:3880028-3880050 GAGCGGGCGGGCGGGCGCCGAGG + Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133634671 16:7653911-7653933 GATCGGGGGCGGGGGCGCCGCGG - Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134172080 16:11976756-11976778 AAGCGGCAGCGGCGGCGGCGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136129643 16:28211735-28211757 TGGCGGCGGCCCCGGCCCCGAGG + Exonic
1136453962 16:30370109-30370131 GGGCGGCGGCGAGGGGGCCGCGG + Exonic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1136861570 16:33707311-33707333 CAGCGCCAGCGCCGGCGCGGCGG - Intergenic
1137675540 16:50302082-50302104 GAGGGGCGGGGCCAGGGCCGGGG - Intronic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138619100 16:58197772-58197794 GGGTGGCGGCGGCGGCGCGGCGG + Exonic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139534413 16:67562686-67562708 CGGCGGCGGAGCGGGCGCCGCGG + Exonic
1140091934 16:71846010-71846032 GTGGGGCGGCTCCGGGGCCGGGG + Exonic
1141482009 16:84313084-84313106 TAGCAGCAGCGCCGGTGCCGCGG - Exonic
1141531365 16:84648801-84648823 GAGTGGGGGCGCCGCGGCCGGGG + Intronic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141831313 16:86511244-86511266 GGGCGGCTGCGGCGGCGCGGCGG + Exonic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142376748 16:89710651-89710673 GAGCGGCAGGGCCGGGGCCGTGG - Exonic
1142379022 16:89721429-89721451 GAGCGGGGGCGCTGGCACCGCGG + Intronic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1203123065 16_KI270728v1_random:1555496-1555518 CAGCGCCAGCGCCGGCGCGGCGG - Intergenic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142631618 17:1229559-1229581 GGGCGGAGGCGCCGGTCCCGAGG - Intergenic
1142764406 17:2057388-2057410 CAGCGGCCGCTCTGGCGCCGCGG - Exonic
1142764777 17:2058893-2058915 GAGCGGCGGGGGCGGCGCGCAGG + Exonic
1142795413 17:2303528-2303550 GGGCGGGGGCTCCGGAGCCGAGG + Intronic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143375418 17:6464203-6464225 GTGCCGCGGCCCCGGCGCCTGGG - Exonic
1143519162 17:7435918-7435940 GAGCGGCCGAGCTGGGGCCGGGG - Exonic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1145110355 17:20156452-20156474 GCCCGGCGGCCCCGGCGCCCAGG - Intronic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1146058705 17:29593557-29593579 GAGGGACGGCGCCGGAGCCGGGG - Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1146716202 17:35089076-35089098 AGGCGGCGGCGGCGGCGCTGGGG - Intronic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147132841 17:38419214-38419236 GAGGGGCGGGGCCGGCGGGGCGG + Intergenic
1147134731 17:38428404-38428426 GAGGGGCGGGGCCGGGGGCGGGG - Exonic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147970883 17:44218821-44218843 GAGCGGCCGCACCGCCCCCGGGG + Intronic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148048697 17:44759038-44759060 GGGCGGCAGGGACGGCGCCGGGG - Exonic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148556597 17:48582230-48582252 CACCGGCGGCGGCGGCGCGGAGG + Intronic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1148878572 17:50707714-50707736 CAGCGCCGCCGCCGTCGCCGCGG + Exonic
1148899654 17:50866356-50866378 GAGAGGCGGGGCGCGCGCCGCGG - Intronic
1149512734 17:57256574-57256596 GAGCGGCGGAGCCGGGGCAGCGG - Exonic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149855415 17:60078652-60078674 GAGGGGTGGGGCCGGGGCCGGGG + Intronic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150488917 17:65561353-65561375 GAGCCGCGGCGTGGGCGCGGGGG - Intronic
1150692751 17:67378866-67378888 GAGCGGCGGGGGCTGCGACGCGG + Intronic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1151453555 17:74213494-74213516 GAGAGGCGGGGCCGGGGGCGGGG + Exonic
1151555213 17:74843173-74843195 CAGGGGCGGCCCCGGCGTCGGGG + Exonic
1151711412 17:75809081-75809103 GAGCGGCGGGGGCGGGGGCGGGG + Intronic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152077511 17:78168598-78168620 CAGCGGCGGCGACGGCGACATGG + Exonic
1152175129 17:78782270-78782292 GAGCGGGGGCGCGGGTGGCGCGG - Exonic
1152363852 17:79844277-79844299 GGGCGGAGGCTCCGGAGCCGCGG + Intergenic
1152542135 17:80981751-80981773 GAGGGGCTGCGGCAGCGCCGGGG - Intergenic
1152589298 17:81203526-81203548 GAGCGGAGGCGCCCTCTCCGAGG + Exonic
1152628651 17:81399802-81399824 GCGCGGCGGCAGCGGCGCTGCGG - Exonic
1152697501 17:81804322-81804344 GCGCGGCGGGGCCGGGGGCGCGG + Intronic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152817833 17:82418662-82418684 GAGCGGAGGCGGCGGCCGCGAGG + Exonic
1152923992 17:83079429-83079451 AATCGGGGGCGCGGGCGCCGGGG - Intergenic
1152952809 18:10932-10954 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952816 18:10961-10983 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952823 18:10990-11012 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952830 18:11019-11041 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1152952837 18:11048-11070 CAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1153765131 18:8367500-8367522 GAGCGGCGGCACCTGTTCCGCGG + Intronic
1153935222 18:9914594-9914616 TGGCGGCGGCGGCGGCGCCAGGG - Intronic
1154070533 18:11148713-11148735 GAGCGTCGCGGCCCGCGCCGAGG - Intronic
1154092448 18:11378316-11378338 GAGCGGCTCCGCCGGCCCAGGGG + Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154202333 18:12308179-12308201 GAGCGGCGGGGCGGGGGCGGGGG + Exonic
1155007466 18:21741415-21741437 GGGCGGCGGCGCGGTCCCCGCGG - Exonic
1155152778 18:23135810-23135832 CAGCGCCGGCACCGACGCCGCGG + Exonic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1160024934 18:75209236-75209258 CGGGGGCTGCGCCGGCGCCGGGG - Exonic
1160163217 18:76491280-76491302 GAGGGCCGGGGCCGGGGCCGGGG - Intronic
1160204665 18:76822755-76822777 GAGCGGCGGGGCGGGGGCGGGGG + Intronic
1160453040 18:78978803-78978825 GCGCGGCGACGACGGGGCCGGGG + Intergenic
1160453596 18:78980668-78980690 GCGCGGCGGCGGAGGCACCGTGG - Intronic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160556506 18:79729086-79729108 GAGCGCTGGCGCGGGCACCGGGG - Intronic
1160659644 19:291903-291925 CAGCGGCGGGACCGGCCCCGCGG + Intergenic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160723679 19:608375-608397 GAGGGGCGGGCCCGGCCCCGGGG + Intronic
1160875802 19:1295754-1295776 GAGCGGCCCCCCGGGCGCCGCGG - Exonic
1160897202 19:1408340-1408362 AGGCGGCGGCGACGGCGCCCTGG - Intronic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161006768 19:1941112-1941134 CAGCCGCGGCCACGGCGCCGGGG - Intergenic
1161384826 19:3985326-3985348 GAGCGGCGGCGGGGCCTCCGCGG - Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161505086 19:4639518-4639540 CAGCGCCGGAGCCGGGGCCGGGG - Intronic
1161688947 19:5719820-5719842 GGGGGGCAGCGCGGGCGCCGGGG - Exonic
1161793186 19:6373029-6373051 GACCGGCAGCGCCGGGGGCGAGG + Intronic
1162019757 19:7863070-7863092 GATCGGCGGGGCCGGGGTCGGGG + Intronic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162145509 19:8610661-8610683 CAGCGGCGGCGACGGCGCGGAGG - Intronic
1162339938 19:10086298-10086320 GAAGGGCGGAGCCGGCCCCGAGG + Exonic
1162374461 19:10296502-10296524 GGGCGGCGGCGCTGGCGGGGCGG + Exonic
1162426875 19:10602422-10602444 GAGGGGCGGGGCCGGGGCCCGGG + Intergenic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162951293 19:14073358-14073380 GAGAGCCTGCGCCGGAGCCGGGG + Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1165243013 19:34482139-34482161 CAGCGGCGGCCCCGAGGCCGGGG + Exonic
1165349932 19:35269765-35269787 GAGCGGCGAGGCCGGCGCTGGGG - Intronic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165745980 19:38229618-38229640 GCGCGGCGGCAGCGGCGCCCCGG - Intronic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
1166304253 19:41928592-41928614 AGGCGGCGGCGGCGGCGCGGGGG + Intronic
1166367303 19:42284195-42284217 GGGCGGCGGCGCCGGCAGCCGGG + Intronic
1166727456 19:45037601-45037623 CAGCGGAGGTGCCGGGGCCGTGG + Exonic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1167019090 19:46861081-46861103 CGGCGGCGGCTCCGGCGGCGGGG - Intergenic
1167080856 19:47275247-47275269 TAGCGGCGGCGGCGGCTCAGCGG - Exonic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167622737 19:50568302-50568324 GAGCGGCGCCGGCGGGCCCGAGG - Intergenic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
1167797546 19:51719647-51719669 GGGTGGCGGCGGCGGCGCGGGGG - Exonic
1168013747 19:53554966-53554988 GAGTGGCGGGGCCGGCAGCGTGG + Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168276075 19:55279512-55279534 GGGCGGCGGCGGCGGCTCCTCGG - Exonic
1168343810 19:55641053-55641075 GGCCGGCGGCGCCGGGGACGCGG - Intronic
1202693092 1_KI270712v1_random:105042-105064 GAGAGGCGGCGGCGGCGGAGAGG + Intergenic
925169688 2:1743513-1743535 GAGCGGGGGCGCCGCGGCTGCGG + Intronic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
927652345 2:24920203-24920225 GCGCGGCGCCGGCGGCTCCGGGG + Intergenic
928143541 2:28751685-28751707 GCGCGGCGGCCCAGGCGTCGAGG + Intronic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929537505 2:42792747-42792769 GCGCGGCGGCGGCAGCGCTGGGG + Intergenic
929604177 2:43224534-43224556 GTGCGGCGGCCCCGGCGGGGAGG + Exonic
929857846 2:45651236-45651258 GAGGGCGGGCGCCGGCGCCCAGG + Intergenic
930136242 2:47906122-47906144 GAGCGGCGTCTCCGGCAGCGGGG + Intergenic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931348718 2:61470488-61470510 GCGCGGTGGCGCGGCCGCCGCGG - Intronic
931348871 2:61470930-61470952 GCGCCGAGGCGCCGGCGGCGGGG + Intergenic
931487324 2:62706078-62706100 GAGCGGCGGGGCCGGGGCTCGGG + Intronic
931602595 2:64019220-64019242 CAGCGGCGGAGGCGGCGCTGCGG - Intergenic
931763601 2:65436193-65436215 GAGCGGGGGCGCCGCGGCAGCGG - Intergenic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684724 2:85133735-85133757 AGGCGGCGGCTCCAGCGCCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933858401 2:86441301-86441323 GAGCGGCGGAAGCGGCTCCGAGG + Exonic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936412844 2:112275739-112275761 GAGCGGCAGCGCCGGCAGCGCGG + Exonic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937284523 2:120741704-120741726 GAGCGGCGCCGACCGTGCCGCGG + Intronic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
940639637 2:156333025-156333047 GAGCCGCTGCGCGGGCGCAGGGG - Intronic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
942043371 2:172085256-172085278 GGGCTGCGGCGTCTGCGCCGGGG - Exonic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942314195 2:174682931-174682953 GGGCGGCGGCGCCGGAGGGGAGG - Intergenic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942446140 2:176080241-176080263 CGGCGGGGGCGCCGGGGCCGGGG - Exonic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942458177 2:176151929-176151951 GGGCGCCGGCGGAGGCGCCGGGG - Exonic
942565830 2:177264374-177264396 GAGCCGCCGCGCTTGCGCCGGGG - Intronic
944221762 2:197310550-197310572 GGGCGGCGGCGCCGGCGGGCGGG - Intronic
944811135 2:203328449-203328471 GAGCGGCGGCCGCAGCGCCAAGG - Exonic
946185537 2:217978676-217978698 GAGCGGGGGCGCCGGCGGGGCGG - Intronic
946202686 2:218080148-218080170 GAGCGGCAGAGCCGGAGCCAGGG + Intronic
946386620 2:219387822-219387844 GAGGGGCGGGGCAGGCGGCGCGG - Exonic
946404168 2:219483875-219483897 GCTCGGCGGTGCCGGCCCCGGGG - Exonic
946692418 2:222319502-222319524 GGGCGGCGGTGGCGGGGCCGGGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1168795882 20:610033-610055 CGGCGGCGGCGCGGGCCCCGTGG - Exonic
1169065489 20:2692630-2692652 GAGCGGCCGGGCCCGGGCCGCGG - Intergenic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169213039 20:3778191-3778213 GAGCGGCGGCCCGGGCCGCGCGG - Exonic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1170204698 20:13785310-13785332 GGGCGGCGGGGCGGGCGACGCGG + Intronic
1171876843 20:30585437-30585459 CAGCGCCGGCGCAGGCGCAGGGG + Intergenic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172274977 20:33674435-33674457 GCGCGTCGGCGCCGGCGCCAAGG - Intronic
1172277230 20:33686292-33686314 GACAGGCGGCGGCGGCGGCGCGG + Exonic
1172359609 20:34303003-34303025 GCGCGGCGGCCCCGGCGTCGCGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172482245 20:35277893-35277915 AAGCGGCGGCCGCGGCGCCCCGG - Intergenic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173243437 20:41317620-41317642 CGGCGGCGACGCCGGAGCCGCGG + Intronic
1173454105 20:43189807-43189829 CAGCGGCCGCGCCGGCGATGCGG - Exonic
1173865081 20:46308145-46308167 GAGCGGCCGGGCAGGCGGCGCGG - Intronic
1174204267 20:48827815-48827837 GCCCGGCGGCGACGGGGCCGGGG - Exonic
1174258697 20:49277944-49277966 GCGGGTCGGCGCGGGCGCCGGGG + Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174607014 20:51768405-51768427 GGGCGGCGGCCCAGGCGGCGCGG - Exonic
1175349842 20:58309879-58309901 GTGCGGCGGCAGCGGCGCCAGGG + Exonic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175859706 20:62143634-62143656 GAGCGGCGGCGCCGCGGGCCCGG + Intergenic
1175859715 20:62143656-62143678 GAGGCGCGGCGACGGCGACGGGG + Intergenic
1175877793 20:62238643-62238665 GAGCTGCGGGGCCTGGGCCGCGG + Intronic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176194430 20:63830898-63830920 CAGCTGCGGCGCGGGCTCCGGGG - Intronic
1176194623 20:63831423-63831445 GAGGGGCGGGGCCGGCGGCCGGG - Intergenic
1176234581 20:64048484-64048506 GAGCGGCGCCGCGGGGGGCGCGG + Exonic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176278214 20:64286480-64286502 GCGCGCCTGCGCCGGCGCGGTGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1176619179 21:9043200-9043222 CAGCGCCGGCGCAGGCGCAGGGG - Intergenic
1177166875 21:17613005-17613027 GAGGGGCGGTGCCGGGGGCGGGG + Intergenic
1178610431 21:34074147-34074169 CGGCGGCGGGGCCGGCGACGAGG - Intronic
1178707802 21:34889395-34889417 GAGCCGCGGCCCGGGCGCAGCGG - Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180095858 21:45555154-45555176 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095873 21:45555187-45555209 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180614773 22:17120233-17120255 CCGCGGGGGCGCCGGCGGCGCGG - Exonic
1180866494 22:19122648-19122670 GAGAGGCAGGGCCGGGGCCGGGG + Intergenic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182278623 22:29205816-29205838 CAGCGGCGGCGCAGGGGGCGGGG + Intergenic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1182586325 22:31346100-31346122 GGGCGGGGGCGCCGGAGCGGAGG + Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183429665 22:37757935-37757957 GAGGGGCCGCGCCGGGGCCTGGG + Exonic
1183452859 22:37906269-37906291 GAGGGGCGGAGGCGGGGCCGCGG - Intronic
1183484352 22:38081395-38081417 CAGCGCCGGCGACCGCGCCGGGG - Exonic
1183486402 22:38089492-38089514 GAACGGCGGCGGGGGCGCCCAGG + Intronic
1183665575 22:39244136-39244158 CAGCGACGGAGCCGGGGCCGGGG - Exonic
1183702251 22:39457320-39457342 GAGCGGCCGCGCCGGGTCCCCGG + Intergenic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1184152986 22:42649265-42649287 GGGAGGGGGCGCCGGGGCCGCGG - Intronic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184593858 22:45502815-45502837 GCGCGGCGGAGGCGGGGCCGCGG - Intronic
1184680919 22:46071728-46071750 GGGCGGGGACGGCGGCGCCGCGG + Intronic
1184711289 22:46250772-46250794 GAGGGGCGCCGCAGGCGACGTGG - Intergenic
1184720311 22:46308780-46308802 GTGCGGAGGCCCCGGCGCCCGGG - Exonic
1184759488 22:46536744-46536766 GCGCGGCCGCGCAGCCGCCGGGG + Exonic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185037962 22:48489568-48489590 AAGCCGCGGCGCCCGCGCGGGGG - Exonic
1185278756 22:49961043-49961065 GGCCGGCGGGGCCGGGGCCGGGG + Intronic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185335163 22:50268070-50268092 GAGCTGGGGCGGCGGGGCCGGGG - Intronic
1185343004 22:50299916-50299938 GTCTGGCGGTGCCGGCGCCGGGG - Intronic
1185398448 22:50604210-50604232 GCGCGGGGGCTCCGGCTCCGAGG - Exonic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185420279 22:50731060-50731082 GGCCGGGGGCGCCGGGGCCGGGG - Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950024298 3:9810046-9810068 GAGCTGGGGCCCGGGCGCCGGGG + Exonic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004218 3:47578866-47578888 CAGCGGCGGCGCGGGAGGCGGGG - Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954265936 3:49470365-49470387 GAGCGGCGGTGGCGGCGTCCTGG + Exonic
954389230 3:50260242-50260264 GTGAGGCGGCGACGGCTCCGCGG + Intergenic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954778995 3:53045741-53045763 CGGCGGCGGCGCCGGGGCGGGGG - Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955060460 3:55488229-55488251 GGGCGGCGGAGGCGGCTCCGTGG + Intronic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956675018 3:71725272-71725294 GAGCGGCGGCTCGGGGGCGGCGG + Exonic
956677936 3:71753428-71753450 CGGCGGCGGCGCCCGCGCTGGGG - Intronic
956678190 3:71754300-71754322 GCCCGGCGGCGCCCCCGCCGCGG - Exonic
957939793 3:86990764-86990786 GAGCGGCGGCGGCAGCTCGGGGG - Exonic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
958900141 3:99876289-99876311 GTGTGGCTGCGCCGCCGCCGCGG - Intronic
959539836 3:107525151-107525173 GCGCGGGGACGTCGGCGCCGGGG - Intronic
960639146 3:119810208-119810230 GCGCGGGCGGGCCGGCGCCGGGG + Intronic
960864285 3:122184284-122184306 GAGCTCCGGGGCCGGGGCCGGGG + Intronic
961012910 3:123448125-123448147 GGGCGGCGGCGGCGGCTCGGCGG - Exonic
961377308 3:126475598-126475620 GCACGGCGGCGCTGCCGCCGAGG - Exonic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
962808999 3:138946176-138946198 GTGCGGCGTGGCGGGCGCCGGGG - Exonic
962919139 3:139935428-139935450 GAGCGGCAGCGGCGGTGGCGGGG + Exonic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
964358387 3:155870676-155870698 GAGCGCGGGCCCCAGCGCCGCGG - Exonic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966182246 3:177197690-177197712 GGGAGGCGGCGGCGGCGCGGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966808730 3:183825553-183825575 GAGCGGGGCGGCGGGCGCCGGGG - Exonic
966911277 3:184561760-184561782 GAGCGGCCGCGCCAGCGCTGGGG + Intronic
967924189 3:194633389-194633411 CGGCGGCGGCGAAGGCGCCGGGG + Exonic
968494529 4:907979-908001 GAGCGGCGGGGACAGGGCCGGGG - Intronic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
970194637 4:13542442-13542464 GTGCAGCGGGGCCGGCGGCGGGG - Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972437249 4:39045338-39045360 GAGCGCCGGAGCCGGCGCCCGGG + Intronic
972739049 4:41873693-41873715 AGGCGGAGGCCCCGGCGCCGAGG + Intergenic
972817179 4:42657141-42657163 GAGCTCGGGCGCCGGCGCCGGGG + Intergenic
973759068 4:54100581-54100603 CAGCGGGGGCGCAGGGGCCGGGG + Exonic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975870773 4:78776360-78776382 GAGCCGCGGAGCGGGCGGCGGGG + Exonic
977810033 4:101347386-101347408 GAGCGCCGCCGCTGGTGCCGCGG + Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979349264 4:119627300-119627322 GGGCGGCGGCGCGGAGGCCGGGG - Intronic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
979785680 4:124712795-124712817 GAGCGGCGGGGCGGGGGCGGGGG - Intergenic
980827379 4:138089048-138089070 GAGCGGCGGCAACGGCGCGGCGG - Intergenic
982573201 4:157076123-157076145 GGGCCGCGGAGCCTGCGCCGTGG - Exonic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985129101 4:186723887-186723909 GAGCGCCGGCGCCGGCGGGCGGG - Intronic
985629860 5:1008779-1008801 GAGCGCGTGCGCCCGCGCCGGGG - Intergenic
985749753 5:1667388-1667410 GAGCGGTGGCGCCGTTGCCCTGG + Intergenic
985894267 5:2739622-2739644 GTCCGGCGGCGACGGCGGCGGGG - Intergenic
986813632 5:11385050-11385072 GCGCGGCGGCGCGGGCAGCGTGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
989178989 5:38557144-38557166 GAGCGGCGGCGCCTCGGCCCTGG - Intronic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
989812588 5:45695940-45695962 GGGCGGCGGGGCCGGCGCGAAGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
991474372 5:67004155-67004177 GAGCGGCGGCCCAGGCTGCGGGG + Intronic
992067298 5:73120170-73120192 GAGCGGCGGCGTGGGGGGCGCGG - Intergenic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
992627669 5:78649180-78649202 GAGCGGCGCTGACGGAGCCGGGG + Intronic
992796079 5:80256098-80256120 GCGAGGCGGGGCCGGCGGCGGGG - Intergenic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
997584061 5:135034355-135034377 GCGCGGCGGCGCGGGCGGCTTGG - Intronic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998374568 5:141682232-141682254 GGGAGGCGGGGCCGGCGCGGCGG - Intergenic
1002168710 5:177363309-177363331 GAGGGGCGGGGCCGGAGACGGGG + Intronic
1002591053 5:180291926-180291948 CGGCGGCGGAGCCGGGGCCGCGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002621973 5:180494461-180494483 TGGCGGCGGCGACGGCGGCGCGG + Exonic
1002712768 5:181205062-181205084 GAGCCTCGGCGCCGGTTCCGGGG + Exonic
1002771275 6:292445-292467 GAGCGGCGGGGCGGGCGGGGAGG - Exonic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003942603 6:11044121-11044143 GGGCGCCGGCGCGGGCGCTGCGG - Intronic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004650249 6:17600885-17600907 GGGCGGCGGCGCCGCGGCCTGGG - Exonic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1005348324 6:24911095-24911117 GAGCGGCGGAGCGGGCGGAGGGG + Intronic
1005859155 6:29888084-29888106 GAGAGGAGCCGCGGGCGCCGTGG + Intergenic
1006043223 6:31271717-31271739 GAGGGGAGCCGCGGGCGCCGTGG - Exonic
1006052810 6:31356806-31356828 GAGAGGAGCCGCGGGCGCCGTGG - Exonic
1006096716 6:31660787-31660809 GAGCTGCGGCACCGCCCCCGCGG - Intergenic
1006293966 6:33161633-33161655 AGGCGGAGGCGCCAGCGCCGAGG + Intergenic
1006304120 6:33208647-33208669 GAGGGGCAGTGCCGGCGCGGGGG + Intronic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1010414874 6:75601813-75601835 GGGCGGCGGCGTCGGGGCGGGGG + Intronic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1011195323 6:84774337-84774359 GAGTCGGGGCGCGGGCGCCGCGG - Intergenic
1011226613 6:85114981-85115003 GGGCGGGGGCGGGGGCGCCGGGG + Intergenic
1013009575 6:106107137-106107159 GCGCTGCGGCCCCGGCGCCTGGG + Exonic
1013117768 6:107115417-107115439 GACCGGCGGCGGCGGCGCTCGGG + Intergenic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1013359632 6:109382229-109382251 GAGGGACGTCACCGGCGCCGAGG + Exonic
1013472411 6:110476829-110476851 GAGCGGCGGCGCTGGGGGCGAGG - Intergenic
1013619289 6:111872891-111872913 GCGCGGGGGCGCCGGCGGCCGGG + Intronic
1013792718 6:113855234-113855256 AAGAGGCGGAGCCGGCGCTGGGG - Intergenic
1013803300 6:113970832-113970854 GAGCGGCCGGGCCGGTGTCGGGG - Intronic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014098129 6:117482381-117482403 GAGGGGCGGGTCCGGCGGCGAGG + Intronic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014724952 6:124962568-124962590 GAGCGGCGGCGGCGGGCCCCAGG + Exonic
1014802363 6:125791040-125791062 GGGCGGGGGCGCCGGCTCCTGGG - Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015773540 6:136792282-136792304 GAGAGGAGGCGGCGGCGCGGCGG - Exonic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017793772 6:157823502-157823524 GAGGGTCGGGGCCGGGGCCGCGG + Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1019200004 6:170306590-170306612 GCGCGCAGGCGCCGGCGGCGTGG - Intronic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019474375 7:1236838-1236860 GGGCGACGGCGCGGGCGGCGGGG - Exonic
1019563189 7:1667842-1667864 CGGCGGCGGCGCCGGCGTCCGGG + Intergenic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019989551 7:4682247-4682269 CAGCGGCGGCGCGGGGGGCGGGG - Intergenic
1020099924 7:5388950-5388972 CAACGGCGGCGCCGGGGACGTGG - Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020260153 7:6526531-6526553 GGGCGGCCTCGCCGGCCCCGGGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1023703055 7:42911767-42911789 GAGCCGCGGCGCTGGCGGTGGGG - Intronic
1024043821 7:45574463-45574485 GGGCGCGGGCGGCGGCGCCGGGG - Intronic
1024579949 7:50793340-50793362 TGGCGGCAGCGCCGGCGGCGCGG - Intronic
1025078707 7:55964567-55964589 CAGCGGCGGCGCCCGGGCGGTGG + Exonic
1026817190 7:73522077-73522099 GCGCGGCCGCGCCGGCGGTGAGG - Exonic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1028173567 7:87628289-87628311 GAGGGGCGGGGCCGGCCGCGCGG - Intronic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1028899139 7:96076200-96076222 GAGCGGCGGCTCAGGCGCCCGGG + Intronic
1029123245 7:98281896-98281918 GGGCGGCGGCGGGGGCGCGGCGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029640763 7:101817446-101817468 GCGCGGAGTCCCCGGCGCCGCGG + Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031043550 7:116862919-116862941 GGGCGGGGGCGCGGGCGCGGGGG + Intronic
1031317272 7:120273371-120273393 GCGCGGTGGGGCCGGGGCCGGGG - Intergenic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033186507 7:139231627-139231649 GGGCGGAGCCGCCGGCCCCGCGG + Exonic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1033390722 7:140924831-140924853 GAGCGGCCCGGGCGGCGCCGCGG + Intergenic
1033654318 7:143362670-143362692 GAGCGGCTGGGGCGGCGGCGCGG - Exonic
1033662063 7:143408893-143408915 GGGGGGCGGGGCCAGCGCCGGGG + Intergenic
1034223086 7:149460451-149460473 GAGGGGCGGCGCGCGGGCCGGGG - Intronic
1034228007 7:149497741-149497763 GGGCCGCGGCGCCGGCTCCCAGG - Exonic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034447938 7:151122952-151122974 GAGCGCCGGAGCCCGCGCTGGGG + Intronic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035404204 7:158587655-158587677 GAGCGGCGGCCCCATCCCCGCGG + Exonic
1035429306 7:158806046-158806068 TAGCAGCAGAGCCGGCGCCGGGG + Intronic
1036454056 8:8892917-8892939 GCGCGTCGGCCCCGGCCCCGGGG + Exonic
1036789478 8:11708611-11708633 GCGCGGCGACACCGGCGGCGGGG - Exonic
1037336840 8:17800890-17800912 GGGCGGCAGCGCCGGCGGAGCGG - Intronic
1037450744 8:19013852-19013874 GAGAGGCGGGGCCGACGCCTCGG + Intronic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1037825218 8:22156574-22156596 GAGCGGTGGGGCGGGGGCCGCGG - Exonic
1037903836 8:22703782-22703804 GAGCGGCGCCGCCCGCGGCCCGG - Intergenic
1039554866 8:38468315-38468337 CTGCGGAGGCCCCGGCGCCGCGG + Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1039618236 8:38974159-38974181 GGCCGGCGGAGGCGGCGCCGTGG + Exonic
1039868842 8:41528927-41528949 GAGCGGCGGTGTCCGCCCCGGGG - Intergenic
1039936597 8:42051641-42051663 GGGCGGCGGCGCGCGGGCCGCGG + Intronic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1040471255 8:47737626-47737648 GCGCGGCGGCTCCGGCGACGTGG + Exonic
1041552604 8:59118809-59118831 GAGCGGCGGTGGCCGGGCCGCGG - Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1043563477 8:81522256-81522278 CAGCGGCGGCGCTGGAGCGGCGG + Intergenic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1044306354 8:90645605-90645627 GAGTGGCGGCGGCGGCGTGGTGG - Exonic
1045489176 8:102656034-102656056 GAGAGGCGGTGCCGCGGCCGGGG + Intergenic
1045500187 8:102738799-102738821 GGGAGGCGGCACCGGCACCGTGG + Intergenic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1045583223 8:103500814-103500836 CAGCGGCGGCACCGGCGCGGCGG - Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049166369 8:141128541-141128563 GAGGGGCGGGGCCCGAGCCGAGG - Intronic
1049194686 8:141308617-141308639 GTGCGGAGGGGCCGGGGCCGGGG - Intergenic
1049405533 8:142450384-142450406 GGGAGGAGGCGGCGGCGCCGAGG - Intronic
1049411523 8:142475797-142475819 TAGGGGCGGGGCCGGGGCCGGGG + Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049644041 8:143728200-143728222 GACCGAGGGCGCGGGCGCCGTGG - Exonic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049694535 8:143976907-143976929 GAGCGGCGGGGCTGGGGCCCGGG + Intergenic
1049936439 9:504973-504995 GAGAGGTGGCGTCGGCCCCGCGG + Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1053034108 9:34810010-34810032 GGGCGGCGGCGGCGGCGCGTGGG - Intergenic
1053055188 9:34989756-34989778 AGGCGGCGGAGCCGGAGCCGGGG + Exonic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053239976 9:36487536-36487558 GAGCGGAAGCGCGGCCGCCGCGG - Intronic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1053752911 9:41274036-41274058 GAGCCCCGGCGCAGGCGCGGAGG - Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054333334 9:63781656-63781678 GAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055321732 9:75088768-75088790 CAGAGGAGGCGCCGGCACCGCGG - Intronic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1056153938 9:83817194-83817216 GAGCGCGGGCGCCAGCGGCGGGG + Intronic
1057054390 9:91949761-91949783 GAGCATGGGCGCCGGCGCAGCGG + Intronic
1057488719 9:95506371-95506393 GGCCGGGGGCGCGGGCGCCGCGG + Intronic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1058070813 9:100598942-100598964 CAGAGCCGGCGCAGGCGCCGAGG + Intergenic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059405836 9:114098086-114098108 GAGCGCCGGCGGCGCCCCCGCGG - Intronic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060283475 9:122228846-122228868 GGGCGGCGGGGCCGGCGCCTCGG - Intronic
1060404404 9:123366119-123366141 GAGCGGCGGGGCAGGCGGCAGGG + Intronic
1060480020 9:124012318-124012340 GACCGGCGGGGCCGGGGGCGCGG - Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060979859 9:127785823-127785845 GAGCCGGGGCGCCGGAGCTGGGG - Intronic
1061038668 9:128127517-128127539 GAGCTGCGGCGCTGGCCCTGGGG - Exonic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061293705 9:129666151-129666173 GGGTGGCGGGGCCGGGGCCGGGG + Intronic
1061438152 9:130579652-130579674 CGGCGGCGGCGACGGCGGCGGGG + Exonic
1061559588 9:131394079-131394101 GAGCGGCGAGACAGGCGCCGAGG + Intronic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062294779 9:135818663-135818685 GCGCCGCGGCGCAGGCGTCGTGG - Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062431282 9:136527860-136527882 GAGCGGCACAGCAGGCGCCGGGG - Intronic
1062472383 9:136712298-136712320 GGGAGGCGGAGCCGGGGCCGGGG - Intergenic
1062499522 9:136846282-136846304 GCGTGGCGGCGCCAGCGCGGGGG - Exonic
1062556222 9:137114434-137114456 GGGCGGCCGGGCCGGGGCCGGGG + Intronic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062594940 9:137295395-137295417 GGGAGGCGGGGCGGGCGCCGGGG - Intergenic
1062659103 9:137619092-137619114 CAGCGGCGGAGGCGGCGCGGGGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696347 9:137877999-137878021 GGGCGGCGGGGCCGGCGGGGCGG + Exonic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1202800338 9_KI270719v1_random:169980-170002 GACCGCCGGCGCAGGCGCGGAGG + Intergenic
1203773591 EBV:61239-61261 CAGCGGTGGCGGCGGCCCCGCGG - Intergenic
1203773622 EBV:61314-61336 GAGGGCCGGAGCCGGGGCCGGGG + Intergenic
1203782390 EBV:107926-107948 GAGCGGCGGCGGTTGCGCCCGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1185621494 X:1453423-1453445 GAGGGGCGGGGCGAGCGCCGGGG - Intronic
1185736644 X:2500931-2500953 AAGCGGCGGCGGCGCGGCCGGGG - Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190062259 X:47219055-47219077 GCGCCGCCGCGCCGGCCCCGCGG + Intronic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1195668350 X:107449918-107449940 GCGCGGCAGCGGCGGCGCAGCGG - Intergenic
1195716840 X:107826301-107826323 TAGCGGCGGCGGCGGCGACCGGG + Exonic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1197202991 X:123765040-123765062 GAGCGGCGGAGGCGGCTCAGCGG + Intergenic
1198215268 X:134549629-134549651 GAGCGGCGCAGCCGGCGGAGAGG + Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1201152843 Y:11103185-11103207 CAGCGCCGGCGCAGGCGCAGGGG - Intergenic