ID: 1143102582

View in Genome Browser
Species Human (GRCh38)
Location 17:4512553-4512575
Sequence CCCAGGGTACAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 346}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143102582_1143102595 19 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102595 17:4512595-4512617 GGGCCCGGTTATAATCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1143102582_1143102599 27 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102599 17:4512603-4512625 TTATAATCCTGAGGGCAGCTGGG 0: 1
1: 1
2: 1
3: 19
4: 151
1143102582_1143102594 18 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102594 17:4512594-4512616 GGGGCCCGGTTATAATCCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 46
1143102582_1143102593 4 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102593 17:4512580-4512602 AATCTGAAAATGGAGGGGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 291
1143102582_1143102588 -6 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102588 17:4512570-4512592 CCTGGGCCAGAATCTGAAAATGG 0: 1
1: 0
2: 1
3: 21
4: 303
1143102582_1143102598 26 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102598 17:4512602-4512624 GTTATAATCCTGAGGGCAGCTGG 0: 1
1: 1
2: 0
3: 16
4: 143
1143102582_1143102600 28 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102600 17:4512604-4512626 TATAATCCTGAGGGCAGCTGGGG 0: 1
1: 0
2: 2
3: 27
4: 187
1143102582_1143102591 -1 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102591 17:4512575-4512597 GCCAGAATCTGAAAATGGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 394
1143102582_1143102590 -2 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102590 17:4512574-4512596 GGCCAGAATCTGAAAATGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 196
1143102582_1143102589 -3 Left 1143102582 17:4512553-4512575 CCTGCTTCCCTCTGTACCCTGGG 0: 1
1: 0
2: 3
3: 41
4: 346
Right 1143102589 17:4512573-4512595 GGGCCAGAATCTGAAAATGGAGG 0: 1
1: 0
2: 2
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143102582 Original CRISPR CCCAGGGTACAGAGGGAAGC AGG (reversed) Intronic
900599149 1:3495750-3495772 CCCAGGGTCAAGTGGGGAGCTGG + Intronic
900610251 1:3541681-3541703 CCCTGGGGACAGTGGGAACCTGG + Intronic
900731384 1:4263673-4263695 ATCAGGGTACAGAGGGAGGCAGG + Intergenic
902085311 1:13855777-13855799 CCCAGGCTGCACAGAGAAGCAGG - Intergenic
902466231 1:16620334-16620356 TGCAGGGTGCAGAGGGAAACAGG + Intergenic
902930112 1:19725176-19725198 CCTAGGGCCCAGAGTGAAGCAGG + Intronic
903238105 1:21963821-21963843 CCCAGAGATCAGAGGGGAGCTGG - Intergenic
903802284 1:25978148-25978170 CCGAGGGTACTGAGTGAAGGGGG - Intronic
903854442 1:26328474-26328496 CCCAGGGCGGAGAGGGAGGCTGG + Intronic
903946468 1:26967020-26967042 CCCAGGGAAGGAAGGGAAGCAGG - Intergenic
904356617 1:29944425-29944447 CCTAGGGTACACAGTGAGGCTGG - Intergenic
904438445 1:30514428-30514450 CCTAGGGGACAGAGTGAGGCTGG + Intergenic
905252623 1:36659318-36659340 CCCAGGGTACAGGGTAAAGGAGG - Intergenic
905382793 1:37575339-37575361 CACAGGATCCAAAGGGAAGCAGG - Intronic
905402795 1:37715771-37715793 CCCAGGGTACCGAGGGGAACTGG - Intronic
905731625 1:40302702-40302724 CCCTGGGTACCCAGGCAAGCAGG - Exonic
906380925 1:45331799-45331821 CCCAGGGCTCCGAGGGAGGCAGG + Exonic
906933381 1:50190753-50190775 GCTAGGGTACAGAGGGAACAGGG - Intronic
909329600 1:74395796-74395818 CCTAGGGAACAGAGGAAAGAGGG + Intronic
911127071 1:94350722-94350744 GCCAGGGTAGAGAGGGAGGGAGG - Intergenic
912504614 1:110147780-110147802 CCCAGGGGACAGGTGGAGGCTGG + Intergenic
915111240 1:153565765-153565787 CCCAGGCCACAGTGGGAAGTGGG + Exonic
915356054 1:155255624-155255646 GCCAGGGTCCAGAGCGAGGCAGG - Intergenic
916715340 1:167442736-167442758 GCCAGGGGACAGAGGGATTCAGG - Intronic
918080320 1:181203009-181203031 CCCAGGGTACAGTGAGATGAAGG - Intergenic
918967389 1:191369282-191369304 CACAGGGAACAAAGGAAAGCAGG - Intergenic
919935856 1:202250314-202250336 CTCAGAGTATAGAGGGAAACAGG - Intronic
920191602 1:204197334-204197356 CCAAGGGTACAGGGGGAAGGGGG - Intergenic
922593899 1:226799048-226799070 CGCAGGATGCCGAGGGAAGCGGG - Intergenic
922909900 1:229206575-229206597 CTCAGGGTCCAGAGAGAAGAGGG - Intergenic
923113318 1:230910438-230910460 CGCAGGGCACAGAGAGGAGCAGG + Intronic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1071844197 10:89504910-89504932 CCCAGGGTACAGAGTGTGCCAGG + Intronic
1072270387 10:93770525-93770547 CTCAGAGTTCAGAGGGAACCAGG - Intronic
1074954073 10:118370250-118370272 CCCAGGGTACAGAAGCAGGTTGG + Intergenic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075103911 10:119524654-119524676 CCCAGGGGAAAGTGAGAAGCAGG - Intronic
1076874877 10:133211086-133211108 CCATGGGTACCGAGGGAGGCTGG - Intronic
1077192789 11:1262421-1262443 CCCAGGGGACAGGGGGCAGGGGG + Intergenic
1077257847 11:1596852-1596874 CCCAGAGGAGAGCGGGAAGCTGG + Intergenic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077606383 11:3615639-3615661 CCCAGGGTACAGAGCAGAGGGGG + Intergenic
1078730819 11:13972320-13972342 TCTAGGTTAAAGAGGGAAGCAGG - Intronic
1079036652 11:17025987-17026009 GCTAGGATACAGAGGGGAGCTGG - Intergenic
1079249147 11:18774493-18774515 CTCAGAGTACAGGGGGAAGCTGG - Intronic
1080297651 11:30749036-30749058 CCCAGGTTACACAGCCAAGCTGG + Intergenic
1081587642 11:44398324-44398346 CCCCCGGCACAGAGGGAAGAGGG - Intergenic
1082003948 11:47409571-47409593 CCCAGGGCACTGAGGGCAACAGG - Intronic
1083237776 11:61362565-61362587 CCCTAGGTACAAAGGGAAGGCGG + Intronic
1083857489 11:65400363-65400385 CCCAGGACACAGATGGCAGCAGG - Intronic
1084657383 11:70527406-70527428 CCCAGGGCCCACTGGGAAGCGGG - Intronic
1084667429 11:70583964-70583986 CCCAGAGGTTAGAGGGAAGCAGG - Intronic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1084804135 11:71567039-71567061 CCCAGAGGAGAGCGGGAAGCTGG - Intronic
1084806298 11:71581530-71581552 CCCAGAGGAGAGCGGGAAGCTGG + Intronic
1085014292 11:73162794-73162816 CCCAGGGCACAAATGGAAGAAGG + Intergenic
1085525835 11:77162983-77163005 CCCAAGGTACAGAGGGCTGCCGG + Exonic
1086914692 11:92516051-92516073 CCAAAGGTACAAAGAGAAGCTGG + Intronic
1088724762 11:112624185-112624207 CCCAGCGTGCAGAGAGAGGCAGG - Intergenic
1090042311 11:123301834-123301856 CCCCGGGCGCCGAGGGAAGCGGG + Intergenic
1090153810 11:124414613-124414635 CCCAGGAGAGAGAGGGCAGCAGG + Intergenic
1090237261 11:125158521-125158543 CCCTGGGTACAGGGAGAAGAGGG + Intergenic
1090253957 11:125270220-125270242 CCCAGGGGAGAGAGGGCTGCTGG - Intronic
1091252836 11:134158190-134158212 CCCAGGGCACAGTGTGGAGCGGG + Intronic
1091397470 12:162888-162910 TCAAGGTTACGGAGGGAAGCAGG + Intronic
1092458143 12:8662994-8663016 CCCAAGGAACAAAGGGGAGCTGG - Intergenic
1093253991 12:16842824-16842846 CCCTGGGTAAGCAGGGAAGCAGG + Intergenic
1093997986 12:25663021-25663043 CCAGAGGTACAGAGAGAAGCTGG - Intergenic
1094820824 12:34222908-34222930 CCCAGGGTACACAGGATGGCAGG - Intergenic
1095573926 12:43713162-43713184 GCCAGTGTGCAGAGGGAAGGAGG - Intergenic
1096419154 12:51441464-51441486 CCCAGGGGAAAAAGGAAAGCAGG - Intronic
1097053679 12:56238042-56238064 CCCAGGGTGCCGAGGGCAGCAGG - Exonic
1100892575 12:99142117-99142139 CTGAGGGTACAGGCGGAAGCAGG + Intronic
1102010783 12:109617145-109617167 CCCAGGGTAAAGAGCCAGGCAGG + Intergenic
1104017600 12:124971201-124971223 CCCAGGGTACAACGGGGAACAGG + Intronic
1104062794 12:125282277-125282299 ACCAGGGCACAGAGGCAGGCAGG - Intronic
1104711957 12:130993642-130993664 CCCATGTCACAGTGGGAAGCAGG - Intronic
1104841283 12:131827334-131827356 GCCAGAGTACCCAGGGAAGCGGG + Intergenic
1106589921 13:31090277-31090299 CCCAGGGCACAGAGGAGAACTGG + Intergenic
1107556594 13:41521023-41521045 GCCAGGATACAGTGGGGAGCAGG + Intergenic
1107649911 13:42534812-42534834 CCTAGGGTCCAGGGTGAAGCTGG + Intergenic
1110407779 13:75169864-75169886 GCCAGGGAACAGAGTGAGGCAGG + Intergenic
1112343590 13:98572374-98572396 CCCAGGGTGCAGATGGTAACAGG + Intronic
1112965824 13:105192381-105192403 ACAAGGGTACAGAGAGAAACCGG + Intergenic
1113562292 13:111291416-111291438 GGCAGGGTGCAGTGGGAAGCTGG - Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1115961397 14:38838302-38838324 CCCAGGGAACACAGGGAGGATGG + Intergenic
1116408256 14:44593017-44593039 CCCAGGGTAAGGATGGAACCAGG + Intergenic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1117372656 14:55093064-55093086 CCCAGCGGACAGAGGGACACAGG + Intergenic
1117827600 14:59719721-59719743 CCCAGACTTCAGAGGGAAGTAGG + Intronic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1119509358 14:75198872-75198894 CCAAGGGGACTGAGGGAACCCGG - Intergenic
1119740723 14:77012256-77012278 CCCGGTGTCCAGAGGGGAGCTGG + Intergenic
1120979395 14:90277188-90277210 CCCAGGGCACGGTGGGAAACTGG - Exonic
1124404213 15:29379643-29379665 CCCAGGGAAGCCAGGGAAGCAGG - Intronic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1126336471 15:47590796-47590818 CCCAGAGTTCAGAGGGAACATGG + Intronic
1127661228 15:61101994-61102016 CCCAAGGCACACAGGGAAGGCGG + Intronic
1127785992 15:62355131-62355153 CACTGGGTGCAGAGTGAAGCAGG + Intergenic
1128545618 15:68565849-68565871 CCCAGGGGAGAGGGGGAAACTGG - Intergenic
1129534358 15:76299869-76299891 ACCAGGGTAAAGGGAGAAGCTGG - Intronic
1129661754 15:77556626-77556648 GCCAGGTTGCAGAGGGAAACTGG - Intergenic
1129787742 15:78320652-78320674 CCCTGGGCACAGAGAGGAGCAGG + Intergenic
1129907390 15:79198084-79198106 TGCAGGCTGCAGAGGGAAGCAGG - Intergenic
1129946308 15:79542038-79542060 CCCAGTGGACAGAGGTATGCTGG + Intergenic
1130045408 15:80440466-80440488 CACAGGGTGGAGAAGGAAGCTGG + Intronic
1131045896 15:89315140-89315162 CCCAGCATACAGAAGGAAGTGGG + Intronic
1131094110 15:89645327-89645349 TCCAGGGTCCAGAGGTAAGCTGG - Exonic
1131121235 15:89824470-89824492 CCCAGGGGAGAGAGGCAAGGGGG - Intergenic
1131533861 15:93217410-93217432 TCCTGGGTCCTGAGGGAAGCTGG + Intergenic
1132498633 16:275252-275274 CCCAGGGCCCAGTGGGAGGCAGG + Intronic
1133030349 16:3007928-3007950 CCAAGTGCACAGCGGGAAGCAGG - Intergenic
1134109181 16:11503987-11504009 CCCAGGGTGCCAAGGGCAGCTGG - Intronic
1134110538 16:11512888-11512910 CCCATGGTGCAGAGCGAAGTCGG + Intronic
1134229051 16:12415141-12415163 CCCAGGGCACACAAGCAAGCTGG - Intronic
1135154588 16:20041533-20041555 CCCAGGGTCCAGAGTGGGGCAGG - Intronic
1135537096 16:23302655-23302677 CCCAGGGTGCAGAAGGCAGACGG + Intronic
1135776770 16:25263358-25263380 CTCAGGGTGCAGAGGGAATCAGG + Intergenic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1138350716 16:56344979-56345001 CCCTGGGGACAGAGGACAGCAGG + Exonic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141659033 16:85431732-85431754 CCCAGGGCCCAGAGGGTATCTGG + Intergenic
1141997997 16:87647333-87647355 CCCAGGAGACACAGGGATGCTGG - Intronic
1142188902 16:88708256-88708278 CCCAAGGAACAGTGGGGAGCCGG + Intronic
1142561427 17:811634-811656 CCCAGGGCACCGAAGGAAGCCGG + Intronic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1144919707 17:18753165-18753187 TCTAGGGCACAGAGGGAAGTGGG + Intronic
1144949577 17:18986728-18986750 CCCAGCGTGCAGACGCAAGCAGG - Intronic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1146284307 17:31564315-31564337 CCTATGGTACCGAGGCAAGCTGG - Intergenic
1146974329 17:37098083-37098105 GCCAGGCCACAGAGGGAAGAGGG - Intronic
1147262070 17:39214532-39214554 CCCAGGGTACAGCAGGCAGAAGG - Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147760799 17:42796339-42796361 CTCAGGGAAAAGATGGAAGCTGG - Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1148781396 17:50123996-50124018 ACCAGGGGAGAGAGGGAAGAAGG + Intronic
1149856626 17:60088441-60088463 CCCAGGGTACACAGGGTGGGTGG - Intergenic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1150209917 17:63436298-63436320 CCCAGGGTCCCCAGGGAACCTGG - Intronic
1151149153 17:72068806-72068828 GCCAGGGTACAAAGGGCAGAGGG + Intergenic
1151155946 17:72123104-72123126 CTCTGGGTAGAGAGGGGAGCGGG - Intronic
1151480481 17:74367681-74367703 CACAGGTCACAGGGGGAAGCTGG + Exonic
1151560196 17:74865896-74865918 CCCAGGGCACAGTGGGGACCAGG - Intronic
1152594758 17:81232753-81232775 CCCAGAGGACAGAGGGACGGAGG - Intronic
1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG + Intronic
1153085441 18:1280383-1280405 CACAGGGTACAGTGGTAAGTTGG + Intergenic
1153781193 18:8496236-8496258 CCCAGGGCACACAGGGAGGCTGG - Intergenic
1153810863 18:8750449-8750471 CCCAGGGCACAGAGAGCAGCAGG - Intronic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157079637 18:44508899-44508921 CCCATGGTACAGAAGAAAGAGGG - Intergenic
1159415343 18:68139776-68139798 CCAAGGGTACAAAGAGGAGCTGG - Intergenic
1160329433 18:77978161-77978183 TCCAGGGTGCAGGGGGAAGCTGG - Intergenic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1160975568 19:1790646-1790668 CCCAAGGCACAGTGGGAAGGGGG - Intronic
1161003570 19:1923429-1923451 TCCAGACTCCAGAGGGAAGCAGG + Intronic
1161043878 19:2124155-2124177 TCCAGACTCCAGAGGGAAGCAGG - Intronic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1161981891 19:7634187-7634209 CCCTGGGGACAGAGGCAGGCGGG + Intronic
1162782493 19:13013522-13013544 TCCAGGGTACAGGGCGCAGCAGG - Intronic
1162851966 19:13437885-13437907 CCCAGTGGACAGAGGGAGCCAGG + Intronic
1163527464 19:17830405-17830427 CCCATGCTAAAGAGGGACGCAGG + Intronic
1163688329 19:18724979-18725001 GCCAGTGTGCTGAGGGAAGCTGG - Intronic
1163690259 19:18734903-18734925 CGCAGGGTACACAGGGAATGTGG - Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164509815 19:28888324-28888346 CCCAGGGTCCTGAGGGAGCCAGG - Intergenic
1164586588 19:29479775-29479797 CACAGGGTAGAGAGGTCAGCAGG + Intergenic
1164609289 19:29621282-29621304 CACAGGGTGCAGCGGGAAGGTGG - Intergenic
1166194312 19:41196084-41196106 ACGAGGGTAAAGAGGGAATCAGG + Intronic
1166290643 19:41860996-41861018 CCCAGAGTACAAAGAGAGGCTGG - Intronic
1166379966 19:42350703-42350725 CCCAGGGAACAAGAGGAAGCAGG - Intronic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166863111 19:45821051-45821073 CCCGAGGAACAGAAGGAAGCAGG - Intronic
1167507489 19:49878476-49878498 CCTAGGGTAAGGAGGGAGGCGGG - Exonic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168271412 19:55251780-55251802 ACCAGCGTGCTGAGGGAAGCGGG + Intronic
1168335862 19:55597493-55597515 CCCAGAGTACAGTGGGGCGCGGG + Intronic
1168657259 19:58139524-58139546 CACAGGGTACAGCAGGAAGCAGG + Intronic
925945920 2:8863586-8863608 GCGAGGGCACAGAGGGATGCGGG - Intronic
926593113 2:14760389-14760411 CCCAGGGGCCAGAGAAAAGCAGG + Intergenic
927216226 2:20669187-20669209 CTCAGGGTGGAGAGGGAGGCCGG - Intronic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
927872355 2:26631697-26631719 CCCAGGGCACAGAGTGCAGTGGG - Intronic
927936537 2:27079500-27079522 GCTAGGATACAGAGGGCAGCTGG - Intronic
928135436 2:28684360-28684382 GCCGGGTTACAGAGGGTAGCAGG - Intergenic
928427162 2:31188870-31188892 CCCATGGTCCTGGGGGAAGCAGG - Intronic
928987663 2:37196803-37196825 ACCAGGGAACCGGGGGAAGCGGG + Intronic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
932336236 2:70932898-70932920 CCCTGGGCACAGAGAGCAGCCGG - Exonic
932869974 2:75389028-75389050 CCAAGGGTACACAGTAAAGCCGG - Intergenic
933274835 2:80272534-80272556 CCCAGGGAAAAGAGGGAAACAGG + Intronic
934698552 2:96419237-96419259 CCAGAGGTACAAAGGGAAGCTGG - Intergenic
934783149 2:96985917-96985939 CCCAGGGTGCAAAGGGTAGCTGG - Intronic
934844851 2:97656190-97656212 CCCAGGGTGCCGAGGGTAGAGGG + Exonic
935755171 2:106270991-106271013 CCCAGGATAAGGAGGGAAGGTGG - Intergenic
937200991 2:120204442-120204464 CCCAGGGTCCAGAGCCATGCTGG + Intergenic
938296732 2:130183389-130183411 CCCAGGGTGCAGAGGCCTGCGGG + Intronic
938460025 2:131491268-131491290 CCCAGGGTGCAGAGGCCTGCGGG - Intronic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
940309756 2:152265440-152265462 CACAGGGTACTGAGGGCAGCAGG + Intergenic
941610654 2:167657462-167657484 CCCACAGTACAGAGGGAACAGGG + Intergenic
941743035 2:169056379-169056401 CCAGAGGTACAGAGGGGAGCTGG + Intergenic
944176160 2:196831177-196831199 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
946152547 2:217786039-217786061 TCCAGGCTGCACAGGGAAGCAGG - Intergenic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
948229798 2:236341633-236341655 CCCAGGGCTCAGAGGGCCGCAGG + Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948703656 2:239776479-239776501 CCCAGGGCACAAAGGAAAGACGG + Intronic
948907555 2:240986966-240986988 CCCAGGGAACAGGGGCCAGCAGG + Intronic
949026927 2:241770664-241770686 CCCAGGGTCCAGAGGGCACTAGG - Intergenic
1169075017 20:2755038-2755060 CCCAGGGTGCAGGGGGAAGTGGG + Intronic
1169131704 20:3169186-3169208 CCCAAGGCACAAAGGGAAGGAGG - Intronic
1170257986 20:14367688-14367710 CCAAGGGTAAAGAAGGAATCTGG - Intronic
1171005614 20:21462702-21462724 CCCAGGGCACAGAGCAGAGCAGG + Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171335269 20:24379851-24379873 CTCAGGGGACCGAGGGGAGCTGG - Intergenic
1172515409 20:35529459-35529481 CCGACAGGACAGAGGGAAGCTGG - Intronic
1173998962 20:47360545-47360567 CCCAGGGTACAGAGAGGATTGGG + Intergenic
1174396592 20:50250586-50250608 CCCAGGGCTGAGAGGGATGCAGG + Intergenic
1174570736 20:51499295-51499317 CCCAGGTGACAGAGGGGAGGAGG + Intronic
1175946762 20:62562535-62562557 CCCAGGGTTCAGAGGGGAAGGGG + Intronic
1175964918 20:62655599-62655621 CGCAGGGTTCAGAAGGAAGGTGG + Intronic
1175975148 20:62707374-62707396 CGCAGGGTGTTGAGGGAAGCGGG - Intergenic
1176242901 20:64083326-64083348 CCCAGGACCCCGAGGGAAGCGGG - Intronic
1177919221 21:27129582-27129604 TCCAGCGTACAGAGGGCAGAGGG + Intergenic
1179802111 21:43816077-43816099 CCCAGGGTGCGGAGGGGACCAGG - Intergenic
1181182879 22:21079595-21079617 CCCAGGGTACAGAGGCCTGCGGG - Intergenic
1181495953 22:23287620-23287642 CCCAGGTTACAGATGGCAGCAGG - Intronic
1181522918 22:23459780-23459802 CCCAGGGGACACAGGGCAGGAGG - Intergenic
1182239409 22:28903117-28903139 CCCAGGAAACAGAGGGAACTGGG - Intronic
1182416237 22:30223166-30223188 CCCAGCGTCCAGTGGGAAGACGG - Intergenic
1182735419 22:32529459-32529481 CCCAGGGTTCAGAGGAAAGAGGG + Intronic
1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG + Intronic
1183718445 22:39548144-39548166 CCCAGCCTGCAGAGGGGAGCAGG - Intergenic
1184360903 22:44018040-44018062 CCCAGGATACAGAGAGTACCCGG + Intronic
949598038 3:5568114-5568136 GACAGGATACAGAGGGAACCTGG + Intergenic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950577050 3:13838225-13838247 CCCAGGGCCCAGAGGGACGTGGG + Intronic
951292107 3:20883897-20883919 TTCAGGGGTCAGAGGGAAGCAGG + Intergenic
952154314 3:30626539-30626561 TCAAGGAAACAGAGGGAAGCCGG + Intronic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
954097756 3:48343539-48343561 GCCAGGGCCCAGAGGGAAGGTGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
959170275 3:102835933-102835955 CCATGAGTACAGAGGGTAGCTGG + Intergenic
960768981 3:121170754-121170776 CCCAGGGTACAAAGAGGAGATGG + Intronic
961025323 3:123550643-123550665 TCCAGAGTACAGAGGAGAGCAGG + Intronic
961116466 3:124334199-124334221 GGCAGGGCACAGAGAGAAGCAGG - Intronic
961198464 3:125024334-125024356 ACCAGGGCACAAAGGGAAACCGG - Intronic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
962269390 3:133967007-133967029 TCCAGGGTAAAAAGGAAAGCGGG - Intronic
962959665 3:140299002-140299024 ACCAAGGTACAGGGGGAAGAGGG - Intronic
963143503 3:141967796-141967818 TTCATGGTACAGAGGTAAGCAGG + Intronic
964087402 3:152834978-152835000 TCCAGGGCGCAGTGGGAAGCAGG - Exonic
964570078 3:158101479-158101501 CTCAGTGCACAGAGCGAAGCAGG + Intronic
964967710 3:162518284-162518306 CTAGGGGTACAGAAGGAAGCTGG - Intergenic
966929784 3:184668876-184668898 CCCAGAGCACAGAGTGAAGATGG + Intronic
967110552 3:186289707-186289729 GCCAGGGAACAAAGGGAAGATGG + Intronic
967364682 3:188672605-188672627 CCCAGGGTTAAGAAGCAAGCTGG - Intronic
967387649 3:188927198-188927220 CCCAGGCTACACCTGGAAGCTGG - Intergenic
967521573 3:190438809-190438831 CACAGGGCATAGAGGGAAACAGG - Intronic
967631050 3:191743214-191743236 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968232960 3:197015177-197015199 CCCAGGGGACAGAGACAGGCGGG - Intronic
968662075 4:1802815-1802837 CCCAAGGTACAGATCGAGGCTGG - Intronic
968681661 4:1925143-1925165 CCTAGGTTACAGATGGAAGCAGG - Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969043292 4:4317986-4318008 CCCACTGTACAGAGGCATGCTGG - Intronic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
969242867 4:5912678-5912700 GCAAGGCCACAGAGGGAAGCAGG + Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969703665 4:8780961-8780983 CACAGAGTACAGTGGGAACCAGG + Intergenic
970449059 4:16149053-16149075 CAAAGGGTACAGAGGAAAGAGGG - Intergenic
970473435 4:16399467-16399489 CCCAGGGTAATGAGGTAAGCAGG + Intergenic
970917784 4:21355715-21355737 ACCAGGGTACAAAGAGGAGCTGG + Intronic
972169601 4:36329074-36329096 CCCAAGGAATAGAAGGAAGCTGG - Intronic
976144947 4:82033033-82033055 CTCAGGGGACAGAGGGAAAGAGG + Intronic
977293844 4:95191395-95191417 CCCAGGGTCCAGGCTGAAGCTGG + Intronic
981076971 4:140601943-140601965 CACAGGGAACAAAGGAAAGCAGG + Intergenic
984301830 4:177929727-177929749 CCCAGGGTCAACAGGAAAGCAGG + Intronic
985838673 5:2289499-2289521 CCCAGGGTACCCAAGTAAGCCGG + Intergenic
986298854 5:6462399-6462421 CCCAGGCAACAGAGGGATCCTGG + Intronic
986522051 5:8630248-8630270 CCAGGGGTAAAAAGGGAAGCTGG + Intergenic
986582002 5:9275395-9275417 CCAAAGGTACAAAGAGAAGCTGG + Intronic
987038524 5:14040655-14040677 CCCAGGGAACAGAGGGCACTTGG + Intergenic
987073917 5:14362735-14362757 CTCAGGGTCCCGAGGGAAGTGGG - Intronic
990310120 5:54529748-54529770 CCAAGGTTACACAGTGAAGCTGG - Intronic
993346937 5:86795864-86795886 CCCAGGCAATATAGGGAAGCTGG + Intergenic
993907265 5:93637082-93637104 CCAAGGGTAAGGAGGGGAGCTGG - Intronic
994397500 5:99237615-99237637 CCCAGGAGACAGAGAGAAGGGGG + Intergenic
994811703 5:104527718-104527740 CCCAGCATACAGAGGGAATGTGG + Intergenic
995201026 5:109425410-109425432 ACCAGGGCACTGAGGGAAGCAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999303071 5:150502915-150502937 CCCAGGGTTCTGAGGGTGGCAGG + Intronic
1003014959 6:2461091-2461113 CACAGGGAACAGAGAGGAGCTGG - Intergenic
1004609125 6:17222431-17222453 ACCAGGGTGGAGGGGGAAGCAGG - Intergenic
1005463898 6:26093272-26093294 CCCAGGGCACAGTGGGAAGAGGG + Intronic
1006125867 6:31837693-31837715 CATAAGGTACAGAGGGAAGCAGG + Intronic
1006359500 6:33579500-33579522 CCCAGGCTTCCGAGGGGAGCAGG + Intronic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1007298206 6:40844972-40844994 CCTAGGGTACTGAAGGAAGGAGG + Intergenic
1007967803 6:46018082-46018104 CCAAGGTTACAGAGGGAGACTGG + Intronic
1008091715 6:47300549-47300571 CTCAGAGTGCAGTGGGAAGCAGG - Intronic
1008199127 6:48564643-48564665 CCAAGGCTACACAGGGCAGCAGG - Intergenic
1008341750 6:50374112-50374134 CCCAGAGGAGGGAGGGAAGCAGG - Intergenic
1010589046 6:77691620-77691642 TACAAGGTACAGAGGGAAGTTGG + Intronic
1010656549 6:78518316-78518338 TCCAGGGTATAGAGGGAATCTGG + Intergenic
1011452227 6:87505672-87505694 CCCATGTGACAGAGGGAAGTGGG + Intronic
1012805824 6:103891474-103891496 CCAAGTGTACAGAGTGAAACAGG + Intergenic
1014017602 6:116551123-116551145 GTCAGGGGACAGAAGGAAGCAGG - Intronic
1014123143 6:117749149-117749171 CCCAAGGTACAAAGAGGAGCTGG + Intergenic
1015509575 6:134024395-134024417 ATCAAGGCACAGAGGGAAGCTGG - Intronic
1017711599 6:157173919-157173941 CACAAGTTACAGAGTGAAGCAGG - Intronic
1018908961 6:168091005-168091027 CCCAGGGCAGAGAGCGGAGCCGG - Intergenic
1019442221 7:1053153-1053175 CTCTGGGCACAGAGGCAAGCGGG + Intronic
1019443471 7:1059300-1059322 CCCAGGGGACAGAGGGCTGGAGG + Intronic
1019565458 7:1676638-1676660 AGCAGGGCACAGAGGGACGCAGG - Intergenic
1020050151 7:5076130-5076152 TCCATGGTGCAGAGGGAACCTGG - Intergenic
1022015512 7:26345564-26345586 CATAGGGAACACAGGGAAGCAGG - Intronic
1022306318 7:29149676-29149698 TCCAGGTTTCAGAGGGAACCTGG - Intronic
1024556149 7:50605076-50605098 CCCAGGGGACAGGGGACAGCGGG + Intronic
1025739526 7:64183881-64183903 CCCAGGGTACAGGAGGAGGCTGG + Intronic
1026369300 7:69683031-69683053 TCCACCGTACAGAGGGAAGAGGG + Intronic
1027191713 7:76000493-76000515 TCCAGAGAAGAGAGGGAAGCAGG - Intronic
1027584225 7:80037194-80037216 CCCACAGTACAGAGGGAAATGGG - Intergenic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1031206346 7:118762984-118763006 CACAGGGTACCGAGGGATGGTGG + Intergenic
1032442909 7:131955762-131955784 CTCAGAGTACACAGGCAAGCTGG + Intergenic
1034382935 7:150714761-150714783 TACAGGGTACAAAAGGAAGCCGG + Intergenic
1035076391 7:156180370-156180392 CCCAGGGTAGAGAGGGAATCAGG + Intergenic
1035100255 7:156390425-156390447 CCCAGGGAAAAGAGAGAAACAGG + Intergenic
1037404695 8:18529135-18529157 CCCAGGCTACGGAGAGATGCTGG + Exonic
1037748515 8:21664839-21664861 CCCAGGTAACAGTGGAAAGCTGG + Intergenic
1038275511 8:26117712-26117734 CACAGGGAAGAAAGGGAAGCAGG - Intergenic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039665479 8:39522614-39522636 CCCAGGCTGCAGTGGGAAGTGGG - Intergenic
1039832674 8:41228518-41228540 CCAGAGGTACAGAGGGGAGCTGG + Intergenic
1039984681 8:42437263-42437285 CCCAGAGGACAGTGAGAAGCTGG - Exonic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041189411 8:55338420-55338442 CCCAGGGTGCAATGGCAAGCTGG + Intronic
1044155980 8:88847893-88847915 CCCAAGGTACAAAGAGGAGCTGG - Intergenic
1045460926 8:102425256-102425278 CCCAGGATAAAAAGGGAAGGTGG + Intergenic
1046145639 8:110154560-110154582 CCAAAGGTACAGAAAGAAGCTGG - Intergenic
1048349268 8:133603037-133603059 CCCAGGGCACACAAGGCAGCCGG + Intergenic
1049109435 8:140634440-140634462 CCCAGCGGACAAAGGGGAGCAGG + Intronic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049945618 9:592320-592342 CCCAGGGAGCAGCGGGAAGCCGG + Intronic
1051910952 9:22154190-22154212 CCCAGGGTACAGGAGGAAGCTGG + Intergenic
1052020994 9:23524991-23525013 CCCAGAGCACAGAGCGAAGAGGG - Intergenic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1055971296 9:81915402-81915424 CCCAGGGGACTGCAGGAAGCAGG - Intergenic
1056277526 9:85007537-85007559 CCCAGGGGACAGGGGGAGGAGGG + Intronic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1057144166 9:92747353-92747375 CCCTGGCTACACTGGGAAGCAGG + Intronic
1057248613 9:93481043-93481065 CCCAGGGCACAGGAGGAGGCAGG - Intronic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059262383 9:112990691-112990713 CCACGGGTACAAAGAGAAGCTGG - Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1060152144 9:121295628-121295650 CCAAGGTTACAGAGGAAAGGAGG + Intronic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061593350 9:131613167-131613189 CCCACTGCACAGAGGAAAGCGGG + Intronic
1061950291 9:133932246-133932268 CACAGGGCACAGAGGAAAACAGG + Intronic
1061951416 9:133938398-133938420 GCCTGGGTACAGAGGGACGCAGG - Intronic
1062291769 9:135798516-135798538 CCCAGGGGACAGGAGGAGGCAGG - Intergenic
1062545916 9:137063721-137063743 CCCAGGGTACAGGAGGAGGCTGG - Exonic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1187251707 X:17604783-17604805 CCCTGGGTCCAGAGGTAATCAGG - Intronic
1187672476 X:21682167-21682189 TCCAGGGTAATGAGGGAGGCTGG + Intergenic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1189664174 X:43335001-43335023 CCCAGGGTACAGAGGCAGGCAGG - Intergenic
1189850743 X:45173922-45173944 CCCAGGGTGCAGAGGAATGAGGG - Intronic
1189953376 X:46254922-46254944 CCAACAGTACAGAGGGAAGGGGG + Intergenic
1190743506 X:53306335-53306357 CCAGGGGTCCAGAGGGAGGCAGG + Intronic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1191132983 X:57034633-57034655 CCCACGGTACAAAGAGGAGCTGG - Intergenic
1192554231 X:72077365-72077387 CCCAGGGTACAGAGCGAGGTTGG + Intergenic
1194409863 X:93544128-93544150 CCGAGGTTACACAGGGCAGCCGG + Intergenic
1195626648 X:107010437-107010459 CGCAGTGTTCAGAGGGAAGAAGG + Intergenic
1195810310 X:108821809-108821831 CCAAAGGTACAAAGGGGAGCTGG - Intergenic
1195943191 X:110181870-110181892 CCCAGAGCACAGAGGTTAGCTGG + Intronic
1195985909 X:110629874-110629896 ACCAGGGTACAAAGAGGAGCTGG + Intergenic
1199119060 X:144029490-144029512 CCCAGGCTGCACAGGGTAGCAGG - Intergenic
1199460636 X:148080836-148080858 CCCAGGGTTCAAAGGGCAGCTGG - Intergenic
1199787950 X:151122197-151122219 ACCAGGGTACAAAGAGGAGCTGG + Intergenic
1200064414 X:153497684-153497706 CCCAGGGAACCCTGGGAAGCTGG - Intronic
1200126082 X:153815737-153815759 CCCAGGGAACCCTGGGAAGCTGG + Intronic
1200767498 Y:7092651-7092673 ACAAAGGTACAGAGGGAAGGAGG - Intergenic