ID: 1143104154

View in Genome Browser
Species Human (GRCh38)
Location 17:4520038-4520060
Sequence GTCCCAAGGGAAGACACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 381}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143104145_1143104154 0 Left 1143104145 17:4520015-4520037 CCCTCCTGACCCTGGACTGCCAT 0: 1
1: 0
2: 3
3: 29
4: 296
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104146_1143104154 -1 Left 1143104146 17:4520016-4520038 CCTCCTGACCCTGGACTGCCATG 0: 1
1: 0
2: 1
3: 27
4: 289
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104144_1143104154 3 Left 1143104144 17:4520012-4520034 CCTCCCTCCTGACCCTGGACTGC 0: 1
1: 0
2: 5
3: 55
4: 490
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104147_1143104154 -4 Left 1143104147 17:4520019-4520041 CCTGACCCTGGACTGCCATGTCC 0: 1
1: 0
2: 1
3: 20
4: 267
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104142_1143104154 7 Left 1143104142 17:4520008-4520030 CCCACCTCCCTCCTGACCCTGGA 0: 1
1: 0
2: 5
3: 74
4: 600
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104143_1143104154 6 Left 1143104143 17:4520009-4520031 CCACCTCCCTCCTGACCCTGGAC 0: 1
1: 0
2: 5
3: 78
4: 788
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104150_1143104154 -10 Left 1143104150 17:4520025-4520047 CCTGGACTGCCATGTCCCAAGGG 0: 1
1: 0
2: 4
3: 21
4: 180
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1143104148_1143104154 -9 Left 1143104148 17:4520024-4520046 CCCTGGACTGCCATGTCCCAAGG 0: 1
1: 0
2: 3
3: 9
4: 189
Right 1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143104154 Original CRISPR GTCCCAAGGGAAGACACTGA GGG Intronic
900070790 1:770256-770278 AACCCAAGGGAAGGCACTGCTGG + Intergenic
900125276 1:1066451-1066473 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
900136091 1:1117476-1117498 GTCCCACGGCCAGACACTGGTGG - Intergenic
900167747 1:1250615-1250637 GTGCCGAGGGAAGAGACCGAGGG - Intergenic
900457543 1:2784837-2784859 GTGCCGAGGCAAGAGACTGAAGG - Intronic
900654575 1:3749103-3749125 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
900664061 1:3801905-3801927 GTGCCGAGGCAAGAGACTGAGGG - Intergenic
901720306 1:11192133-11192155 CTCCCAAATGCAGACACTGATGG + Intronic
901817273 1:11801446-11801468 GCCCCATGGGAAGGCAGTGACGG - Intronic
901834215 1:11913333-11913355 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
904713372 1:32448219-32448241 GTGCCAAGGCAAGAGACCGAAGG + Intergenic
904739973 1:32666709-32666731 GTGCCGAGGCAAGAGACTGAAGG + Intronic
905184070 1:36183757-36183779 GGGCCATGGGAAGCCACTGAAGG + Intergenic
905345699 1:37309610-37309632 ATCCCAAGGGGAGCCACTGAAGG - Intergenic
905634473 1:39540424-39540446 GAGACAAGGGAAGAGACTGAGGG + Intergenic
905702714 1:40030439-40030461 ATTCCAAGGGAAGTCACTGAAGG - Intergenic
905857747 1:41325594-41325616 GTGCAGAGGGAAGCCACTGAGGG + Intergenic
905925246 1:41745093-41745115 GTCCAGAGAGAAGAAACTGAGGG - Intronic
907288786 1:53399222-53399244 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
907605604 1:55814375-55814397 GTCCCATAGGAAGATGCTGAGGG - Intergenic
907936403 1:59046104-59046126 GTGCAAATGGAAGCCACTGAAGG - Intergenic
908877762 1:68697501-68697523 GTTACATGGGAAGAAACTGAGGG + Intergenic
912561811 1:110556422-110556444 GACCCTTGGGAGGACACTGAGGG - Intergenic
914378915 1:147098825-147098847 GTGCCGAGGCAAGAGACTGAGGG - Intergenic
914761740 1:150604629-150604651 GCCCCCAGGGAAGCCTCTGATGG - Intronic
915233235 1:154461715-154461737 GTGCCGAGGCAAGACACTGAAGG - Intronic
915474398 1:156144847-156144869 GTGCTTTGGGAAGACACTGAGGG - Intergenic
916472008 1:165133155-165133177 GTTGCAAAGGAAGACACTAAGGG + Intergenic
917534427 1:175864106-175864128 GGCCCGAGGGTGGACACTGAAGG + Intergenic
918091297 1:181297360-181297382 TTGTCAAGGGAAGACACTGGAGG + Intergenic
918681299 1:187357834-187357856 GTACCCAGGGAAGAACCTGATGG - Intergenic
919471591 1:197986038-197986060 GTCCAAAGGGGAAACATTGATGG - Intergenic
920338028 1:205257953-205257975 CTCCACAGGGCAGACACTGAGGG + Intronic
920380241 1:205530795-205530817 GTCCAAAGGGAAGCCAGTGGTGG - Intronic
920970259 1:210737252-210737274 ACCCAAAGGGAAGAGACTGAGGG + Intronic
921018295 1:211212575-211212597 GCCCCAAGGGAAAACATTGGTGG - Intergenic
921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG + Intergenic
921081556 1:211742696-211742718 GTTCCCAGGGAAGACACTCTGGG + Intergenic
921148322 1:212379810-212379832 GTCCCAAGGCTAGAGACGGAGGG - Intronic
921183151 1:212647057-212647079 TCCCCCAGGGATGACACTGATGG - Intergenic
922106149 1:222515672-222515694 AACCCAAGGGAAGGCACTGCTGG + Intergenic
922169883 1:223145041-223145063 GTTCATAGGGAAGACATTGAAGG - Intergenic
922622870 1:227004310-227004332 GTCCCAATGGAAACCAATGAGGG - Intronic
923492768 1:234499109-234499131 CCCCCAAAGGAAGACACCGAGGG - Intergenic
923501665 1:234570487-234570509 TTCACAAAGGAAGAAACTGAGGG + Intergenic
924348329 1:243093239-243093261 AACCCAAGGGAAGGCACTGCTGG + Intergenic
1063226231 10:4017391-4017413 GTCGCAGGAGAAGACCCTGAAGG - Intergenic
1063319389 10:5038519-5038541 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1063320518 10:5047597-5047619 GTGCCAAGGCAAGAGATTGAAGG - Intronic
1065974453 10:30830138-30830160 GTCCCATTTGAAGACTCTGATGG + Intronic
1066728035 10:38411662-38411684 AACCCAAGGGAAGGCACTGCTGG - Intergenic
1067152356 10:43747232-43747254 AGGCCAAGGGAAGCCACTGAAGG + Intergenic
1069078857 10:64066640-64066662 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1069369786 10:67735507-67735529 GTCCCAAGGAAATATACTAACGG + Intergenic
1069702884 10:70439455-70439477 GGCACACGGGAAGCCACTGATGG - Intronic
1069799145 10:71071481-71071503 GTGCCATGGGAAGTCACTGGAGG + Intergenic
1069941117 10:71955980-71956002 GCGCCAAGGCAAGAGACTGAAGG + Intergenic
1071261590 10:83924471-83924493 GTGCCATGAGAAGCCACTGATGG + Intergenic
1072499163 10:95994915-95994937 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1072890532 10:99319804-99319826 ATGTCATGGGAAGACACTGAAGG + Intergenic
1073342934 10:102759489-102759511 GTGCCAAGGCAAGAGACTGAAGG - Intronic
1075926879 10:126258537-126258559 GCACCAGGGGAAGCCACTGAAGG - Intronic
1076075357 10:127529886-127529908 CTCCCAAGGGCAGCCTCTGAAGG + Intergenic
1076897723 10:133321824-133321846 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1076906953 10:133367218-133367240 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1077001526 11:325743-325765 GTGCCCAGGCAAGAGACTGAAGG - Intronic
1077013415 11:389903-389925 GTGCCCAGGCAAGAGACTGAAGG - Intergenic
1077114342 11:876540-876562 CTACCCAGGGAAGACACTGGTGG + Intronic
1077239153 11:1501639-1501661 GTGCCAAGGGAAGGGACTGGGGG + Intergenic
1077706712 11:4493693-4493715 GTGCCAAGACAAGAGACTGAGGG - Intergenic
1080070847 11:28084905-28084927 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1080298243 11:30754523-30754545 GTGCCAGGGGAACACACTGCTGG - Intergenic
1080730429 11:34945991-34946013 GTTCTGAGGGAAGACACTGGAGG - Intronic
1083130346 11:60619166-60619188 GTGCCAAGGCAAGAGACTGAAGG - Intergenic
1083611969 11:64008591-64008613 GTGCTAGGGGAAGACAGTGAGGG + Intronic
1083896444 11:65622238-65622260 ATCCCAGGAGCAGACACTGATGG + Exonic
1084013894 11:66367637-66367659 ACCCCCAGAGAAGACACTGAGGG - Intronic
1084088594 11:66865988-66866010 CTCCCAGGGGAAGAGACTGCTGG - Intronic
1084164996 11:67371480-67371502 GGCCCAGGGGAAGAAGCTGAGGG + Intronic
1084217783 11:67659871-67659893 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
1084477386 11:69396634-69396656 GTCCCACCAGAAGTCACTGACGG + Intergenic
1086398537 11:86441926-86441948 CGCCCAAAGGAAGAAACTGACGG + Intronic
1087150792 11:94857765-94857787 CTCCCATGTGAACACACTGAGGG + Intronic
1088599060 11:111459765-111459787 GGCTCAATGGAAGACGCTGATGG + Intergenic
1088701881 11:112420458-112420480 GTCTCAAGGAAAGACCTTGATGG - Intergenic
1089003805 11:115074237-115074259 TTCCCAGAGGAAGACAATGATGG + Intergenic
1089642505 11:119857051-119857073 GCCCCAAGTGAGGACACTGCAGG + Intergenic
1089649535 11:119903691-119903713 GTCCCCAGGGAAGAGCCTGCTGG - Intergenic
1092731719 12:11541163-11541185 GACCCTGGGCAAGACACTGAGGG - Intergenic
1094639403 12:32259307-32259329 GTGCCAAGGCAAGAAACTGAAGG - Intronic
1097243093 12:57589798-57589820 GTGCCAAGGCAAGAGACTGAAGG - Intergenic
1098625493 12:72660763-72660785 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1100212955 12:92417123-92417145 GTCCCAAGGGCTGACACTGGTGG + Intergenic
1100600951 12:96110954-96110976 GTCACAATGGCAGACACTGGCGG + Intergenic
1101737222 12:107472076-107472098 GACCAAAGAGAAAACACTGAGGG + Intronic
1102693211 12:114777958-114777980 GTCCCTATGGAAGACACTTATGG - Intergenic
1103926602 12:124426862-124426884 GGACCCAGGGAAGACACAGAGGG + Intronic
1104862994 12:131934650-131934672 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1104913807 12:132253679-132253701 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1105640919 13:22263461-22263483 TTCCTAAGGGAAGGCTCTGATGG - Intergenic
1105855644 13:24369598-24369620 GTGCCAAGGCAAGAGACTGAAGG - Intergenic
1105988085 13:25589195-25589217 GTTTCAAAGGAATACACTGAGGG - Intronic
1106345015 13:28868273-28868295 GTTCCAAGGCAAGAAACAGATGG - Intronic
1106715841 13:32387171-32387193 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1107319643 13:39171918-39171940 GTCACTTGGGAAGCCACTGAAGG + Intergenic
1107637676 13:42409051-42409073 ATCAGAAGAGAAGACACTGAAGG - Intergenic
1107835594 13:44410208-44410230 ATCCCCAGGGAAGACTCTGAGGG - Intergenic
1109290842 13:60473480-60473502 GTGCCAAGGCAAGAGACCGAGGG + Intronic
1111215320 13:85133527-85133549 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1112431001 13:99350242-99350264 GTGCCGAGGTAAGAAACTGAAGG - Intronic
1112554831 13:100457269-100457291 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1112706772 13:102079153-102079175 GTCTCTGGGGAAGAGACTGATGG - Intronic
1114846433 14:26328593-26328615 GTCCTAAGGGAAAAGACTGAGGG + Intergenic
1116976644 14:51123958-51123980 TTCCCAAAGGAAGAAAATGAAGG + Intergenic
1116983660 14:51196682-51196704 CTCCCAAGGGTGGACAATGACGG + Intergenic
1119021882 14:71123317-71123339 GTCCCTAAGGAAGTCATTGAAGG + Intergenic
1119025220 14:71147239-71147261 GTGCCAAGGCAGGAGACTGAGGG + Intergenic
1122693667 14:103542840-103542862 GTCCCCAGGAGAGACGCTGAGGG - Intergenic
1122763935 14:104051735-104051757 TTCTCAAAAGAAGACACTGAAGG - Intronic
1123183579 14:106492328-106492350 GTGCCAAGGTAAGAGACCGAGGG - Intergenic
1202890186 14_KI270722v1_random:149264-149286 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
1123688893 15:22820763-22820785 GGCCCAAGGGGAGCCACTGTGGG - Intronic
1124291315 15:28455965-28455987 CTCCCAAGGGAAGGCGCTGGTGG - Intergenic
1124905368 15:33863091-33863113 GTGCCATGGGAAGGCACAGAAGG - Intronic
1125785853 15:42317095-42317117 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1127390019 15:58497799-58497821 AGCCCAAGGGAGGACCCTGAAGG - Intronic
1127417021 15:58768225-58768247 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1128604210 15:69024069-69024091 GCCCCAGGGTAAGACATTGATGG - Intronic
1129574832 15:76732227-76732249 GTGCCAAGGCAAGAGACCGAGGG + Intronic
1129865338 15:78903196-78903218 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1130011539 15:80156424-80156446 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1130209401 15:81909537-81909559 GACCCAAGGGAAGGCAGGGAGGG + Intergenic
1130914134 15:88291372-88291394 GACACCAGGGGAGACACTGAAGG + Intergenic
1131381517 15:91968086-91968108 GTACCCAGGGAAGCCACTTACGG + Intronic
1132064089 15:98716103-98716125 GTCCCTAGGAAAGGCACTGCTGG - Intronic
1132112214 15:99109901-99109923 GTGCCATGGGAAGCCACTGGAGG + Intronic
1132436338 15:101807311-101807333 GTGTCAAGGGAAGAACCTGAGGG + Intronic
1132985617 16:2765710-2765732 GGCTCCGGGGAAGACACTGAGGG - Exonic
1133934632 16:10258690-10258712 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1135600801 16:23781880-23781902 CCCCCAAGGCAAGACACAGAGGG - Intergenic
1135691969 16:24545422-24545444 GTGCAACAGGAAGACACTGAAGG - Intronic
1136663976 16:31792360-31792382 GTCCCCAGGGCATTCACTGATGG + Intronic
1136707462 16:32201706-32201728 CTCCCAAGGGAAGGCACTGGTGG + Intergenic
1136711730 16:32242967-32242989 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1136756186 16:32686440-32686462 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1136760449 16:32727711-32727733 CTCCCAAGGGAAGGCACTGGTGG - Intergenic
1136807654 16:33142675-33142697 CTCCCAAGGGAAGGCACTGGTGG + Intergenic
1136811927 16:33183933-33183955 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1136818403 16:33294013-33294035 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1136824967 16:33350546-33350568 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1136830033 16:33449317-33449339 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1137229861 16:46554289-46554311 GTGCCAAGGCAAGAGACCGAGGG + Intergenic
1138086495 16:54138614-54138636 GTCTTAAGGGAGGACACAGAGGG + Intergenic
1139068937 16:63356362-63356384 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1140325194 16:73994692-73994714 GTGTCATGGGAAGCCACTGAGGG - Intergenic
1140761278 16:78111212-78111234 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1142222640 16:88863197-88863219 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142222652 16:88863233-88863255 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142364254 16:89641624-89641646 GTGCCAAGGCAAGAGACCGAGGG - Intergenic
1202990505 16_KI270728v1_random:6903-6925 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1203058324 16_KI270728v1_random:946792-946814 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1203062602 16_KI270728v1_random:988026-988048 CTCCCAAGGGAAGGCACTGGTGG - Intergenic
1142546684 17:708927-708949 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG + Intronic
1143142240 17:4747387-4747409 GAGCTAAGGGAAGTCACTGAAGG - Intergenic
1143459467 17:7092244-7092266 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1143500030 17:7333489-7333511 GTGCCAAGGTAAGAGACTGAAGG - Intergenic
1144018504 17:11220053-11220075 ATGCCAAGGGAAGACTTTGAGGG + Intergenic
1144636154 17:16910532-16910554 GGCCCTTGGGAAGAAACTGAAGG - Intergenic
1145415521 17:22710968-22710990 GGTCCAAGGGAGGACCCTGAGGG - Intergenic
1146600044 17:34206168-34206190 GTCCCAAGGGAAGGAAGAGATGG - Intergenic
1146761181 17:35480840-35480862 GTGCCAAGGCAAGAGACTGAGGG + Intronic
1147838394 17:43351707-43351729 GTGCCGAGGAAAGAGACTGAAGG - Intergenic
1147959700 17:44159175-44159197 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1147959875 17:44160664-44160686 GTGCCAGGGCAAGAGACTGAAGG - Intronic
1148401070 17:47362087-47362109 GTGCCGAGGCAAGAGACTGAGGG + Intronic
1149444595 17:56703796-56703818 GTCCCAAGTCTAGACCCTGAGGG - Intergenic
1150627396 17:66850172-66850194 CTTTCAAGGGAAGACACAGAAGG - Intronic
1152773164 17:82183070-82183092 GTGTCAAGGGAGGACCCTGATGG - Intronic
1153529459 18:6030208-6030230 ATTCCAAGGGAGGAAACTGAAGG + Intronic
1153697659 18:7660624-7660646 GGCCCAAGAGAAGAAACTCAGGG - Intronic
1153720016 18:7892157-7892179 GGCCCAAGAGAAGAAACTCAGGG - Intronic
1154098328 18:11441991-11442013 GTCACAGGGGAATCCACTGAAGG - Intergenic
1155940475 18:31797583-31797605 TTCCCAAGGGGAGTCACAGAAGG - Intergenic
1156617267 18:38802188-38802210 GAACTAAGGGAAGACAGTGAAGG - Intergenic
1160651857 19:235184-235206 AACCCAAGGGAAGGCACTGCTGG + Intergenic
1161142681 19:2657781-2657803 GTACCGAGGCAAGAGACTGAGGG + Intronic
1162008208 19:7793599-7793621 GTGCCAAGGCAAGAGACCGAGGG - Intergenic
1162089375 19:8268955-8268977 GTGCCGAGGCAAGAGACTGAGGG + Intronic
1162127714 19:8508255-8508277 GGGCCATGGGAAGCCACTGAAGG + Intergenic
1162236250 19:9311964-9311986 GTGCCAAGGCAAGAGACCGAGGG + Intergenic
1162292613 19:9791551-9791573 GTGCCCAGGCAAGAGACTGAAGG - Intronic
1162319156 19:9960560-9960582 GTCCCCAGAGAAGACAGAGACGG + Intronic
1162638611 19:11989309-11989331 GTGCCAAGGCAAGAGACCGAAGG - Intergenic
1162638687 19:11990175-11990197 GTGCCAAGGCAAGAGACAGAGGG - Intergenic
1163075716 19:14889279-14889301 GTGCCAAGGCAAGAGACCGAGGG - Intergenic
1163235976 19:16031017-16031039 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1163885248 19:19959650-19959672 GTGCCAAGGCAAGAGACTGATGG - Intergenic
1163992060 19:21007948-21007970 GTGCCAAAGCAAGAGACTGAGGG + Intergenic
1165852844 19:38860440-38860462 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1166446886 19:42865915-42865937 GTGCCAAGGCAAGAGACCGAGGG - Intronic
1166472221 19:43088203-43088225 GTGCCGAGGCAAGAGACTGAGGG - Intronic
1166514585 19:43436816-43436838 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1167314228 19:48754742-48754764 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1167392949 19:49208729-49208751 GTGCCAAGGCAAGAGACCGAGGG - Intronic
1167526147 19:49985019-49985041 GTCCCAAGGCAGGAGACTGAGGG - Intronic
1167707672 19:51091187-51091209 GACCCAAGGGAAGACAGAGACGG - Intergenic
1167719658 19:51169765-51169787 GTGCCGAGGCAAGAGACTGAGGG - Intergenic
1167895475 19:52577385-52577407 GTGCCAAGGCAAGAGACTGAAGG + Intronic
1167939060 19:52931652-52931674 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1168058644 19:53878229-53878251 GTGCCCAGGCAAGAGACTGAAGG - Intergenic
1168726345 19:58584258-58584280 GTGACAAGGCAAGAGACTGAAGG + Intergenic
1202665605 1_KI270708v1_random:116096-116118 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
925019933 2:560420-560442 GTCCCAAGGGAGTACAGAGAAGG - Intergenic
926358986 2:12067479-12067501 GCCCCAGGAGGAGACACTGATGG - Intergenic
926474109 2:13301022-13301044 GTCACAAGGAAATACACTGATGG + Intergenic
927430834 2:23025018-23025040 GTCCCATGGGAAGACATGGACGG - Intergenic
928461105 2:31473480-31473502 GTGACAAGGGAAGACATTGGAGG + Intergenic
930662120 2:54064677-54064699 GTACAAAGGGAAGACATTTAAGG + Intronic
930813586 2:55568931-55568953 GTGCCGAGGCAAGAGACTGAGGG + Intronic
931066202 2:58590234-58590256 TTCCCAAATGAAGAAACTGAGGG - Intergenic
931085192 2:58822490-58822512 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
931116545 2:59172515-59172537 GTGCCCAGGCAAGAGACTGAAGG + Intergenic
931536944 2:63288095-63288117 ATGCCAAGGGAAGGCACAGATGG + Intronic
931646731 2:64429474-64429496 GACCTCAGGGAAGACCCTGAAGG - Intergenic
931838806 2:66127763-66127785 TTCCCAAGGGAAAGCACTCAGGG - Intergenic
932342878 2:70977825-70977847 GTGCCAAGGCAAGAGACCGAGGG - Intronic
932839432 2:75067901-75067923 GTGCCAAGTAAAGTCACTGAAGG + Intronic
933328030 2:80863467-80863489 GCCCCAGGGGCAGACACTGGAGG - Intergenic
935688438 2:105708468-105708490 GTCCCAGATGAAGACAGTGATGG - Intergenic
936144361 2:109969759-109969781 GTGCCAAGGCAAGAGACTGAAGG + Intergenic
936181044 2:110267719-110267741 GTGCCAAGGCAAGAGACTGAAGG + Intergenic
936200327 2:110401710-110401732 GTGCCAAGGCAAGAGACTGAAGG - Intergenic
940335137 2:152518901-152518923 GTGCCACGGGAAGCCATTGAAGG - Intronic
940357047 2:152754894-152754916 GTGCCAAGGCAAGAGACCGAGGG + Intronic
942286663 2:174424310-174424332 GTCCCCAGGGAAGACAGGCATGG + Intronic
945019581 2:205557494-205557516 TTCCCAAGGGGATGCACTGAGGG + Intronic
946240846 2:218354595-218354617 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
947130563 2:226919586-226919608 GTGCCAAGAGAATACACTGGGGG - Intronic
948292969 2:236841071-236841093 GTCCCAGGGGAGGAGACCGATGG + Intergenic
948613587 2:239184720-239184742 GTCTCCAGGACAGACACTGAGGG - Intronic
948613611 2:239184804-239184826 GTCTCCAGGACAGACACTGAGGG - Intronic
948613635 2:239184888-239184910 GTCTCCAGGACAGACACTGAGGG - Intronic
948902953 2:240965374-240965396 CTCCCAGGTGAGGACACTGAAGG + Intronic
949027314 2:241772632-241772654 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1168770085 20:408907-408929 GTACCAAAGGAGGAAACTGATGG - Intronic
1168882122 20:1216027-1216049 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1169163967 20:3407202-3407224 GTCCCTAGGGAAGCCATTGTGGG + Intronic
1169179780 20:3553554-3553576 GTCCAAAGGCAAGACACTGATGG - Intronic
1170388112 20:15842264-15842286 GTCCCTAGGATATACACTGATGG + Intronic
1172352664 20:34255477-34255499 GTGCCAAGGCAAGAGACCGAGGG + Intronic
1177173315 21:17677473-17677495 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1177772532 21:25532407-25532429 GTGCCAAGACAAGAGACTGAAGG - Intergenic
1178458815 21:32782091-32782113 AACCCAAGAGAAGAGACTGAAGG - Intergenic
1178599408 21:33983163-33983185 CTCCCAGGAGAAGTCACTGAGGG - Intergenic
1178885545 21:36482059-36482081 GACCCAAGGGCAGACGTTGATGG - Intronic
1179276030 21:39892404-39892426 GTGCCAAGGCAAGAGACTGAAGG - Intronic
1179469659 21:41602125-41602147 GTCCCAAGGGGAGGGACAGAAGG - Intergenic
1179597734 21:42454061-42454083 CTCCCAAGGCAAGACACAGCCGG + Intergenic
1180201148 21:46225037-46225059 GTGCCAAGGCAAGAGACCGAGGG + Intronic
1180332320 22:11493016-11493038 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
1180623836 22:17180652-17180674 GTTTAAAGGGAAGAGACTGAGGG + Exonic
1182437474 22:30340003-30340025 TCCCCAAAGGCAGACACTGAAGG - Intronic
1184133612 22:42532788-42532810 GTGCCGAGGCAAGAGACTGAGGG + Intergenic
1184136373 22:42552478-42552500 GTGCCAAGGCAAGAGACCGAGGG - Intergenic
1184546112 22:45169427-45169449 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1184891862 22:47384714-47384736 GTCCCAGAGGAAGACACACACGG - Intergenic
1185310605 22:50152225-50152247 GTCCCTCGGGGAGACACTGCTGG - Intronic
1185355704 22:50368635-50368657 GTGCCAAGGCAAGAGACTGAGGG - Intronic
1185386485 22:50533889-50533911 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
950584379 3:13881882-13881904 GTCCTAAGGGAACACACTGTGGG + Intergenic
950845585 3:16012579-16012601 GGCCCTAGGGAAGACAATGATGG + Intergenic
951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG + Intronic
952912434 3:38202565-38202587 GTGCCGAGGCAAGAGACTGAAGG + Intronic
953171779 3:40513634-40513656 GTGCCAAGGCAAGAGACTGAGGG + Intronic
953756221 3:45647949-45647971 ATGGCAATGGAAGACACTGAAGG - Intronic
953900190 3:46835958-46835980 GTGCCCAGGCAAGAGACTGAAGG - Intergenic
956580018 3:70800175-70800197 GAACAATGGGAAGACACTGAAGG - Intergenic
957089455 3:75714589-75714611 GTGCCGAGGCAAGAGACTGAGGG - Intronic
957090299 3:75723407-75723429 GTGCCAACGCAAGAGACTGAGGG + Intronic
959398916 3:105875357-105875379 TTTTCAAGGGAAGATACTGAAGG + Intergenic
959575559 3:107929199-107929221 GTGCCATGGGAAGGCACTGAAGG - Intergenic
961002608 3:123384183-123384205 GCCCCAAGAAAAGACCCTGAGGG + Intronic
963405205 3:144854502-144854524 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
964101344 3:152991924-152991946 GTGCCGAGGCAAGAGACTGAGGG + Intergenic
964159713 3:153632195-153632217 GTTCAATGGGGAGACACTGAGGG + Intergenic
965755524 3:172022306-172022328 GACCCAAGGGAAAAAACTAATGG - Intergenic
966962587 3:184954752-184954774 GTGCCGAGGCAAGAGACTGAAGG + Intronic
968350853 3:198050693-198050715 GTGCCGAGGCAAGAGACTGAGGG + Intergenic
968404784 4:330540-330562 GTGCCGAGGCAAGAAACTGAGGG - Intergenic
968680140 4:1912921-1912943 GTGCCAAGGCAAGAGACTGAAGG + Intronic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
969045787 4:4335693-4335715 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
969118182 4:4887571-4887593 CTCCCCTGGGAAGAAACTGAAGG - Intergenic
970790034 4:19846436-19846458 GTCCAAATGGAAGAACCTGAGGG + Intergenic
971480354 4:27109230-27109252 GCCCCAGGGGAAGTCACTCAAGG - Intergenic
972557880 4:40198611-40198633 GTCCTAAGGGAAGACAGTAGAGG - Intronic
973266761 4:48218970-48218992 GTGCCAAGGCAAGAGACTGAAGG + Intronic
975377875 4:73666402-73666424 GTGCCAAGGCAAGAGACCGAGGG - Intergenic
977310312 4:95378158-95378180 TTCCCAAAGGAATACGCTGATGG + Intronic
978053820 4:104238175-104238197 GTGACAAGGGAAGAAACTGGTGG - Intergenic
978308171 4:107354767-107354789 GTGCCAAGGCAAGAGACCGACGG - Intergenic
979255011 4:118599942-118599964 AACCCAAGGGAAGGCACTGCTGG - Intergenic
980007553 4:127559266-127559288 AAGCCAAGGGGAGACACTGAGGG + Intergenic
982915896 4:161208924-161208946 GTGCCAAGAAAATACACTGAAGG + Intergenic
984273935 4:177584655-177584677 GTCACAGGAGAAGACAGTGATGG - Intergenic
984760361 4:183357823-183357845 AAGCCAAGGGAAGACCCTGAAGG + Intergenic
985882727 5:2652567-2652589 GAGACATGGGAAGACACTGAGGG - Intergenic
987176188 5:15313008-15313030 GTCTCAGGGGAAGTCACTGGAGG - Intergenic
987500193 5:18698982-18699004 GTGCCAAGGCAAGATACTGAAGG - Intergenic
992270150 5:75054771-75054793 GTCCCATGGGGAGAAAATGAAGG - Intergenic
992369878 5:76131970-76131992 GGCTCAAGTGAAGCCACTGAGGG + Exonic
992524153 5:77590421-77590443 GCCCCAAGGGACCACACAGATGG + Intronic
994186851 5:96824436-96824458 GTGTCAAGGGAAGTCATTGAGGG - Intronic
994388615 5:99162869-99162891 GTCTCAGGGGAAGGCACAGAAGG - Intergenic
994855977 5:105119620-105119642 GGCCCAATTGAAAACACTGAAGG - Intergenic
995294406 5:110502574-110502596 GTGCAAAGGGAAGTCACTGGAGG - Intronic
996184440 5:120458725-120458747 GTGCCAAGGTAAGAGACCGAGGG - Intergenic
996324629 5:122258777-122258799 GTCCCAAGGGGAGACTTTGGTGG + Intergenic
998153281 5:139769396-139769418 GTCCCAATGGAGGGCACTCAGGG + Intergenic
998370455 5:141657437-141657459 GTTCAATGGGAAGCCACTGAAGG + Intronic
998399444 5:141840963-141840985 ATCACAAGGGAAGTCCCTGAGGG - Intergenic
998892112 5:146757238-146757260 GTACAAAGGGAAGCCACAGAAGG + Intronic
999069957 5:148733959-148733981 GTGCAAAGGGAAGTCACAGAAGG - Intergenic
999130284 5:149277762-149277784 ATTCCAAATGAAGACACTGAAGG - Intronic
1000171442 5:158706683-158706705 CCACCAAGGGAAGACACTGTGGG + Intronic
1000555153 5:162717232-162717254 TTCCCAAGGGAAGAGCCTAAAGG - Intergenic
1001559035 5:172657343-172657365 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1001994688 5:176146921-176146943 GTCCGAATGCAAGACAATGAAGG + Intergenic
1002336009 5:178478756-178478778 GTAGCCAGGAAAGACACTGATGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002725199 5:181290008-181290030 AACCCAAGGGAAGGCACTGCTGG - Intergenic
1002823384 6:750239-750261 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1004178692 6:13362821-13362843 GACCCTAGGGAGGACAATGAAGG + Exonic
1004608729 6:17218565-17218587 GTCCCATGGGAAGCCACATATGG - Intergenic
1005586449 6:27280734-27280756 GCTCGAAGGGAAGAAACTGAGGG + Intergenic
1005922101 6:30411326-30411348 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1006368774 6:33632060-33632082 GTGCCAAGGCAAGAGACTGAAGG - Intronic
1006484568 6:34328127-34328149 GTGCCGAGGCAAGAGACTGAAGG - Intronic
1007289521 6:40774833-40774855 AGCCCAAGTGGAGACACTGAGGG - Intergenic
1007551681 6:42734698-42734720 GTGCCAAGGCAAGAGGCTGAAGG - Intergenic
1009640379 6:66327957-66327979 TGGCCAATGGAAGACACTGAGGG - Intergenic
1013545275 6:111150729-111150751 TTCCCAGGAGTAGACACTGAGGG + Intronic
1014798138 6:125748901-125748923 GACCCAATGGAAGTAACTGATGG + Intronic
1016989154 6:149917688-149917710 GTGCCAAGGCAAGAGACTGAAGG - Intronic
1017717671 6:157223704-157223726 CTCCCAAGGGAACACAGAGAAGG + Intergenic
1018768356 6:166951816-166951838 GTGCCAAGGCAAGAGACCGAGGG - Intronic
1018970552 6:168525862-168525884 GACCAAAGGGAAGTGACTGAGGG - Intronic
1019093103 6:169556300-169556322 GTCCCCAGGGAAGCCTCAGAAGG + Intronic
1019423259 7:961593-961615 GTGCCAAGGCAAGAGACTGAAGG - Intronic
1020181016 7:5922505-5922527 GGCCCCAGGGTGGACACTGAGGG + Intronic
1020301917 7:6802383-6802405 GGCCCCAGGGTGGACACTGAGGG - Intronic
1022639228 7:32165677-32165699 GTGTCAAGGGAAGAATCTGATGG - Intronic
1022927150 7:35068209-35068231 GTGCCAAGGGAAGAACCTGGTGG + Intergenic
1023019094 7:35994376-35994398 GTGCCCAGGAAAGGCACTGATGG - Intergenic
1023817565 7:43962159-43962181 GCCCCAAGGGAAAAAACTGGAGG - Intergenic
1024070109 7:45777631-45777653 AACCCAAGGGAAGGCACTGCCGG - Intergenic
1024455687 7:49604562-49604584 GTCCCCAGGGAAGCCACTTCCGG + Intergenic
1024456495 7:49614493-49614515 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1025263718 7:57439347-57439369 GTCCCAAGGCAAGAGACCCAAGG + Intergenic
1026406548 7:70071998-70072020 GGCCCAAGGGAAAACTCTGCAGG + Intronic
1026870069 7:73845434-73845456 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1027212859 7:76164778-76164800 AACCCAAGGGAAGGCACTGCCGG + Intergenic
1028375119 7:90137383-90137405 GTGCCAAGGGAAGAACCTGGTGG - Intergenic
1028972533 7:96875278-96875300 GTCCCCAGGGAAAATCCTGAGGG + Intergenic
1029113131 7:98223529-98223551 GTCCCAAGGGAAGAAGCAGTGGG - Intronic
1029742190 7:102497033-102497055 GCCCCAAGGGAAAAAACTGGAGG - Intronic
1029760179 7:102596198-102596220 GCCCCAAGGGAAAAAACTGGAGG - Intronic
1030453998 7:109749167-109749189 GTCCCTAGGGAAGACAATAGGGG + Intergenic
1032047500 7:128621914-128621936 AACCCAAGGGAAGGCACTGCCGG - Intergenic
1033509515 7:142040977-142040999 CTCCCAAGGGAAGAGACTTTTGG - Intronic
1034484555 7:151350728-151350750 GTGCCAAGGCAAGAGACCGAGGG - Intronic
1034579532 7:152030552-152030574 GTGCCGAGGCAAGAGACTGAGGG - Intronic
1034897157 7:154884983-154885005 CTCCGAAGGGAAGACCCCGAGGG - Intronic
1035324315 7:158055009-158055031 GTGCCGAGGCAAGAGACTGAGGG + Intronic
1035405162 7:158592039-158592061 GTACCAGGGGAATACACAGAAGG + Intergenic
1035432753 7:158834570-158834592 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1036991906 8:13607724-13607746 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1037252805 8:16916959-16916981 GTGACAAAGGAAGATACTGAGGG - Intergenic
1039179312 8:34847001-34847023 GTTGAAAGGGAAGCCACTGAGGG - Intergenic
1039516713 8:38139928-38139950 GTTCCAAGGGAAGACCGGGAGGG - Exonic
1039704799 8:39995574-39995596 GTGCCAAGGCAAGAGACAGAGGG + Intronic
1039805545 8:40994544-40994566 GTCCCAAGTGAAAAAGCTGAGGG + Intergenic
1041414387 8:57591473-57591495 GTGCCAGAGAAAGACACTGAAGG + Intergenic
1041650151 8:60294260-60294282 GTGCCGAGGTAAGAGACTGAAGG + Intergenic
1042653221 8:71066427-71066449 GACAGAAGAGAAGACACTGAAGG + Intergenic
1042933976 8:74040300-74040322 GTGCCAAGGCAAGAGCCTGAAGG - Intergenic
1042936720 8:74066728-74066750 GACCCAAGGCAAGAGACTGGAGG + Intergenic
1044159754 8:88898678-88898700 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1044270536 8:90237733-90237755 GTCCCACGGGATGACAAGGAGGG + Intergenic
1045307228 8:100968651-100968673 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1045562385 8:103277575-103277597 GTGCCAATGGAAAGCACTGATGG - Intergenic
1046212763 8:111100458-111100480 GTGCCAAGGTAAGAGACCGAGGG + Intergenic
1046413919 8:113885084-113885106 GTGCCGAGGCAAGACACTAAAGG - Intergenic
1046638834 8:116703028-116703050 GTGCCAAGGCAAGAGACTGAAGG + Intronic
1046729484 8:117709767-117709789 GAGCCAAGGGGAGACACTGAAGG - Intergenic
1046803640 8:118456050-118456072 GTGCAAAGGAAAGCCACTGAAGG - Intronic
1048232680 8:132659207-132659229 TGCCCATGGGAAGACACAGATGG - Intronic
1048553471 8:135455068-135455090 GTCTGAATGGAAGACACAGAGGG + Intergenic
1049062930 8:140290163-140290185 GTCCCCAGGCAAGGCCCTGAGGG - Intronic
1049458810 8:142710733-142710755 GTGCCAAGGCAAGAGACCGAGGG - Intergenic
1049634980 8:143683124-143683146 GTGCCTAGGCAAGAGACTGAAGG + Intergenic
1049768205 8:144365363-144365385 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1049846721 8:144806067-144806089 GTGCCAAGGCAAGAGACCGAGGG - Intronic
1049879973 8:145055147-145055169 GTGCCGAGGAAAGAGACTGAGGG + Exonic
1052750486 9:32484751-32484773 GGGCCAGGGGAAGACAGTGAAGG - Intronic
1053276466 9:36787168-36787190 GTGACATGGGAAGACACTGGGGG + Intergenic
1055438831 9:76319290-76319312 GTGCCGAGGCAAGAGACTGAAGG + Intronic
1055476188 9:76665859-76665881 GTGCCAAGGCAAAAGACTGAGGG + Intronic
1056243283 9:84669924-84669946 GCCCCAGGGGGAGACAGTGAGGG - Intronic
1056933953 9:90901466-90901488 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1057549209 9:96039716-96039738 CACCCAAGAGAAGACTCTGAAGG + Intergenic
1057554405 9:96076159-96076181 GTGCCAAGGCAAGAGACCGAGGG + Intergenic
1058294981 9:103294969-103294991 GTGCCAAGGCAAGAGACTGAAGG - Intergenic
1058875821 9:109244004-109244026 TTCCCAAGGGAAGAGGCGGAAGG + Intronic
1061785466 9:133025198-133025220 GTGCCAAGGCAAGAGACCGAGGG + Intergenic
1061873522 9:133532926-133532948 GAGCCAAGAGAAGACACTGGGGG + Intronic
1061884386 9:133584238-133584260 GTCCCCAGGGAGGAGGCTGAAGG - Intronic
1062173920 9:135150481-135150503 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1062377756 9:136271051-136271073 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1203487267 Un_GL000224v1:68378-68400 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
1203499888 Un_KI270741v1:10278-10300 GTGCCAAGGCAAGAGACTGAGGG - Intergenic
1185981585 X:4785621-4785643 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1187310568 X:18137364-18137386 CGCCCAAGGGAAGAAACTGTTGG - Intergenic
1187622846 X:21077867-21077889 CTCTGAAGGGTAGACACTGAGGG + Intergenic
1187672926 X:21686434-21686456 GTGCCGAGGCAAGAGACTGAAGG + Intergenic
1188955739 X:36433591-36433613 GTGCCGAGGTAAGAGACTGAAGG - Intergenic
1190284885 X:48955390-48955412 GCCCCAAGGGAAGAGTCTCAGGG + Intronic
1190511530 X:51178220-51178242 GTGCCGAGGCAAGAGACTGAAGG - Intergenic
1193336736 X:80298548-80298570 GTGCATTGGGAAGACACTGAAGG + Intergenic
1197986321 X:132269715-132269737 GTCAGGAGGGAAGACCCTGAAGG - Intergenic
1198272280 X:135066097-135066119 GTGCCAAGGCAAGAGACCGAGGG + Intergenic
1199406261 X:147464583-147464605 GTGCCAAGGACAGACACTCAGGG - Intergenic