ID: 1143104249

View in Genome Browser
Species Human (GRCh38)
Location 17:4520437-4520459
Sequence CTCGTCACCCCCCCGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143104237_1143104249 17 Left 1143104237 17:4520397-4520419 CCGGGGTCTGGCGAAGGTCTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1143104249 17:4520437-4520459 CTCGTCACCCCCCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143104249 Original CRISPR CTCGTCACCCCCCCGGGAGG GGG Intronic
901203165 1:7478100-7478122 CTCGGCAGCCCCCTGGGAAGTGG + Intronic
901391715 1:8950360-8950382 CTCATGACCACCCCAGGAGGGGG + Intronic
901635767 1:10669522-10669544 CTCATCACCCCCTCCGTAGGCGG + Intronic
901686142 1:10944638-10944660 CTCTTCACCCCCCAGGCGGGCGG - Intergenic
903186895 1:21634050-21634072 CCCCCCCCCCCCCCGGGAGGGGG - Intronic
903857414 1:26345220-26345242 CTCATCTCCCACCCGGAAGGAGG - Exonic
905472814 1:38206331-38206353 CTCATAACCACCCTGGGAGGTGG + Intergenic
907444344 1:54498503-54498525 CTCTCCACCCCCCAGGGAGCAGG + Intergenic
915284925 1:154846449-154846471 AGCGTCTGCCCCCCGGGAGGAGG + Intronic
915325945 1:155081121-155081143 CACGTGACCCCCCCAGGAGGCGG - Intronic
922339086 1:224641237-224641259 CTCTTCCCCTCCCCGGCAGGTGG - Intronic
1067733820 10:48833571-48833593 CTCGTCACTCCCCCATGAGAAGG - Intronic
1070156709 10:73839858-73839880 CTCATGACCCCCTCCGGAGGAGG + Intronic
1070589069 10:77788778-77788800 CTCATCAACCCCACAGGAGGTGG + Intergenic
1074818556 10:117163051-117163073 CCCGTGCCCCCTCCGGGAGGTGG + Intergenic
1076373828 10:129970885-129970907 CTCCTCTCCCCCCAGGAAGGCGG + Intergenic
1077525346 11:3060865-3060887 CTTGGGACCCCCCCGGGAGTTGG - Intergenic
1079689915 11:23405794-23405816 CTCCTCACCTCCCCGGGCTGCGG - Intergenic
1080735380 11:35008956-35008978 CGCTTGAACCCCCCGGGAGGTGG - Intronic
1081538774 11:44014970-44014992 ATCATCACATCCCCGGGAGGAGG - Intergenic
1083618194 11:64036480-64036502 CGCTGCACCCCCCAGGGAGGGGG + Intronic
1085302891 11:75468676-75468698 GACGCCCCCCCCCCGGGAGGTGG + Intronic
1091715984 12:2776515-2776537 CTCGTCCCACCCTTGGGAGGCGG + Intergenic
1094147321 12:27244221-27244243 CTCGCCCCGCCCCCGGGAGGTGG - Exonic
1097057456 12:56258386-56258408 CTCGCCCGCCCCCCGGTAGGCGG - Exonic
1106760163 13:32859997-32860019 CTCCTCACAGCTCCGGGAGGAGG - Intergenic
1115399285 14:32939252-32939274 CACGCCCCCCACCCGGGAGGGGG + Intronic
1122139281 14:99652690-99652712 CTCGTCACCCTCCCAGGGCGAGG - Exonic
1122228198 14:100291832-100291854 CCCACCACCCCCCCGGGTGGAGG + Exonic
1122608735 14:102966375-102966397 CTCGTCACTGACCCTGGAGGAGG + Exonic
1128279984 15:66386857-66386879 CTCGCCTCCCACCCGGGATGCGG - Exonic
1129107338 15:73319133-73319155 CCCGTCGCCACCCCAGGAGGGGG + Intergenic
1132580326 16:681778-681800 CTGGTCAACCCCCAGGGAGCTGG + Exonic
1137395191 16:48112099-48112121 CTTGTCACACCTCCAGGAGGGGG - Intronic
1137787924 16:51152434-51152456 CGCGTCACTCCGCGGGGAGGCGG + Intergenic
1141989451 16:87602153-87602175 CTCGGCCCCCTCCCGGGAGCTGG - Intronic
1143104249 17:4520437-4520459 CTCGTCACCCCCCCGGGAGGGGG + Intronic
1143750274 17:9022242-9022264 CTCGCCACCCCGCCGAGAGCTGG + Intronic
1145985395 17:29042707-29042729 CTCACCACCCACCAGGGAGGTGG + Intronic
1146653740 17:34623159-34623181 CCCCTCACCCCCCCTGGGGGAGG - Intronic
1147602919 17:41757015-41757037 CTCGGTACTCCCCAGGGAGGAGG + Intronic
1151187355 17:72374020-72374042 CTCTCCACCCCCCTTGGAGGTGG + Intergenic
1152111305 17:78359169-78359191 CTCCGCAGCCCCCCGGGATGCGG - Exonic
1152834448 17:82520132-82520154 ATCTTCACGCCCCCGGGCGGCGG + Exonic
1154016170 18:10619890-10619912 CTCGGCAACCCCCTGTGAGGAGG + Intergenic
1154189344 18:12215759-12215781 CTCGGCAACCCCCTGTGAGGAGG - Intergenic
1159900548 18:74040893-74040915 CTCCTCACCCCGCCAGCAGGGGG + Intergenic
1161681298 19:5681091-5681113 CCCGGCCCCTCCCCGGGAGGAGG + Exonic
1164517665 19:28949781-28949803 CTCATCACCCCCTCAGCAGGGGG - Intergenic
1166337408 19:42116787-42116809 CAGGTCACCCCCCCCAGAGGAGG + Intronic
1167307947 19:48719779-48719801 CCCGTCACACCCCAGGAAGGTGG - Intergenic
925836367 2:7950872-7950894 CTCATCACCGCCCTGGGAGGTGG - Intergenic
927596735 2:24403392-24403414 CTCCTCAGCCCCCTGGGTGGTGG - Intergenic
932596164 2:73094816-73094838 CTCATCCCTCCCCCAGGAGGGGG + Intronic
948941698 2:241200046-241200068 CTCCTCCCACTCCCGGGAGGAGG - Intronic
949031052 2:241797710-241797732 CTCTTCACCCTCCCGGGACGTGG - Intronic
1168943879 20:1735751-1735773 GACGTCGCCCACCCGGGAGGAGG + Intergenic
1172225346 20:33301897-33301919 CCCGTCAGTCACCCGGGAGGAGG - Intronic
1173880219 20:46406367-46406389 CTCGTCAGGCCCCCGAGGGGTGG - Intronic
1174112558 20:48206305-48206327 CTCCTCACTCCCCCGGAATGGGG - Intergenic
1174282253 20:49447685-49447707 CTCGTAGCCACCCCGGGAAGCGG - Intronic
1179891857 21:44339234-44339256 GTCGTCACCCGCCCGGGATCAGG - Exonic
1181506801 22:23363973-23363995 CTCATCACCACCCTGGCAGGAGG - Intergenic
1181811227 22:25405009-25405031 CTCCTCACCGGCCCGGGACGCGG + Intronic
1182366683 22:29783901-29783923 CTCCCCACCCCCAGGGGAGGGGG + Intergenic
1182583148 22:31327360-31327382 CTCATGACCCCTCCAGGAGGGGG - Intronic
950849801 3:16051496-16051518 CTCTTCACCCACCAGAGAGGAGG - Intergenic
952905930 3:38139050-38139072 CTCCTCACCCCCCAGGTACGAGG - Intronic
961061752 3:123834495-123834517 CTCATCACCCATCCTGGAGGTGG + Intronic
961438905 3:126939170-126939192 CTCGCCACACCCCGGGGTGGTGG - Intronic
962250529 3:133833424-133833446 TTCCTGACCCCCCCGGGGGGTGG + Intronic
968634833 4:1672443-1672465 CTCCCCACCACCCCGTGAGGAGG - Intronic
969429581 4:7146322-7146344 CACGTCCCCCCACCGGGCGGAGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
984630098 4:182052002-182052024 CTTGTCACCGCCTGGGGAGGGGG + Intergenic
985556097 5:558734-558756 CTGCTCAGCGCCCCGGGAGGCGG - Intergenic
985556116 5:558807-558829 CTGCTCAGCGCCCCGGGAGGCGG - Intergenic
985556136 5:558880-558902 CTCCTCAGCGCCCCAGGAGGCGG - Intergenic
985733632 5:1565162-1565184 CTCCTCACCCCTCCTGGAGCCGG + Intergenic
989812597 5:45695957-45695979 CTGGGCACCCCGCCGGGGGGCGG - Exonic
996937392 5:128965131-128965153 CTGCTCACACCCCAGGGAGGAGG - Exonic
997441776 5:133913584-133913606 GTCGTCACCACGCTGGGAGGTGG + Intergenic
1000530730 5:162416600-162416622 CTCGTGATCCACCCGGAAGGCGG - Intergenic
1006118948 6:31792384-31792406 CGCCTCACCTCCCCTGGAGGTGG + Exonic
1006642560 6:35496676-35496698 CTCCCCACCCCCCCGCGACGGGG - Intronic
1006644430 6:35506137-35506159 CCCGTCTCCCCCCGTGGAGGTGG - Exonic
1007818038 6:44538686-44538708 CTCTTCACCCTCCCCGGAGTGGG + Intergenic
1011638620 6:89399188-89399210 CTCGCCACCCTCCCAGGAGGAGG - Intronic
1017161054 6:151366404-151366426 TTGGTCTCCTCCCCGGGAGGAGG + Exonic
1023601321 7:41884333-41884355 CTTGTCACCGCCCCATGAGGCGG + Intergenic
1024645336 7:51366305-51366327 CTCTTCACCCCGCCTGGGGGAGG - Intergenic
1037802769 8:22044265-22044287 CCCCTCACCCCCCTGGGAGGGGG + Intronic
1038611200 8:29061499-29061521 CTCTACAGCCCCCCGGGAAGTGG - Intronic
1039752697 8:40492849-40492871 CTGGTGACCCCCCTGAGAGGAGG + Intergenic
1051288363 9:15519527-15519549 CCCCTGACCCCCCCGGGAGTAGG - Intergenic
1056532487 9:87498834-87498856 CTCCTCTCCACCCCGCGAGGAGG + Intronic
1056534591 9:87516700-87516722 CTCTTCAGCCCCCTGGCAGGAGG + Intronic
1057562639 9:96140272-96140294 CTCGCCATCACCCTGGGAGGTGG + Intergenic
1057869865 9:98709203-98709225 CTCGTCCCCGTCCCTGGAGGCGG - Intergenic
1057922114 9:99105554-99105576 CTCGGGACTCCCCGGGGAGGTGG + Intronic
1060105297 9:120869323-120869345 CTCGTCTCCCCCCAGAAAGGCGG - Exonic
1061050853 9:128193884-128193906 ATCCTTACCACCCCGGGAGGGGG - Intronic
1061495763 9:130973421-130973443 CTCCTGTCCCACCCGGGAGGTGG - Intergenic
1062093161 9:134689167-134689189 CTCGGCACTGCCACGGGAGGAGG - Intronic
1190055729 X:47180079-47180101 CTCGTCTCCACCCCGGGGGCCGG - Intronic
1195011022 X:100732110-100732132 CTTCTCACCCTCCCGGGAGGCGG + Intronic
1198530916 X:137549241-137549263 CTCGTCTCTCCTCCGGGAGCCGG + Intergenic
1199767953 X:150954160-150954182 CTCCCCACCCCCCAGGCAGGAGG - Intergenic
1200100572 X:153687753-153687775 GGCGTCTCCTCCCCGGGAGGAGG + Intronic