ID: 1143100587

View in Genome Browser
Species Human (GRCh38)
Location 17:4502646-4502668
Sequence CACGCAACCCGGGAGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 331}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143100587_1143100596 13 Left 1143100587 17:4502646-4502668 CCGCCTGCCTCCCGGGTTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 331
Right 1143100596 17:4502682-4502704 TGTATCTCGAGCACCTGGGACGG 0: 1
1: 1
2: 3
3: 20
4: 254
1143100587_1143100600 28 Left 1143100587 17:4502646-4502668 CCGCCTGCCTCCCGGGTTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 331
Right 1143100600 17:4502697-4502719 TGGGACGGGGCCAGATTCCTAGG 0: 1
1: 0
2: 0
3: 18
4: 156
1143100587_1143100598 15 Left 1143100587 17:4502646-4502668 CCGCCTGCCTCCCGGGTTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 331
Right 1143100598 17:4502684-4502706 TATCTCGAGCACCTGGGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 138
1143100587_1143100595 9 Left 1143100587 17:4502646-4502668 CCGCCTGCCTCCCGGGTTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 331
Right 1143100595 17:4502678-4502700 AGACTGTATCTCGAGCACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 166
1143100587_1143100597 14 Left 1143100587 17:4502646-4502668 CCGCCTGCCTCCCGGGTTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 331
Right 1143100597 17:4502683-4502705 GTATCTCGAGCACCTGGGACGGG 0: 1
1: 0
2: 0
3: 17
4: 141
1143100587_1143100594 8 Left 1143100587 17:4502646-4502668 CCGCCTGCCTCCCGGGTTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 331
Right 1143100594 17:4502677-4502699 GAGACTGTATCTCGAGCACCTGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143100587 Original CRISPR CACGCAACCCGGGAGGCAGG CGG (reversed) Intronic
900094790 1:935983-936005 CAGGCAGCCAGAGAGGCAGGAGG + Intronic
901492065 1:9601727-9601749 CCCACAACCCAGGAGGCAGGTGG - Intronic
901632239 1:10653585-10653607 CACGGCACCCAGGAGGCTGGGGG + Exonic
902180118 1:14681764-14681786 AACGCCTCCCGGGAGGCGGGAGG - Intronic
903081649 1:20816254-20816276 CACCCCATCCGGGAGGGAGGTGG + Intronic
903508181 1:23853324-23853346 CACCCCATCCGGGAGGGAGGTGG + Intronic
903939764 1:26921660-26921682 GCCGCAAACCGGGAGGAAGGCGG + Intronic
905041962 1:34967716-34967738 CACCCCATCCGGGAGGGAGGTGG - Intergenic
906432400 1:45765695-45765717 CAACAAACCCGGGAGGGAGGTGG - Intergenic
907410229 1:54278612-54278634 CACCCAACCCTGGAGGCCTGGGG + Intronic
911486698 1:98512875-98512897 CACCCCATCCGGGAGGGAGGTGG - Intergenic
912298496 1:108489937-108489959 CACCCCATCCGGGAGGGAGGTGG - Intergenic
914754990 1:150557458-150557480 AAGGCAGCCAGGGAGGCAGGAGG - Intronic
915511412 1:156388811-156388833 CAGCCAGCCCGGGAGGAAGGCGG + Intergenic
918176107 1:182046709-182046731 CAGGCTACCTCGGAGGCAGGAGG + Intergenic
920504561 1:206507180-206507202 CACGCGCCCCGGGAGGGAGCAGG - Intergenic
920852353 1:209636679-209636701 CACAAAGGCCGGGAGGCAGGCGG - Intronic
922806130 1:228390859-228390881 CCAGCAACCGGGGAGGCAGGCGG + Intergenic
923063906 1:230500835-230500857 GAAGCAGCCCGGGAGGCAGGTGG + Intergenic
923098412 1:230793578-230793600 CAGGCAGCCCGGCAGGCGGGAGG - Intronic
924561175 1:245156870-245156892 CAGGCCGCCCGGGGGGCAGGAGG + Intronic
924788381 1:247220602-247220624 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1062901894 10:1152812-1152834 CACGGCACACAGGAGGCAGGGGG + Intergenic
1062901916 10:1152892-1152914 CACGGCACACAGGAGGCAGGGGG + Intergenic
1064108366 10:12519453-12519475 CACCCCATCCGGGAGGGAGGTGG - Intronic
1064799470 10:19052579-19052601 CACGGAAGGTGGGAGGCAGGAGG - Intronic
1067872110 10:49970690-49970712 CACCCCATCCGGGAGGGAGGTGG + Intronic
1071311386 10:84347466-84347488 CACCCAGTCCGGGAGGGAGGTGG - Intronic
1071343394 10:84668359-84668381 CACGCAAAGCGTGAAGCAGGAGG - Intergenic
1073041324 10:100608794-100608816 CTTTCAACCCAGGAGGCAGGAGG + Intergenic
1074152004 10:110767123-110767145 CACCCCATCCGGGAGGGAGGTGG - Intronic
1074396487 10:113102022-113102044 CCAGCTACTCGGGAGGCAGGAGG + Intronic
1075675716 10:124294437-124294459 CACACAACCAGGGATGGAGGAGG - Intergenic
1076395673 10:130136190-130136212 CATGAACCCCGGGAGCCAGGAGG + Intergenic
1077292258 11:1803301-1803323 CACTCACCCCGGAAGGAAGGCGG + Intergenic
1077606232 11:3614716-3614738 CACGGAACCCAGGAGACAGGGGG - Intergenic
1079039824 11:17050597-17050619 CATGCCATCCGGGAGGGAGGTGG - Intergenic
1081536733 11:44002158-44002180 CACGTAACACAGGAGGAAGGAGG - Intergenic
1082166382 11:48955552-48955574 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1083624438 11:64064911-64064933 CAGGCAAGGCGGCAGGCAGGAGG + Intronic
1085027339 11:73243948-73243970 CCTTGAACCCGGGAGGCAGGAGG + Intergenic
1086233698 11:84600248-84600270 CAAGCAAGCAGGCAGGCAGGCGG + Intronic
1086446929 11:86879431-86879453 CACCCCATCCGGGAGGGAGGTGG + Intronic
1086697287 11:89860908-89860930 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1087057346 11:93947354-93947376 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1088625189 11:111724874-111724896 CCCGCCACCGTGGAGGCAGGGGG + Exonic
1089159720 11:116428303-116428325 CAGGCAGCCCGGGAGAAAGGAGG + Intergenic
1089666694 11:120025147-120025169 CAAGCTACTCCGGAGGCAGGAGG + Intergenic
1090785501 11:130044264-130044286 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1092827839 12:12414697-12414719 CACCCCATCCGGGAGGGAGGTGG - Intronic
1093287000 12:17276050-17276072 CACTTGAACCGGGAGGCAGGAGG + Intergenic
1094272258 12:28629910-28629932 CAGGCAGGCCGGCAGGCAGGCGG + Intergenic
1094670330 12:32563148-32563170 CACCCCATCCGGGAGGGAGGTGG - Intronic
1095557398 12:43523511-43523533 CAGGCAACCTGGGAGGGATGTGG + Intronic
1096791882 12:54050460-54050482 CCAGCAAGGCGGGAGGCAGGAGG + Intronic
1097189961 12:57214874-57214896 CTACCCACCCGGGAGGCAGGTGG + Intergenic
1097228540 12:57495096-57495118 CACCCAGCCCGGGAGGTGGGGGG - Intronic
1098883761 12:75941891-75941913 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1100994969 12:100294216-100294238 CACCCCATCCGGGAGGGAGGTGG - Intronic
1102521281 12:113478743-113478765 CGCGGACCCCGGGAGGGAGGAGG + Intergenic
1103457131 12:121076353-121076375 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1103626132 12:122221515-122221537 CTAGCTACCTGGGAGGCAGGAGG - Intronic
1104973965 12:132543851-132543873 CACCCAGCCCGGGATGGAGGTGG + Intronic
1105808399 13:23972608-23972630 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1106149042 13:27080147-27080169 CATGCAGGCAGGGAGGCAGGAGG + Intronic
1111418180 13:87976298-87976320 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1111567323 13:90032866-90032888 CACCCAACCCTGGAGGAGGGTGG - Intergenic
1112056067 13:95690977-95690999 CACCCCATCCGGGAGGGAGGTGG - Intronic
1116005332 14:39285622-39285644 CACCCCATCCGGGAGGGAGGTGG - Intronic
1116394286 14:44429647-44429669 CTTGCAACCCGGGAAGCAGTGGG + Intergenic
1116409135 14:44601547-44601569 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1118148626 14:63165725-63165747 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1119524456 14:75311046-75311068 CAGGCAGCCCGGGGGGCAGTGGG + Intergenic
1119554289 14:75541507-75541529 CATGCAGCCCAGGAGGCAGATGG + Intronic
1121142900 14:91557570-91557592 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1121311414 14:92937380-92937402 CACACAGCCCTGGAGGAAGGGGG + Exonic
1121637922 14:95466279-95466301 CCCCCGACCCAGGAGGCAGGTGG - Intronic
1123008174 14:105334292-105334314 CACGCTGCCCTGGAGTCAGGTGG - Intronic
1124843263 15:33264442-33264464 CACTCAACCCGGTAGTCAGAGGG + Intergenic
1125521131 15:40348383-40348405 AGGGCAGCCCGGGAGGCAGGGGG + Intergenic
1126571595 15:50158370-50158392 CACCCCATCCGGGAGGGAGGTGG + Intronic
1127072980 15:55303062-55303084 CGCGCCATCCGGGAGGGAGGTGG + Intronic
1127361155 15:58246222-58246244 CTCTCAACCCAGAAGGCAGGAGG + Intronic
1128323459 15:66707818-66707840 TTGGCAACCCGGGAGGCATGTGG + Intronic
1130340782 15:82998227-82998249 CACCCCATCCGGGAGGGAGGTGG - Intronic
1131680181 15:94713394-94713416 CAGGCAACCAGGAAGGCTGGAGG + Intergenic
1131836810 15:96399253-96399275 CAGGCAACTCTGCAGGCAGGTGG - Intergenic
1132221503 15:100108829-100108851 CAGGCAACACTGGCGGCAGGAGG + Intronic
1132805346 16:1772721-1772743 CACGCAAACCTGCAGGGAGGAGG + Intronic
1135639687 16:24109294-24109316 CACCCCATCCGGGAGGGAGGTGG - Intronic
1136069777 16:27780852-27780874 CACTCACCCCTGGAGGCAGCAGG - Intergenic
1136165240 16:28448873-28448895 CGCCCCACCCGGGAGGGAGGTGG + Intergenic
1136165263 16:28448922-28448944 CGCCCCACCCGGGAGGGAGGTGG + Intergenic
1136197711 16:28666098-28666120 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1136197734 16:28666147-28666169 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1136214049 16:28780235-28780257 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1136214072 16:28780284-28780306 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1136258785 16:29060159-29060181 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1136258808 16:29060208-29060230 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1136398682 16:30006324-30006346 CACGCCACCTGGGGAGCAGGTGG + Exonic
1138342177 16:56297162-56297184 CAAGCAAGCTGGGAGGCAGGTGG - Intronic
1138590664 16:57998051-57998073 CACGCACCCCTGCAGGCAGCAGG - Exonic
1139713440 16:68793807-68793829 CCTCGAACCCGGGAGGCAGGAGG + Intronic
1140994112 16:80243383-80243405 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1141968166 16:87461207-87461229 CACTGAACCCAGGAAGCAGGAGG - Intronic
1142384202 16:89752287-89752309 CACTCAGCTCCGGAGGCAGGAGG - Intronic
1142822594 17:2482800-2482822 CCCGCTACGCAGGAGGCAGGAGG + Intronic
1142847860 17:2690829-2690851 CAGGAAAGCCGGGAGGCGGGTGG - Intronic
1143100587 17:4502646-4502668 CACGCAACCCGGGAGGCAGGCGG - Intronic
1143140865 17:4741044-4741066 GAGGCTGCCCGGGAGGCAGGAGG + Exonic
1143671184 17:8397290-8397312 CTGGCCACCTGGGAGGCAGGGGG + Intronic
1144336974 17:14280251-14280273 CCCGCTACTCGGGAGGCTGGAGG + Intergenic
1144536389 17:16095373-16095395 CACCCCGCCCGGGAGGGAGGTGG + Intronic
1145011291 17:19369783-19369805 CTAGCAACCCAGGTGGCAGGTGG + Intronic
1145022295 17:19441668-19441690 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1145389472 17:22444441-22444463 CAGGAAAGCTGGGAGGCAGGAGG - Intergenic
1145418152 17:22741398-22741420 CACCCCGCCCGGGAGGGAGGTGG + Intergenic
1145717217 17:27034001-27034023 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1146048855 17:29533025-29533047 CACCCCATCCGGGAGGGAGGTGG - Intronic
1147278428 17:39337754-39337776 CACCCCATCCGGGAGGGAGGTGG + Intronic
1147278490 17:39337893-39337915 CACCCTATCCGGGAGGGAGGTGG + Intronic
1147324555 17:39663989-39664011 CAGGCCAGCCGGGAGGGAGGAGG - Intergenic
1147785081 17:42973170-42973192 CACCCCATCCGGGAGGGAGGTGG + Intronic
1147963319 17:44180530-44180552 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1148404296 17:47397899-47397921 CACCCCATCCGGGAGGGAGGTGG + Intronic
1148406485 17:47420795-47420817 CACCCCATCCGGGAGGGAGGTGG + Intronic
1148442731 17:47720145-47720167 TTCACAACCTGGGAGGCAGGAGG + Intergenic
1152091202 17:78248812-78248834 AAGGTCACCCGGGAGGCAGGGGG + Intergenic
1153634086 18:7098697-7098719 CACCCCATCCGGGAGGGAGGTGG + Intronic
1154115246 18:11608734-11608756 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1155505881 18:26532376-26532398 CCAGCTACCCTGGAGGCAGGAGG - Intronic
1156326297 18:36077718-36077740 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1157705217 18:49800063-49800085 CACGCCATCCGGGAGGGAGGTGG + Intronic
1160101355 18:75922901-75922923 CACTGAGCCCGGGTGGCAGGTGG + Intergenic
1160503911 18:79416884-79416906 CACCCATGCCGGGAGCCAGGAGG - Intronic
1160585479 18:79911310-79911332 CAGGCAGGCCAGGAGGCAGGCGG + Intronic
1160989980 19:1856556-1856578 CAAGCAACCCAGGATGCAGCTGG + Intronic
1161459597 19:4388986-4389008 CACAGCACCAGGGAGGCAGGTGG - Intronic
1161533441 19:4804119-4804141 CCCCCAAGCCTGGAGGCAGGGGG - Intergenic
1161790210 19:6355555-6355577 CACCCCACCCGGGAGGGAGGTGG + Intergenic
1162695080 19:12467912-12467934 CACCCCATCCGGGAGGGAGGTGG + Intronic
1163433444 19:17281935-17281957 CCCGCAACCTGCGAGCCAGGCGG - Exonic
1163663889 19:18594235-18594257 CCCGCAACCAGGTAGGAAGGAGG - Exonic
1163780557 19:19245066-19245088 CGGGCACCCAGGGAGGCAGGAGG + Intronic
1163896465 19:20064476-20064498 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1164046992 19:21551433-21551455 CACCCCATCCGGGAGGGAGGTGG - Intronic
1165540847 19:36491276-36491298 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1166028579 19:40108773-40108795 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1166418026 19:42610498-42610520 CACCCCATCCGGGAGGGAGGTGG - Intronic
1166425728 19:42676480-42676502 CACCCTATCCGGGAGGGAGGCGG - Intronic
1167166977 19:47804968-47804990 CAGGCAGCCCAGGAGCCAGGAGG - Intronic
1167252172 19:48405162-48405184 CAAACAGCCCGGCAGGCAGGGGG - Exonic
1167540915 19:50086603-50086625 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1168096528 19:54118685-54118707 CAAGCAGCCAGGGAGCCAGGGGG - Intronic
1168694338 19:58396258-58396280 CACTCCACCGGGGAGGCGGGGGG - Exonic
928234250 2:29526143-29526165 CAGACAGCCTGGGAGGCAGGGGG + Intronic
928888977 2:36180516-36180538 CACCCCATCCGGGAGGGAGGTGG + Intergenic
929110690 2:38403544-38403566 CACCCCATCCGGGAGGGAGGTGG + Intergenic
930079127 2:47433107-47433129 CACCCCATCCGGGAGGGAGGCGG - Intronic
932410233 2:71543007-71543029 CACCCCATCCGGGAGGGAGGTGG - Intronic
932719006 2:74124195-74124217 CACCCCATCCGGGAGGGAGGTGG + Intergenic
933287222 2:80397626-80397648 CGCACAACCCTGGAGGAAGGTGG - Intronic
935057054 2:99576927-99576949 CAAGCAGCCAGGGAGGTAGGTGG - Intronic
935160793 2:100527844-100527866 CCCGCAACAGGGTAGGCAGGTGG + Intergenic
935862708 2:107350246-107350268 CAAGAAACCTGGGAGACAGGGGG + Intergenic
936084140 2:109455125-109455147 GACCCAACACAGGAGGCAGGAGG - Intronic
936228365 2:110678579-110678601 CGCAGCACCCGGGAGGCAGGTGG + Intergenic
936726022 2:115316983-115317005 CATGCTACTCAGGAGGCAGGAGG + Intronic
937123091 2:119454217-119454239 CCCGGTACCCAGGAGGCAGGCGG + Intronic
937222041 2:120347299-120347321 CAGGCAAGCCGAGAGGCACGGGG - Intronic
937321792 2:120965428-120965450 CACTCCAGCCGGGATGCAGGTGG + Intronic
939477270 2:142702609-142702631 CACCCCATCCGGGAGGGAGGTGG + Intergenic
939578425 2:143921996-143922018 CACCCCATCCGGGAGGGAGGTGG - Intergenic
939578450 2:143922045-143922067 CACCCCATCCGGGAGGGAGGTGG - Intergenic
940336309 2:152531588-152531610 CCAGCTACTCGGGAGGCAGGAGG - Intronic
941095645 2:161237777-161237799 CACGCAACCCGGGGCTGAGGGGG - Intergenic
941786647 2:169505806-169505828 CACCCAGTCCGGGAGGGAGGTGG + Exonic
941852914 2:170201997-170202019 CATGCAACCAGGCAGGCAGGTGG + Intronic
942026433 2:171915014-171915036 CCAGCTACTCGGGAGGCAGGAGG + Intronic
942454751 2:176130100-176130122 CCCGCGACCCGCGAGGGAGGCGG + Exonic
943323467 2:186473097-186473119 CACCCCATCCGGGAGGGAGGTGG + Intergenic
945115086 2:206401276-206401298 CATGCCATCCGGGAGGGAGGTGG - Intergenic
946185640 2:217979010-217979032 CCCGCGGCCGGGGAGGCAGGGGG + Intronic
946334170 2:219026378-219026400 CTCACAACCCGGGAGGAGGGTGG + Intronic
1170415693 20:16137277-16137299 CACGGAAGCCAGGAGGCAGTGGG + Intergenic
1171848445 20:30291757-30291779 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1171861261 20:30405066-30405088 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1171861368 20:30405337-30405359 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1171899820 20:30846983-30847005 CACCCCGCCCGGGAGGGAGGTGG - Intergenic
1171951703 20:31427275-31427297 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1172722842 20:37012767-37012789 CACCCAGTCCGGGAGGGAGGTGG + Intronic
1172728918 20:37069726-37069748 CACCCAGTCCGGGAGGGAGGTGG + Intronic
1173508422 20:43607317-43607339 CACCCAGTCCGGGAGGGAGGTGG - Intronic
1173769584 20:45645962-45645984 CGCCCCACCCGGGAGGGAGGTGG - Intergenic
1175820239 20:61905046-61905068 CACCCATCCCGAGAGGTAGGAGG - Intronic
1175999559 20:62825839-62825861 CACGCTGCCCGGGAGGCCGGCGG - Exonic
1179103370 21:38376572-38376594 CAACCAACTCGGGAGTCAGGTGG - Intergenic
1180630537 22:17226447-17226469 GTTGGAACCCGGGAGGCAGGAGG + Intergenic
1180739259 22:18041605-18041627 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1180861345 22:19084648-19084670 CACCCCATCCGGGAGGGAGGTGG + Intronic
1182199393 22:28553634-28553656 CACCCCATCCGGGAGGGAGGTGG + Intronic
1182583520 22:31329222-31329244 CAAGCAACCCTAGAGGCAGTTGG - Intronic
1183185821 22:36291035-36291057 CACCCCATCCGGGAGGGAGGTGG + Intronic
1183595246 22:38807183-38807205 CACCCCGCCCGGGAGGGAGGTGG + Intergenic
950134790 3:10573435-10573457 CATGCAGTCAGGGAGGCAGGGGG - Intronic
950819537 3:15742585-15742607 CACCCCATCCGGGAGGGAGGTGG + Intronic
952364711 3:32664243-32664265 CACCCCATCCGGGAGGGAGGTGG + Intergenic
953068244 3:39494786-39494808 CACGTAACTCGGGGGGCGGGGGG - Intronic
953257662 3:41306199-41306221 CACCCCGCCCGGGAGGGAGGTGG + Intronic
955674537 3:61434877-61434899 CACCCCATCCGGGAGGGAGGTGG - Intergenic
959586073 3:108026300-108026322 CACCCCATCCGGGAGGGAGGTGG - Intergenic
961120153 3:124366892-124366914 CACCCCATCCGGGAGGGAGGTGG - Intronic
961120230 3:124367070-124367092 CACCCCATCCGGGAGGGAGGTGG - Intronic
961120510 3:124367699-124367721 CACCCCATCCGGGAGGGAGGTGG - Intronic
961163895 3:124750574-124750596 CACCCCATCCGGGAGGGAGGTGG - Intergenic
961552373 3:127676705-127676727 AACCCAACCCGAGAGGCAGCTGG - Intronic
961749265 3:129085948-129085970 CAGGGAAGCCAGGAGGCAGGGGG - Intergenic
961756132 3:129128337-129128359 CAGGGAAGCCAGGAGGCAGGGGG + Intronic
962063265 3:131952549-131952571 CACCCCATCCGGGAGGGAGGTGG + Intronic
967177641 3:186874369-186874391 CACCCCATCCGGGAGGGAGGTGG + Intergenic
967861817 3:194157880-194157902 CTAGCTACTCGGGAGGCAGGAGG + Intergenic
968429827 4:550480-550502 CACCCCATCCGGGAGGGAGGTGG - Intergenic
968570838 4:1339729-1339751 GACACGACCCGCGAGGCAGGCGG - Exonic
968728615 4:2259624-2259646 GACCCCACCCTGGAGGCAGGGGG + Intronic
969354023 4:6614647-6614669 CAGGCAACCTGGGGGTCAGGGGG - Intronic
970216072 4:13761232-13761254 CACCCCATCCGGGAGGGAGGTGG - Intergenic
972412478 4:38807810-38807832 CACCCCATCCGGGAGGGAGGTGG + Intronic
973673148 4:53238508-53238530 CACCCCATCCGGGAGGGAGGTGG - Intronic
977607357 4:98996024-98996046 CAGGGACCCCAGGAGGCAGGAGG - Intronic
979641607 4:123016269-123016291 CACCCCATCCGGGAGGGAGGTGG - Intronic
980895184 4:138854318-138854340 CACCCCATCCGGGAGGGAGGTGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983576897 4:169270589-169270611 CGCGCCATCCGGGAAGCAGGGGG + Intronic
985777717 5:1853586-1853608 GTAGCAACCAGGGAGGCAGGTGG - Intergenic
987267943 5:16276945-16276967 CACCCCATCCGGGAGGGAGGTGG - Intergenic
990458913 5:56014736-56014758 CACGCCGTCCGGGAGGGAGGTGG - Intergenic
992391677 5:76336156-76336178 CACCCCATCCGGGAGGGAGGTGG - Intronic
992600229 5:78391464-78391486 CACCCCATCCGGGAGGGAGGTGG - Intronic
993657852 5:90595897-90595919 CACCCCATCCGGGAGGGAGGTGG - Intronic
995161828 5:108992686-108992708 CACCCCATCCGGGAGGGAGGTGG - Intronic
997608108 5:135191287-135191309 CACGCAGCCAGGGAGGCCTGAGG + Intronic
998021842 5:138777005-138777027 CACCCCATCCGGGAGGGAGGTGG - Intronic
999180939 5:149670158-149670180 CACCCCATCCGGGAGGGAGGTGG - Intergenic
999987027 5:157014351-157014373 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1000032976 5:157419797-157419819 CACCCCATCCGGGAGGGAGGTGG + Intronic
1000159288 5:158582916-158582938 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1001459386 5:171896311-171896333 CAGGCAACTGGGGAGGGAGGGGG + Intronic
1004414980 6:15415876-15415898 CACCCCATCCGGGAGGGAGGTGG - Intronic
1004664234 6:17735625-17735647 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1004892799 6:20117590-20117612 CACCCAACGTGGGTGGCAGGTGG + Intronic
1006492428 6:34397901-34397923 CACCCCATCCGGGAGGGAGGTGG + Intronic
1007180019 6:39923121-39923143 CCCACCACCTGGGAGGCAGGAGG + Intronic
1007743216 6:44025328-44025350 TACGCAGCCTGGGAGGCAGTGGG + Intergenic
1008106302 6:47443988-47444010 CACCCAGTCCGGGAGGGAGGTGG - Intergenic
1008624737 6:53305388-53305410 CACCCCGCCCGGGAGGGAGGTGG - Intronic
1010030301 6:71266146-71266168 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1010270865 6:73914925-73914947 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1011405231 6:87010196-87010218 CACCCCATCCGGGAGGGAGGTGG - Intronic
1013681308 6:112528394-112528416 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1015023099 6:128500888-128500910 CAGCCTACCTGGGAGGCAGGAGG - Intronic
1015718321 6:136214677-136214699 CCTGCAACCCTGGAGGCACGTGG + Intergenic
1016480458 6:144475722-144475744 CCAGCTACCCAGGAGGCAGGAGG - Intronic
1017170387 6:151450337-151450359 CACCCCATCCGGGAGGGAGGTGG + Intronic
1017170408 6:151450383-151450405 CACCCCATCCGGGAGGGAGGTGG + Intronic
1017660643 6:156670328-156670350 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1017843989 6:158240805-158240827 CATGCCATCCGGGAGGGAGGTGG - Intronic
1019669130 7:2268429-2268451 CACCCCATCCGGGAGGGAGGTGG + Intronic
1019951095 7:4373391-4373413 CAAGCTACCCGAGAGACAGGCGG - Intergenic
1020143092 7:5623018-5623040 CAGGCCGCACGGGAGGCAGGGGG + Exonic
1024059912 7:45690055-45690077 CACACAGCCCAGGAGGCAGGTGG + Intronic
1024309858 7:47959630-47959652 CACCCCATCCGGGAGGGAGGTGG + Intronic
1024538708 7:50459765-50459787 CACCCCATCCGGGAGGGAGGTGG + Intronic
1025103417 7:56151835-56151857 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1025189102 7:56883218-56883240 CACGCCAACTTGGAGGCAGGAGG + Intergenic
1025682837 7:63693700-63693722 CACGCCAACTTGGAGGCAGGAGG - Intergenic
1025796029 7:64738904-64738926 CACCCCGCCCGGGAGGGAGGTGG - Intergenic
1025803473 7:64809223-64809245 CGCCCCACCCGGGAGGGAGGTGG - Intronic
1026868240 7:73836061-73836083 CACCCCATCCGGGAGGGAGGTGG + Intronic
1028685567 7:93586147-93586169 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1029250611 7:99233514-99233536 CACGCACCAAGGAAGGCAGGTGG - Intergenic
1031360418 7:120843344-120843366 CAAGCAACGAGGGAGGCAGCAGG - Intronic
1032042954 7:128577148-128577170 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1032374958 7:131404427-131404449 CAGGCTACTCAGGAGGCAGGAGG - Intronic
1034234010 7:149554398-149554420 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1034445325 7:151111128-151111150 CACTGAGCCCGGGAGGCAGTGGG - Intronic
1034471609 7:151257696-151257718 GGAGCAACCCGGGAGGCAAGAGG - Intronic
1035355897 7:158276078-158276100 GACGCACCCCTGGAGGCAGCTGG - Intronic
1037803639 8:22048243-22048265 CACGTAGTCTGGGAGGCAGGGGG + Exonic
1039153229 8:34528974-34528996 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1040121189 8:43687512-43687534 CACCCCACCTGGGAGGGAGGTGG - Intergenic
1040785628 8:51159540-51159562 CACCCCATCCGGGAGGGAGGCGG + Intergenic
1041796630 8:61753190-61753212 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1042048960 8:64685753-64685775 CACCCCATCCGGGAGGGAGGTGG + Intronic
1042837291 8:73090430-73090452 CTCTGAGCCCGGGAGGCAGGCGG + Intronic
1042907702 8:73789381-73789403 TCAGCTACCCGGGAGGCAGGAGG + Intronic
1044973753 8:97644270-97644292 CAGGAGACCCGGGAGGCGGGAGG - Exonic
1045248886 8:100466848-100466870 CAGGCTACTCGGAAGGCAGGAGG - Intergenic
1045298545 8:100892364-100892386 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1049057945 8:140254002-140254024 CAGGCAACACGGGAGGAAGGGGG + Intronic
1049727878 8:144158851-144158873 CCAGCTACTCGGGAGGCAGGAGG - Intronic
1051334635 9:16054901-16054923 CACGCAGGGCGGGGGGCAGGTGG + Intronic
1054359755 9:64101233-64101255 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1055242176 9:74197854-74197876 CACCCCATCCGGGAGGTAGGTGG + Intergenic
1055586645 9:77762404-77762426 CACCCCATCCGGGAGGGAGGTGG + Intronic
1055638347 9:78298711-78298733 CATGTAACCTGGGGGGCAGGAGG + Intronic
1056330523 9:85517383-85517405 GAGGCAACAAGGGAGGCAGGAGG + Intergenic
1056409616 9:86312468-86312490 CACCCCATCCGGGAGGGAGGTGG + Intronic
1057477835 9:95419041-95419063 CACGCAGCCAAGGAAGCAGGAGG + Intergenic
1057958563 9:99432999-99433021 CACCCAACCCAGGAGCCAGCAGG + Intergenic
1058659927 9:107257615-107257637 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1059118109 9:111617483-111617505 CACCCCGCCCGGGAGGGAGGTGG - Intergenic
1059335305 9:113565171-113565193 CATGTAACCCGGGAGCCAGCTGG + Intronic
1059879885 9:118678114-118678136 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1060188953 9:121580245-121580267 CACGCACCCAGGGAAGCATGAGG + Intronic
1060703654 9:125780249-125780271 CACCCCATCCGGGAGGGAGGTGG - Intronic
1061056243 9:128224468-128224490 CATGCTACCGAGGAGGCAGGGGG - Intronic
1061427139 9:130506582-130506604 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1062448401 9:136605245-136605267 AGAACAACCCGGGAGGCAGGAGG - Intergenic
1185673637 X:1831183-1831205 CCAGCTACCCTGGAGGCAGGAGG + Intergenic
1186786907 X:12963455-12963477 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1188477145 X:30602430-30602452 CATGCCATCCGGGAGGGAGGTGG + Intergenic
1189210284 X:39277869-39277891 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1189646786 X:43141919-43141941 CACTCAGCCTGGTAGGCAGGAGG - Intergenic
1190505180 X:51119472-51119494 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1190737149 X:53263183-53263205 GAAGCAACCCGGGAGGAAGCAGG + Intronic
1191009904 X:55748717-55748739 CACCCCATCCGGGAGGGAGGTGG + Intronic
1191068918 X:56380157-56380179 CACCCCACCCAGGAGGGAGGTGG - Intergenic
1192204174 X:69085368-69085390 TGCCCAACCCTGGAGGCAGGAGG + Intergenic
1192739953 X:73882535-73882557 CGCCCAATCCGGGAGGGAGGTGG + Intergenic
1193132392 X:77932052-77932074 CACCCCATCCGGGAGGGAGGTGG - Intronic
1193164615 X:78265627-78265649 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1194611572 X:96051151-96051173 CACCCAGTCCGGGAGGGAGGTGG - Intergenic
1194669504 X:96713281-96713303 CACACAATCCTTGAGGCAGGAGG - Intronic
1195316893 X:103687860-103687882 CACGCAACCTTGAAGGGAGGGGG - Intronic
1197735943 X:129850630-129850652 CACCCCATCCGGGAGGGAGGTGG + Intergenic
1198476548 X:137000815-137000837 CACCCCATCCGGGAGGGAGGTGG - Intergenic
1200098119 X:153673623-153673645 CACGCAGCTCGGGACGCGGGCGG - Intronic
1200878108 Y:8180792-8180814 CTTGCAACCCAGGAGGCAGTGGG - Intergenic
1201335792 Y:12878861-12878883 CACCCACTCCGGGAGGGAGGTGG + Intergenic
1202190015 Y:22231904-22231926 CTTGCAACCCAGGAGGCAGTAGG - Intergenic
1202239290 Y:22750095-22750117 CCGGCTACTCGGGAGGCAGGAGG + Intergenic
1202392277 Y:24383857-24383879 CCGGCTACTCGGGAGGCAGGAGG + Intergenic
1202478507 Y:25286260-25286282 CCGGCTACTCGGGAGGCAGGAGG - Intergenic