ID: 1143100782

View in Genome Browser
Species Human (GRCh38)
Location 17:4503604-4503626
Sequence GCCCTGGCCTTGTTTATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143100770_1143100782 7 Left 1143100770 17:4503574-4503596 CCTGGAACCAGGCCCCACAAGAG 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG 0: 1
1: 1
2: 2
3: 29
4: 158
1143100774_1143100782 0 Left 1143100774 17:4503581-4503603 CCAGGCCCCACAAGAGGGAGGTG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG 0: 1
1: 1
2: 2
3: 29
4: 158
1143100778_1143100782 -7 Left 1143100778 17:4503588-4503610 CCACAAGAGGGAGGTGGCCCTGG 0: 1
1: 1
2: 5
3: 55
4: 310
Right 1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG 0: 1
1: 1
2: 2
3: 29
4: 158
1143100776_1143100782 -5 Left 1143100776 17:4503586-4503608 CCCCACAAGAGGGAGGTGGCCCT 0: 1
1: 0
2: 0
3: 23
4: 143
Right 1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG 0: 1
1: 1
2: 2
3: 29
4: 158
1143100777_1143100782 -6 Left 1143100777 17:4503587-4503609 CCCACAAGAGGGAGGTGGCCCTG 0: 1
1: 0
2: 2
3: 21
4: 214
Right 1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG 0: 1
1: 1
2: 2
3: 29
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143100782 Original CRISPR GCCCTGGCCTTGTTTATGGG TGG Intronic
901033946 1:6325002-6325024 GCCCAGGCCGTGCTTTTGGGAGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902129027 1:14242554-14242576 TCCCTGGCCTTATATTTGGGTGG + Intergenic
904489941 1:30852343-30852365 GCCCTGGGCAGGGTTATGGGAGG + Intergenic
904617530 1:31758008-31758030 GCCCTGGCCTGGTGGGTGGGAGG - Intronic
910244250 1:85121898-85121920 ACCCTGGTCTTGCTAATGGGAGG + Intronic
912300939 1:108516407-108516429 GTCCTGGCCTTTTTTTTGGTTGG + Intergenic
916272755 1:162961558-162961580 GGCATGTCCTTTTTTATGGGGGG - Intergenic
916958007 1:169860389-169860411 ACCCTGGCCTTGTGTCTGGCTGG - Intronic
919208911 1:194454516-194454538 GCCCTGGCCATCTCTATGGCTGG - Intergenic
920415924 1:205799384-205799406 GCCCAGGCCTTGACTCTGGGTGG - Intronic
921960428 1:221028069-221028091 CTCCTGGCCTTGTTGCTGGGAGG + Intergenic
1065839229 10:29687123-29687145 GGCATGTCCTTGTTTATGGGAGG - Intronic
1067341591 10:45409953-45409975 GCCCTGCCCTGGTCTATGGAGGG - Intronic
1067575116 10:47404034-47404056 GCTCTGGCCTTCTCTATGGGAGG + Intergenic
1070093887 10:73317315-73317337 GCCCTGCCTTTGTTTTTGGTTGG + Intronic
1070757999 10:79005428-79005450 GCCCTGGCCTCGATTCTGAGGGG + Intergenic
1071900227 10:90112906-90112928 GAACTGGCCTTATTTAAGGGAGG - Intergenic
1075793424 10:125102262-125102284 GTCCTGGCCTTGGTGATGGCAGG - Intronic
1076012803 10:127003959-127003981 TACCTGGCCTTTTTTTTGGGGGG - Intronic
1077753926 11:5005125-5005147 AGCGTGTCCTTGTTTATGGGAGG - Intergenic
1079651594 11:22936094-22936116 GCCCTGGCCCTGTTTTTAGAGGG - Intergenic
1079657475 11:23000786-23000808 GCAATGTCCTTGTTTAGGGGAGG - Intergenic
1081691663 11:45082500-45082522 TCTATGGGCTTGTTTATGGGTGG - Intergenic
1083488315 11:62997067-62997089 GCCCTTGCCATGGTTTTGGGAGG - Intronic
1084102606 11:66959585-66959607 GACCTGTCCTTGTTTATGGGAGG + Intergenic
1084754218 11:71224547-71224569 GCCCTGTGCTTGTGTTTGGGTGG - Intronic
1089067017 11:115669938-115669960 GCCCTGGACTTGTTTCTAGCTGG + Intergenic
1089635013 11:119806407-119806429 GGCCTGACCTAGTTTAGGGGTGG + Intergenic
1090079707 11:123603716-123603738 GGCCTGGCCATCTTTATGGTTGG + Intronic
1090089645 11:123683743-123683765 GCCTTGGGCTTGGTTAAGGGAGG + Intergenic
1091246918 11:134104871-134104893 GCCCTGGGCTTTTTTTTGGTTGG - Intronic
1092710970 12:11337034-11337056 GCCCTGGACTTCTTTCTGGTTGG + Intergenic
1093667791 12:21834965-21834987 ACCAATGCCTTGTTTATGGGAGG - Intronic
1094572716 12:31655412-31655434 GACATGTCCTTGTTTATGGGAGG - Intronic
1094875959 12:34643029-34643051 GTCCTGGCCTTTTTTTTGGCTGG - Intergenic
1098436031 12:70468771-70468793 GGCCTGGCCTAGTAAATGGGGGG - Intergenic
1099860172 12:88216644-88216666 GCCCTGGGCTTTTTTTTTGGTGG - Intergenic
1104916705 12:132269259-132269281 GCTCTGGGCTTGGTGATGGGAGG + Intronic
1105025749 12:132847744-132847766 GCCCTGGTCTTGCTAAAGGGCGG + Intronic
1105568158 13:21572594-21572616 GGCATGTCCTTGTTTATGGGAGG + Intronic
1107091989 13:36491651-36491673 GCCCTGCCCTTGTCTATGGAAGG - Intergenic
1111341866 13:86897387-86897409 GTCCTGGCCTTTTTTTTGGTTGG - Intergenic
1114182686 14:20379176-20379198 GCCTTGGCCTTCTTTTTGGGTGG - Intronic
1117614883 14:57524097-57524119 GTCCTGGACTTTTTTTTGGGTGG + Intergenic
1118852523 14:69594975-69594997 GACCTGGGCTTGTTCTTGGGCGG + Intergenic
1119031777 14:71198281-71198303 GGCATGTCCTTATTTATGGGAGG - Intergenic
1119619961 14:76124663-76124685 GCCCAGGCCTGGCTTCTGGGTGG - Intergenic
1120058783 14:79957068-79957090 GCCCTGGGCTTTTTTTTGGTTGG - Intergenic
1123947250 15:25244772-25244794 GGCCTGGCTTTGTGTGTGGGAGG + Intergenic
1124002596 15:25771250-25771272 GGCATGTCCTTGTTTATGGGTGG - Intronic
1124631228 15:31338752-31338774 GCCCTGGCCGGGTTAATGGATGG + Intronic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1125928672 15:43584214-43584236 GCCCTATCCTAGTTTAGGGGAGG - Intronic
1125941838 15:43684049-43684071 GCCCTATCCTAGTTTAGGGGAGG - Intergenic
1126444141 15:48723071-48723093 GACATGTCCTTGTTTATAGGAGG + Intronic
1127807354 15:62533653-62533675 CTCCTGGCATTTTTTATGGGGGG - Intronic
1129071402 15:72954300-72954322 TCCCTGTCCTTGTACATGGGAGG - Intergenic
1129513077 15:76139188-76139210 TCCCTGGGCTTGTTTCTGGAAGG + Intronic
1129564913 15:76611443-76611465 GTCCTGGGCTTTTTTTTGGGTGG - Intronic
1132546194 16:534479-534501 GCCCTGGCCTTGTTTCTTGTAGG + Intronic
1132678083 16:1128933-1128955 GCCCTGGCCTGGCTCATCGGGGG + Intergenic
1132867968 16:2103214-2103236 CCCCTGGCCTTGTTCTTGGGGGG - Intronic
1133055311 16:3142868-3142890 GCCCTGGCCTTGTGTCCTGGTGG + Intergenic
1133995642 16:10745953-10745975 GGCATGTCCTTGTTTATGGGAGG + Intronic
1134523800 16:14929900-14929922 CCCCTGGCCTTGTTCTTGGGGGG + Intronic
1134549103 16:15131035-15131057 CCCCTGGCCTTGTTCTTGGGGGG - Intronic
1134711391 16:16328385-16328407 CCCCTGGCCTTGTTCTTGGGGGG + Intergenic
1134719242 16:16371688-16371710 CCCCTGGCCTTGTTCTTGGGGGG + Intergenic
1134948184 16:18340197-18340219 CCCCTGGCCTTGTTCTTGGGGGG - Intergenic
1134955438 16:18380308-18380330 CCCCTGGCCTTGTTCTTGGGGGG - Intergenic
1137825327 16:51489748-51489770 GCCCAGGCCTTGCTCCTGGGAGG + Intergenic
1140108848 16:71985866-71985888 GCCTTGTCCATGTTTTTGGGAGG + Intronic
1140208679 16:72953968-72953990 GCCCTGGGCTTGTTTCTCTGAGG - Intronic
1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG + Intronic
1144614478 17:16756819-16756841 GCTCTGGCATTGATGATGGGTGG + Intronic
1144898226 17:18558855-18558877 GCTCTGGCATTGATGATGGGTGG - Intergenic
1145134143 17:20386860-20386882 GCTCTGGCATTGATGATGGGTGG + Intergenic
1146663863 17:34683612-34683634 GCCCAGGCCTTGTGGCTGGGTGG - Intergenic
1147610760 17:41800795-41800817 GCCCAGCCCCTGTTTCTGGGAGG - Intergenic
1151400239 17:73851125-73851147 AGCCTGGCCTTGTTTGTGGCAGG - Intergenic
1153148163 18:2057140-2057162 GGCATGTCCTTGTTTATGGGAGG + Intergenic
1153220628 18:2857770-2857792 GCTCTGGCCTGGTTTATGTCAGG + Intronic
1155342515 18:24826978-24827000 GCACTGGCCTAGTTGCTGGGAGG - Intergenic
1163153284 19:15427287-15427309 GCCCTGGCCAAGATGATGGGCGG - Exonic
1163154752 19:15433560-15433582 GCCCTGGCCTTGTCCTTGGGAGG - Intronic
1163822931 19:19506447-19506469 ACCCTGGCCTTGCTCCTGGGAGG + Exonic
1164670624 19:30070191-30070213 GCCCGGGCCTTGTTTATTTTTGG + Intergenic
1167538499 19:50070736-50070758 GGCCTGGCCTGGTCTCTGGGTGG + Intergenic
926852250 2:17212061-17212083 GTCCTGGGCTTTTTTATTGGAGG + Intergenic
930413624 2:51060700-51060722 GTCCTGGCCTTGTTTTTGGTTGG - Intergenic
931323049 2:61191150-61191172 ACCCTTGCAGTGTTTATGGGGGG - Exonic
932159987 2:69450928-69450950 GGCATGTCCTTGTTTATGGGAGG - Intergenic
933587882 2:84199972-84199994 GCCCTGTTGTTGTTTAGGGGAGG + Intergenic
934152912 2:89165905-89165927 GCCCTGGACTTTTTTTTGGTTGG + Intergenic
934214327 2:90016026-90016048 GCCCTGGACTTTTTTTTGGTTGG - Intergenic
935240287 2:101171941-101171963 GCACTGTGCTTGTTGATGGGAGG - Intronic
935261552 2:101359908-101359930 GGCATGTCCTTGTTTATGGGAGG - Intronic
937480604 2:122254494-122254516 GTTCTGGCTTTGTTTTTGGGCGG - Intergenic
941089674 2:161160333-161160355 GCCCTGGCCTTGTTGGGTGGAGG + Exonic
947449936 2:230198412-230198434 ACCCTGCCCATGTTTATGGTGGG - Intronic
948576154 2:238950872-238950894 GCCCTGGCCTGGCATCTGGGAGG - Intergenic
1168961928 20:1875973-1875995 GTGCTGGCCTTGTTCATGGCTGG - Intergenic
1169141686 20:3230354-3230376 GCCCTGGCCTTCTTCCTGGCAGG - Intronic
1171317784 20:24210695-24210717 GGCATGACCTTGCTTATGGGAGG + Intergenic
1171437626 20:25135491-25135513 GGAGTGGCCTGGTTTATGGGAGG - Intergenic
1172167538 20:32908177-32908199 GCCCTGGCCTTGTTCGCCGGAGG + Intronic
1172619185 20:36307993-36308015 GCCCTGGCCTGGCCGATGGGTGG + Intronic
1173395676 20:42677442-42677464 GCCCTGGCCGTGTTTCTCTGAGG - Intronic
1174844054 20:53926494-53926516 TCCCTGGCCTCTTTTATGAGAGG - Intergenic
1174851175 20:53996699-53996721 GCCCTGGCCTTGTCTCTGGTTGG + Intronic
1175740644 20:61417567-61417589 TCCCTGGCCCTGTTTCTGGCTGG + Intronic
1179566422 21:42251813-42251835 GCACTGGCCTTGGGCATGGGAGG + Intronic
1179616234 21:42585115-42585137 GGCATGTCCTTGTTTATGGGAGG + Intergenic
1180074949 21:45457519-45457541 GGCCTGGCCTTGTTGCTGGCTGG + Intronic
1182801535 22:33035525-33035547 GGCACGTCCTTGTTTATGGGAGG - Intronic
1184922467 22:47615170-47615192 GCCCAGGCCTAGTGTATTGGAGG + Intergenic
1184936310 22:47725001-47725023 AGCATGTCCTTGTTTATGGGAGG + Intergenic
1185338905 22:50282994-50283016 GCCCTGGCCCTGGGTATGGAGGG - Intronic
949591330 3:5497141-5497163 TCCCTGGCCTTGTTTATGGGTGG - Intergenic
950720293 3:14877589-14877611 CCCATGGCCTTGTTTGGGGGAGG + Intronic
951697190 3:25457432-25457454 GCCCTGGCCTTTTATTTAGGTGG - Intronic
955794145 3:62618038-62618060 GCCATGGACTGGTTCATGGGTGG + Intronic
959422621 3:106147822-106147844 GCCCTGGGCTTTTTTTTGGTTGG + Intergenic
960785759 3:121371755-121371777 GCCCTGGCCTTGGCACTGGGCGG - Intronic
961861366 3:129919075-129919097 GCCCTGCCCTTGTGCATGGCCGG + Intergenic
962696624 3:137954353-137954375 GCCCTGGGCTTTTTTTTGGTAGG + Intergenic
967106097 3:186256146-186256168 GCTCTGGAGTTGTTTGTGGGAGG - Intronic
970210119 4:13700991-13701013 GCCCTGGGCTTTTTTTTGGTTGG + Intergenic
972377561 4:38486949-38486971 GCCATGACCTTGTTTAGGGCTGG - Intergenic
974363805 4:60918697-60918719 GCCCTGGACTTTTTTTTGGTTGG - Intergenic
975056015 4:69929775-69929797 GTCCTGGCCTTTTTTTTGGTTGG + Intergenic
980330089 4:131400238-131400260 GTCCTGGGCTTGTTTTTGGTTGG + Intergenic
980801757 4:137760410-137760432 GTGATGGTCTTGTTTATGGGGGG - Intergenic
981422722 4:144569971-144569993 GTCAAGTCCTTGTTTATGGGAGG - Intergenic
982868438 4:160546456-160546478 GGCATGTCCTTGTTTATGAGAGG - Intergenic
986253904 5:6085758-6085780 GGCATGTCCTTGTTTATTGGAGG - Intergenic
986307283 5:6525085-6525107 GCGCTGGCCTGGTTGCTGGGAGG + Intergenic
986578188 5:9234443-9234465 GCACTGGGCTGGTTCATGGGTGG - Intronic
989387852 5:40871231-40871253 GGCGTTTCCTTGTTTATGGGAGG + Intergenic
993242818 5:85412987-85413009 GCCCTGGACTTTTTTTTGGTTGG + Intergenic
995582238 5:113614307-113614329 GGCATGTCCTTGTTTATGGGAGG + Intergenic
996826415 5:127686760-127686782 GCCTTGTCCTTGAATATGGGTGG - Intergenic
997680062 5:135743853-135743875 AACATGTCCTTGTTTATGGGAGG - Intergenic
998744034 5:145236494-145236516 GGCATGTCCTTGTTTATGGGAGG - Intergenic
998800446 5:145863969-145863991 GGCCTGGCCATGTTTATGCTGGG - Intronic
999878884 5:155839323-155839345 GGCATGTCCTTGTTTATGGGAGG + Intergenic
999982218 5:156968442-156968464 GCCCTGGTTCTTTTTATGGGAGG - Intergenic
1001315988 5:170641634-170641656 GCCCTAGCCTTGGTTGGGGGAGG + Intronic
1003301097 6:4883515-4883537 GCCATGGCCATGAGTATGGGTGG - Intronic
1004073879 6:12327681-12327703 GGCATGACCTTGTTTATGGGAGG - Intergenic
1005106577 6:22230206-22230228 GCCAGGGCCTGGTTTAAGGGTGG - Intergenic
1007640368 6:43334250-43334272 CCCCTGGCCTTGCAAATGGGGGG - Intronic
1011917574 6:92527040-92527062 GCATTGGCTTTGGTTATGGGTGG - Intergenic
1015131053 6:129809647-129809669 GTCCTGGACTTTTTTTTGGGTGG + Intergenic
1015918321 6:138241150-138241172 GGCATGTCCTTGTTTACGGGAGG - Intronic
1016498833 6:144694515-144694537 GTCCTGGGCTTTTTTTTGGGTGG + Intronic
1018381779 6:163264562-163264584 GCCCAGATCTTGTTTCTGGGCGG - Intronic
1020363310 7:7353136-7353158 GGCATGTCCTTGTTTGTGGGAGG - Intergenic
1024667912 7:51564459-51564481 GGCATGTCCTTGCTTATGGGAGG + Intergenic
1028218019 7:88159271-88159293 GTCCTGGCCTTTTTTTTGGTTGG - Intronic
1028627637 7:92895347-92895369 GTCCTGGGCTTGTTTTTGGTTGG + Intergenic
1028676914 7:93475651-93475673 GCTATGGCCTTGTTCATGAGTGG - Intronic
1034309154 7:150071733-150071755 ACTCTGGCCTTACTTATGGGAGG - Intergenic
1034797701 7:154028903-154028925 ACTCTGGCCTTACTTATGGGAGG + Intronic
1035650272 8:1258696-1258718 GAGCTGGCTTTGTTTATGGAAGG + Intergenic
1037401137 8:18496418-18496440 GGCCTGGCCTTGTTCATATGGGG - Intergenic
1037802037 8:22041159-22041181 GCCCTGGCCTTGCTTACCTGGGG - Intergenic
1041122081 8:54596650-54596672 GCTCTGTCCTTGTTTAAGTGGGG - Intergenic
1041629273 8:60066677-60066699 GGTCTGGCATTGTTTATGGGGGG - Intergenic
1046030281 8:108775220-108775242 GCCCTGTCCTTCTTTCTGGAAGG + Intronic
1046869655 8:119191026-119191048 GCCCTGGCATGGTGAATGGGTGG - Intronic
1047308948 8:123676350-123676372 CCCCTTGCCTAGTGTATGGGTGG + Intergenic
1049871973 8:144986879-144986901 GCCCTGGGCTTTTTTTTGGTTGG + Intergenic
1053023177 9:34709565-34709587 GCCCTGGGCTGGTTTCTGTGGGG + Exonic
1055412302 9:76043564-76043586 GTGCTGGCCTTGCTTATAGGAGG + Intronic
1056672074 9:88638880-88638902 GGCATGTCCTTGTTTATGGGAGG - Intergenic
1060510461 9:124228564-124228586 GCCCTGGCCTTGGGCATGGCAGG + Intergenic
1060805087 9:126570328-126570350 ACCCTGGCCTAGTTTATAGCTGG - Intergenic
1060866989 9:127008358-127008380 CCCCTGGCCCTGTCTGTGGGAGG + Intronic
1061729779 9:132604838-132604860 GCTCTGGCCTTGTCTAGGTGGGG + Intronic
1062611272 9:137374782-137374804 GCTCAGGCTTTGTTTAAGGGCGG - Intronic
1062718891 9:138024449-138024471 GCCCTGTCTTTGTGTGTGGGTGG + Intronic
1185566585 X:1099665-1099687 GCCCTGGCCTGGGTTCAGGGAGG + Intergenic
1185917249 X:4049038-4049060 GCCATGTCCTTGTTTATGGGAGG + Intergenic
1187708777 X:22033069-22033091 GCCCTGGTCGTGTTTGTCGGTGG + Exonic
1189293500 X:39902447-39902469 TCCCTCCCCTTGGTTATGGGTGG - Intergenic
1190317205 X:49158725-49158747 GACCTGACCTTGTCTAAGGGGGG + Intergenic
1191788370 X:64942017-64942039 GCCCTGGACTTTTTTTTGGTTGG + Intronic
1191874248 X:65778854-65778876 GTCCTGGCCTTTTTTTTGGTTGG - Intergenic
1201617140 Y:15913175-15913197 GGCATGTCCTTGTTTCTGGGAGG - Intergenic