ID: 1143100992

View in Genome Browser
Species Human (GRCh38)
Location 17:4504652-4504674
Sequence CCTGAAATCTTGAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143100980_1143100992 27 Left 1143100980 17:4504602-4504624 CCCCAGAACCTTCTGCAATAGGA 0: 1
1: 1
2: 0
3: 14
4: 172
Right 1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 190
1143100984_1143100992 19 Left 1143100984 17:4504610-4504632 CCTTCTGCAATAGGAAGTGGCTT 0: 1
1: 1
2: 4
3: 5
4: 155
Right 1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 190
1143100982_1143100992 25 Left 1143100982 17:4504604-4504626 CCAGAACCTTCTGCAATAGGAAG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 190
1143100981_1143100992 26 Left 1143100981 17:4504603-4504625 CCCAGAACCTTCTGCAATAGGAA 0: 1
1: 0
2: 1
3: 12
4: 188
Right 1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143100992 Original CRISPR CCTGAAATCTTGAAGGTAGA AGG Intronic
905609441 1:39337383-39337405 CTTGAAATCTTCAAGGAAGATGG - Intronic
905799387 1:40833616-40833638 CCAGAAAACTTGGAGGTTGAGGG - Intronic
907615817 1:55925688-55925710 CCTGAAATGTTGGGGATAGAGGG - Intergenic
909815469 1:79986961-79986983 CCTTAAATTATGAAGCTAGAGGG - Intergenic
909888033 1:80966882-80966904 CCTGGAATCATGAGGGGAGAAGG + Intergenic
910803876 1:91171421-91171443 CCTAAGGTTTTGAAGGTAGAAGG + Intergenic
912618834 1:111134982-111135004 CCTGAAAACTTGAAACTGGAGGG - Intronic
917188696 1:172390513-172390535 ACTGAAATCTAGAGGGTAGAGGG - Intronic
918062955 1:181077986-181078008 TGTGAGATCTTGAAGGCAGAGGG - Intergenic
918132316 1:181640260-181640282 CCTGAAGGCCTGAAGGTACATGG - Intronic
921668573 1:217901720-217901742 CCTGAAATCATGAAGCTAAAGGG - Intergenic
923198323 1:231688940-231688962 TCTGAATTATTGAAGGAAGATGG + Intronic
923463490 1:234227755-234227777 CCTGAAATTTTGGAGGTGGGGGG + Intronic
924728215 1:246689656-246689678 ACTGAAATCTTGCCAGTAGAGGG + Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063742278 10:8837137-8837159 ACTGAAACCATGATGGTAGATGG - Intergenic
1065572813 10:27089282-27089304 CCTGAAAAATTCAAGGCAGAGGG + Intronic
1065867871 10:29929221-29929243 CCTGAAAGCTTGAAGGGATGAGG - Intergenic
1067674042 10:48354450-48354472 CCTGCAATCTTGAAGGATGGTGG - Intronic
1068291638 10:55009434-55009456 CCTAAAATGTTGGTGGTAGATGG - Intronic
1071777478 10:88805312-88805334 CCTGAAATCTGAAAGATAAATGG + Intronic
1073305250 10:102498161-102498183 CCTTAAAACATGAAGGTGGATGG + Intronic
1073504260 10:103969904-103969926 CCTAGAATCTTGTAGTTAGAAGG + Intronic
1074656388 10:115593046-115593068 CCTGAAAAGTTCAAGGTTGAGGG + Intronic
1079083580 11:17430197-17430219 AATGAAAGCCTGAAGGTAGAAGG - Intronic
1080197960 11:29633692-29633714 AATGAAATTTTGAAAGTAGAAGG + Intergenic
1080385335 11:31807493-31807515 CCAGAAAGCTGGGAGGTAGATGG - Intronic
1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG + Intronic
1084335817 11:68457296-68457318 CCTGAAATCTAGAAGTTTTAGGG + Intergenic
1084600208 11:70141070-70141092 GCTGAAACCTTGGAGGCAGATGG - Intronic
1086373943 11:86181578-86181600 CCTGGCATGTTGAAGGAAGATGG + Intergenic
1086486783 11:87312948-87312970 ACAGAAATGTTAAAGGTAGAAGG - Intronic
1086923104 11:92610579-92610601 ACTGAGATTTTGAAGGTAAAAGG - Intronic
1087453251 11:98352267-98352289 CCTGAAAGATTGGAGGTAGGTGG - Intergenic
1087660247 11:100979245-100979267 GCTGAAATCTTCACAGTAGAAGG + Intronic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1091144985 11:133271403-133271425 ACTGAAAACATGAAGGTAGATGG + Intronic
1092080702 12:5713723-5713745 CTTGAAATCTGGAAGGTGGTTGG - Intronic
1092907795 12:13117781-13117803 CCTGCAATCTAGAGGGCAGAAGG - Intronic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1093475147 12:19546785-19546807 TCTGAAAGCTTGAATGAAGAAGG + Intronic
1093576323 12:20734449-20734471 CCAGAAATCCTCACGGTAGAGGG + Intronic
1095929305 12:47609746-47609768 CCTGAAACCTGGAAGGAGGAAGG + Intergenic
1097684323 12:62677467-62677489 CCTGAAAGCTTGGAGGTACCAGG - Intronic
1098348248 12:69528898-69528920 CCTGAGATCCTGAAGTGAGAAGG + Intronic
1102003807 12:109575771-109575793 TCTGAAATTTTGCAGGCAGAAGG + Intronic
1102062049 12:109940065-109940087 CATGAAATATTGGAGGTAGCAGG - Intronic
1104115147 12:125742640-125742662 CCTGAATTCTTGCAGTTAGGTGG + Intergenic
1105967493 13:25397918-25397940 CCTGAATTGTTGAAGGCAGCGGG + Intronic
1109985428 13:69977532-69977554 TCTGTAATCTTAAAAGTAGAGGG + Intronic
1111020751 13:82446470-82446492 CCTGAAGGCTTGATTGTAGAAGG + Intergenic
1113004901 13:105689686-105689708 CCAGAAGTCTGTAAGGTAGATGG - Intergenic
1113196970 13:107819143-107819165 CCTGATGTCTTGAAGATAGTAGG + Intronic
1114549726 14:23525823-23525845 CTTGAGATCGTGGAGGTAGAAGG + Exonic
1116320220 14:43453495-43453517 AATGAAATGTTAAAGGTAGATGG - Intergenic
1116717856 14:48450150-48450172 CCAGAAGTCTTCAAGGCAGAAGG - Intergenic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1118815111 14:69306718-69306740 ACTGAAATCTTCTGGGTAGATGG + Intronic
1118890163 14:69902469-69902491 CCTGGACTCTTGAAGGTGGTGGG + Intronic
1120759143 14:88270541-88270563 CCTGAAATTTTGAAGACAGCAGG - Intronic
1125475879 15:40047745-40047767 CCTGAATGCTTGCAGGTGGACGG - Intergenic
1126155945 15:45565807-45565829 TCTCAAATCTTGAAGTCAGATGG + Intergenic
1127291878 15:57578707-57578729 CCTGAAATCTAAACGGGAGAGGG + Intergenic
1128150141 15:65357998-65358020 CCTAGAATCCTGAAGGTGGAGGG - Intronic
1138915361 16:61456704-61456726 TCTGAAATCTGGAAGGAAAATGG - Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1140384921 16:74527644-74527666 CCTAAATTCTTGAAGGTAAAAGG - Intronic
1140860167 16:79011328-79011350 CATGAAAATTTGAATGTAGAGGG - Intronic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1142909012 17:3071451-3071473 GCTGAAATCCTGAATGTGGAAGG + Intergenic
1142925550 17:3232791-3232813 GCTGAAATCCTGAATGTGGAAGG - Intergenic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1146632522 17:34481095-34481117 CCTGTTATCTTCAAGGTTGATGG - Intergenic
1147513591 17:41095340-41095362 CCTGAAATCACTAAGGTAAAGGG + Intronic
1147515695 17:41115630-41115652 CCTGAAATCACTAAGGTAAAGGG + Intergenic
1147933753 17:43999355-43999377 CCAGGAATTTTGAAGGTAAAAGG + Intronic
1151523797 17:74649852-74649874 CTTGAAATCTTGGAGGTGAAAGG - Intergenic
1155412101 18:25557744-25557766 TCTGAAATAGTGGAGGTAGAGGG + Intergenic
1156329593 18:36107211-36107233 ACAGAAATTCTGAAGGTAGAAGG - Intergenic
1156639840 18:39079171-39079193 AAGAAAATCTTGAAGGTAGATGG + Intergenic
1158762857 18:60411108-60411130 CCTGGAATATTGAAGGGAGAAGG + Intergenic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1167438023 19:49491122-49491144 CCTGAAATCTCCCAAGTAGATGG - Intronic
1167693602 19:51001745-51001767 CGTGAAATCTTGAGGGAGGAGGG + Intronic
925451690 2:3974538-3974560 CCTGTCATCTTGCAGGTAGGTGG + Intergenic
925932769 2:8723331-8723353 CCTGAAACCTTGGAGGTCGGTGG + Intergenic
926546146 2:14242737-14242759 CCTGAAGTTTGGAAGGCAGAGGG + Intergenic
926853254 2:17224202-17224224 ATTGAACTCATGAAGGTAGAAGG - Intergenic
927919323 2:26960050-26960072 CCTGAAAGCATGAATGTAGTGGG - Intergenic
928456373 2:31426425-31426447 CCTGAAACATGGAAGGAAGATGG + Intergenic
929419726 2:41778370-41778392 TTTGAAATCTTAAAAGTAGATGG + Intergenic
929798090 2:45075560-45075582 CCAGACATCTTGAAAGCAGAGGG - Intergenic
929988320 2:46760042-46760064 CCTGTAACATTGAGGGTAGAGGG - Exonic
932150236 2:69364252-69364274 ACTGAAATATTGAAGGCAAATGG + Intronic
932426385 2:71638015-71638037 CCTGGAACTTTGAAGGAAGAGGG + Intronic
932839968 2:75072820-75072842 CCTCAAATCTTCAAGGTCTATGG + Intronic
933934023 2:87186005-87186027 CTTGGAATCTTGAAGGTAACAGG - Intergenic
935130541 2:100257933-100257955 CCTGGCATCTGGAAGGTGGAGGG - Intergenic
935496100 2:103783330-103783352 CCTAGAATCCTGAAGGCAGAGGG + Intergenic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
936359120 2:111779890-111779912 CTTGGAATCTTGAAGGTAACAGG + Intronic
938104422 2:128520412-128520434 CCTGAAATCTCGACAGAAGAAGG + Intergenic
940608752 2:155963541-155963563 ATAGAAATCATGAAGGTAGAAGG + Intergenic
940687839 2:156876293-156876315 CCTGAAATGTGGAAGCTATAGGG + Intergenic
940734318 2:157431966-157431988 CCCCATATCTTAAAGGTAGAAGG + Intronic
940996920 2:160159542-160159564 CCTTCAATCTTGAAGGCAGTGGG - Intronic
941745303 2:169080620-169080642 CCTAAAATCAGGCAGGTAGAGGG - Intronic
944254600 2:197612556-197612578 CTTGAACTCTTGAAGGAAAAAGG + Intronic
944670925 2:201993854-201993876 GTTGAAGTCTTGAAGGCAGATGG + Intergenic
945554325 2:211260792-211260814 CATGAAATCTGGAACGAAGAAGG - Intergenic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1169922863 20:10754144-10754166 CATGAAATCTTGTAGGTCCATGG + Intergenic
1175574132 20:60047899-60047921 GGTGAGATCTTGTAGGTAGATGG - Intergenic
1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG + Intronic
1179412381 21:41171848-41171870 CCTGAACACTTGAATGTAAAGGG + Intronic
1179897014 21:44368860-44368882 CCTGAAAGCTGGGAGGAAGAGGG + Intronic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
949663661 3:6311498-6311520 CCTGAAATCCAGAATGGAGATGG + Intergenic
953641136 3:44709353-44709375 CCTGTAACATTGAGGGTAGAGGG + Intergenic
957318165 3:78594580-78594602 CCTGTAGTCTTGAAGGTTAATGG + Intergenic
959345446 3:105189007-105189029 CCTGAAATGTTTAAGGGAGATGG - Intergenic
962745012 3:138390520-138390542 CCTGATGTCATGAAGGTAGGAGG - Intronic
962883587 3:139601857-139601879 CCTACAATGTTGAAGGCAGATGG + Intronic
965384012 3:168024276-168024298 CCTGAAATTTTGAATTAAGAAGG - Intronic
966944547 3:184768583-184768605 CCTGAAATCTTTCAGAAAGAGGG - Intergenic
967381617 3:188865347-188865369 ACAGAAATGTTGAATGTAGAAGG - Intronic
967801121 3:193661227-193661249 CCTGAAATCCTGTGGGGAGAAGG - Intronic
969876768 4:10141289-10141311 CCTGACCTCTTGATGGTAAAAGG + Intergenic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
971790618 4:31165983-31166005 ACTGGAATCTTGAAGCAAGAAGG + Intergenic
974762607 4:66297633-66297655 CCTCAAATTTTGAATGTAAATGG + Intergenic
976048927 4:80987528-80987550 AATGAAATCTTGAAGCTGGAAGG - Intergenic
979087602 4:116432876-116432898 CCAGAAATCATGAAGATAAAGGG - Intergenic
979114217 4:116800623-116800645 CTTGAAATCTTGAATGCAGAGGG + Intergenic
980422532 4:132582791-132582813 TATGAAAACCTGAAGGTAGAGGG + Intergenic
981301412 4:143190713-143190735 CCTGATTTCTTCAAGGTAGTGGG - Intronic
982236371 4:153254579-153254601 CCTGAAAACAGGTAGGTAGATGG - Intronic
983409804 4:167381792-167381814 TCTGAAATATTGGAGGTACATGG + Intergenic
984413978 4:179433607-179433629 CATGAAATCTTGAAAGATGAAGG - Intergenic
986761188 5:10881514-10881536 TCTGAAAATTTGAAGATAGAAGG - Intergenic
988537845 5:32084892-32084914 CCTGAAATCTTGGAGGTGGCAGG - Intronic
989760758 5:45013460-45013482 CCTGAAATCATGAAGTCAGTGGG - Intergenic
990509796 5:56480328-56480350 ACTGAAAATTTGAAGGTCGAGGG - Intronic
991957732 5:72012588-72012610 CCTCAAATCTTGAAATTAGGAGG - Intergenic
994412961 5:99432383-99432405 TCTGAACTCATGAAGGAAGAGGG + Intergenic
994480878 5:100333336-100333358 TCTGAACTCATGAAGGAAGAGGG - Intergenic
994619296 5:102144451-102144473 CTTTAAATGTTGAAGGCAGATGG - Intergenic
995070653 5:107918037-107918059 CCAAAAATGTGGAAGGTAGAAGG - Intronic
995345849 5:111116411-111116433 ACAGAAATCTTTAAGGAAGAAGG - Intronic
995594346 5:113731724-113731746 CCTGAATTCTAAAAGGGAGAAGG + Intergenic
998870208 5:146544238-146544260 CTTGAGATTTTGAAGGTAGAAGG + Intergenic
1003968079 6:11272403-11272425 CCAGAAACCTTAAAAGTAGAAGG - Intronic
1004169971 6:13288272-13288294 CCTGGCATCATGAGGGTAGAGGG - Exonic
1004767887 6:18751804-18751826 CATGAAATTTTAAAGCTAGAAGG + Intergenic
1008586355 6:52954001-52954023 CCTGTAATTCTGAAGGTATATGG - Intergenic
1009047813 6:58249842-58249864 CGTAATATCTTGAAGGGAGAGGG + Intergenic
1009223615 6:61004138-61004160 CGTAATATCTTGAAGGGAGAGGG + Intergenic
1010653626 6:78484863-78484885 CCTGAGATCTTGTAAGTAGGAGG - Intergenic
1012322425 6:97866967-97866989 GCTGAAATTTTGAAGCTAAAAGG - Intergenic
1012413514 6:98987375-98987397 CCTGACATCTTGAGGGGAGGAGG - Intergenic
1015331364 6:131983143-131983165 GCTAAAATCCTGAAGTTAGAAGG - Intergenic
1015383102 6:132592321-132592343 CCTGAAATTATGAAGCCAGATGG + Intergenic
1016351591 6:143175131-143175153 CCTGCAAGCTAGAAGGTAGTGGG - Intronic
1016955454 6:149622383-149622405 TCTGAAATATTGAAGGTTAAAGG + Intronic
1017198136 6:151724011-151724033 CTGGAATTCTAGAAGGTAGAAGG + Intronic
1018416414 6:163605843-163605865 CCTGAAATCATGATGCTAGTTGG + Intergenic
1019694963 7:2440475-2440497 CCTGAACTCTGAAAGGCAGAGGG + Intergenic
1019888805 7:3928770-3928792 ACAGGAATCTTCAAGGTAGAGGG + Intronic
1020534329 7:9375260-9375282 CCTGGAATCTTCATGCTAGAAGG - Intergenic
1021177566 7:17467935-17467957 CCTTAAATCTGGGAGGTGGAGGG - Intergenic
1023146066 7:37152230-37152252 CCTGAAATCTGGATGATAGGAGG + Intronic
1023983914 7:45084474-45084496 CCTCAGAACTTGAAGGAAGAAGG - Exonic
1026031400 7:66797751-66797773 CCTGAAATCTCCAAGGAATAGGG + Intronic
1033281929 7:140012209-140012231 CCTGAAGTCTGGAAGGTAGGAGG + Intronic
1033684412 7:143625295-143625317 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033687588 7:143704514-143704536 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033700199 7:143832328-143832350 ACTGAAATCAGGAAGGAAGAAGG + Intergenic
1034334695 7:150313569-150313591 CCTGAAATCAAGAAGGGAGGGGG + Intronic
1034565591 7:151912107-151912129 ACTGAAAACTGGGAGGTAGAAGG - Intergenic
1041190891 8:55353030-55353052 CAGGAAATCTGGAAAGTAGATGG + Intronic
1041825315 8:62089337-62089359 CCTGATAGTTTGAATGTAGAAGG - Intergenic
1042407331 8:68421250-68421272 TCTGAAATCTAGAAAGAAGAAGG + Intronic
1044204429 8:89475913-89475935 TGTGAAAGCTTGAAGGAAGAGGG - Intergenic
1045740654 8:105355457-105355479 CTTGAAAACTTGAAGGAAGTTGG + Intronic
1045988325 8:108276338-108276360 CTTGAAATTTTCAAGGTACAGGG - Intronic
1047219050 8:122903982-122904004 CCTGAAAAGTGGAAGGAAGAAGG + Intronic
1048491537 8:134898179-134898201 CTTGAAATGTGGAAGGTGGAAGG - Intergenic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1052633956 9:31076070-31076092 CTTGAAATCTAGTAGGTAGTAGG - Intergenic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1056232423 9:84559999-84560021 CCTGAAACCTTGAATGAAGTTGG + Intergenic
1056785421 9:89589320-89589342 CTTAAATTCTTAAAGGTAGAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057327857 9:94082358-94082380 TCTGAAATCTTGAGTATAGAAGG + Intronic
1057841760 9:98491303-98491325 ACTGAAAGGTTGAAGGTAAAAGG - Intronic
1060946717 9:127574062-127574084 TCTGAAATCTGCAAGGCAGAGGG + Intronic
1061912673 9:133733343-133733365 GCTGAAATGGTGAAGGCAGAAGG + Intronic
1188383047 X:29521265-29521287 CCTGAAATTTTCAATGTCGATGG + Intronic
1188844668 X:35058476-35058498 CCTGAGATATTTAAGGTAGATGG - Intergenic
1192847008 X:74916641-74916663 GCTGAAAAGTTCAAGGTAGAGGG - Intronic
1193321129 X:80122729-80122751 CATGAAATCCTGTTGGTAGAAGG - Intergenic
1193873674 X:86833819-86833841 CCAGTAAACTTGAAGGTATATGG - Intergenic
1194700812 X:97111492-97111514 CCGGCAATAATGAAGGTAGAAGG - Intronic
1198178704 X:134182791-134182813 CCTGAAATCTGTGAGGTAGATGG + Intergenic
1198564495 X:137890354-137890376 GCTGAGAACTTAAAGGTAGAAGG - Intergenic
1199592072 X:149476791-149476813 GTTGAATTCTTGAGGGTAGATGG - Intergenic
1201060777 Y:10044363-10044385 CCTGAAATCCAGAATATAGAGGG - Intergenic