ID: 1143107521

View in Genome Browser
Species Human (GRCh38)
Location 17:4536979-4537001
Sequence CCTGGCCTTCCCCTTTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 402}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143107521_1143107525 -10 Left 1143107521 17:4536979-4537001 CCTAAGGAAAGGGGAAGGCCAGG 0: 1
1: 0
2: 1
3: 41
4: 402
Right 1143107525 17:4536992-4537014 GAAGGCCAGGGTTAGGCAACAGG 0: 1
1: 0
2: 2
3: 19
4: 193
1143107521_1143107526 -9 Left 1143107521 17:4536979-4537001 CCTAAGGAAAGGGGAAGGCCAGG 0: 1
1: 0
2: 1
3: 41
4: 402
Right 1143107526 17:4536993-4537015 AAGGCCAGGGTTAGGCAACAGGG 0: 1
1: 0
2: 0
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143107521 Original CRISPR CCTGGCCTTCCCCTTTCCTT AGG (reversed) Intronic
900879728 1:5372183-5372205 CCTTGCCTTTCCCTTGCCCTTGG - Intergenic
902560346 1:17273402-17273424 CCTGCAGTTCCCCATTCCTTGGG - Exonic
903870356 1:26429661-26429683 CCTTCCCTTCTCCTTTCCCTGGG + Exonic
904363168 1:29991629-29991651 CCTGCCCTTCCCTCTTCCTCTGG - Intergenic
904425573 1:30420640-30420662 CCTTGCCTTGCCTTCTCCTTGGG - Intergenic
905297593 1:36963985-36964007 CCAGGCCTTTGCCTGTCCTTAGG - Intronic
905335807 1:37243846-37243868 TCGGGCCCTTCCCTTTCCTTTGG - Intergenic
905336483 1:37248170-37248192 CTTGGCCATCCTCTTCCCTTGGG - Intergenic
906319089 1:44805733-44805755 TGTGGCCTTCCCCCTTCCTTTGG + Exonic
906507696 1:46392656-46392678 CCTCTCCTTCCCCTTCCCCTAGG + Intergenic
907436551 1:54453153-54453175 CCTTGCCTTCCCATTTCTTGTGG + Intergenic
908924386 1:69236626-69236648 ACAGGCCTTCCCTTTTCCTGTGG - Intergenic
910163386 1:84298398-84298420 ACTGGCCTTCCCCATTCCTGGGG + Exonic
910292431 1:85612446-85612468 CCTGGCTTTCACCTTTCTTGTGG + Intergenic
912234650 1:107835925-107835947 GCTGTGCTTCCCCTTCCCTTAGG - Intronic
913121869 1:115749765-115749787 CCTTGCCTCCACCTTTACTTTGG + Intronic
913667201 1:121059211-121059233 CCTGACCATCCACTTTCCTACGG - Intergenic
914018891 1:143846362-143846384 CCTGACCATCCACTTTCCTACGG - Intergenic
914325998 1:146617051-146617073 CCATGCCTTCCCCTTTGATTCGG - Intergenic
914657443 1:149754566-149754588 CCTGACCATCCACTTTCCTATGG - Intergenic
914858987 1:151371462-151371484 CCTGGCATTCTCCTCTCCTCTGG - Intronic
915129588 1:153687474-153687496 TCTGGCCTTCCCTTTTTCATGGG - Intronic
916300716 1:163270903-163270925 CTTGGTCTTTCCCATTCCTTGGG + Intronic
917330771 1:173878413-173878435 CCTTCCCTTCTCCTTTCCCTGGG - Intronic
917518968 1:175732501-175732523 CCAGTCCTACCCCCTTCCTTGGG - Intronic
918241500 1:182624175-182624197 CCTGGCCTCTCCCTGTCCTCAGG - Intergenic
919999865 1:202789530-202789552 CTTTGCCTTTCCCTTTCCTGTGG - Intronic
920214595 1:204353068-204353090 CCTGGCCCTACCATTTGCTTTGG - Intronic
920664280 1:207949737-207949759 GCTGGCCTTCCTGTTTCCTATGG + Intergenic
920819792 1:209369621-209369643 CCTGTCCATCACCTTCCCTTTGG - Intergenic
921576527 1:216841590-216841612 CCTGGCCTGCCACTGTCCTGAGG - Intronic
921995278 1:221411271-221411293 CCTGACCTTCCCATCTCCATGGG + Intergenic
922562273 1:226577940-226577962 CCTGGCCTACCCTTTTCTTTGGG + Intronic
924272286 1:242346106-242346128 CTAGGCATTCTCCTTTCCTTTGG - Intronic
1063403941 10:5774884-5774906 CTTGCCCTTCCCCTTCCCCTGGG - Intronic
1063968860 10:11367587-11367609 CCTGGACTTTCCCTTCCATTTGG - Intergenic
1064769864 10:18712088-18712110 CCTCTCCTTTCCCTTTCCTGTGG - Intergenic
1065810422 10:29438217-29438239 CCTCTCCTTCCCCTTCCCCTAGG + Intergenic
1066712388 10:38250036-38250058 CTAGGCATTCTCCTTTCCTTTGG + Intergenic
1067098624 10:43318808-43318830 CCAGGCCTTCCCATTCCCTCTGG - Intergenic
1067406654 10:46030155-46030177 GCCGGCCTTCCCCTCTCTTTAGG - Intronic
1067664652 10:48266754-48266776 CCTAGACTTCCACTTTCCTCTGG + Intronic
1068753085 10:60619025-60619047 CCAGGCCATCCTCTTTCTTTAGG + Intronic
1071269867 10:83997109-83997131 CCTGTCCTCCCTCCTTCCTTGGG - Intergenic
1071560742 10:86645194-86645216 TCTGGCCTTCCCATTTCCTTAGG - Intergenic
1072694897 10:97595857-97595879 CCTGGCCTTTTCCTCTCCTCTGG + Intronic
1073060517 10:100730787-100730809 CCTGGCTTTCGCCTTTCCCTGGG + Intergenic
1073192828 10:101663975-101663997 CCTTGCCTGCCACTTTCCTTTGG + Intronic
1073633877 10:105177492-105177514 CCAGACCTTCCTCTTACCTTTGG + Intronic
1074035281 10:109732466-109732488 CCTGGAGTTCCCATTTCCTCTGG + Intergenic
1074121313 10:110496327-110496349 ACAGGCCTTCCCCTTCCCTCTGG + Intergenic
1074319578 10:112389320-112389342 CAGGGCCTTCCCCTCTCCTGTGG - Intronic
1074681538 10:115912155-115912177 CCTGGATTTCCCCCTTGCTTTGG - Intronic
1075765247 10:124887785-124887807 CCTGGCCTTACTCTTTCTTAAGG + Intergenic
1077909223 11:6559382-6559404 CCTAAGCTTCCCCTTTCCCTAGG + Intronic
1078320049 11:10326479-10326501 TCTGCCCTTCCCCCTTCCTATGG + Intronic
1078494920 11:11808010-11808032 CCTGTACTTCCCCGCTCCTTGGG - Intergenic
1078742667 11:14081740-14081762 CCTTTTCTCCCCCTTTCCTTTGG - Intronic
1079381981 11:19946203-19946225 CCTGGACTTCACACTTCCTTTGG + Intronic
1080653494 11:34240888-34240910 CCTGGCCTTCCCCCCTTTTTAGG + Intronic
1081068022 11:38571895-38571917 ACTGTCCTTGACCTTTCCTTGGG - Intergenic
1081942361 11:46954853-46954875 CCTTCCCTTCTCCTTTCCCTGGG - Intronic
1082132521 11:48507100-48507122 CCTTGCTTTCCCTTTGCCTTCGG + Intergenic
1082565951 11:54677649-54677671 CCTTGCTTTCCCTTTGCCTTCGG + Intergenic
1082988081 11:59185018-59185040 CCTGGTCTTCCTTTTTCCGTGGG - Intronic
1084040442 11:66539579-66539601 CCTGGCCTCCCCATTGCCTGGGG - Exonic
1084148917 11:67279054-67279076 CCTGGCCCACCCCTTGCCTGGGG + Intronic
1084165898 11:67374601-67374623 CCTGGCATTCTCCTTCCTTTGGG + Intronic
1087640269 11:100749074-100749096 CCTCTCCTTCCCCTTCCCTAGGG + Intronic
1088776830 11:113093461-113093483 CCTGGTCTTCCTCCTTCCTCCGG + Intronic
1088798904 11:113287862-113287884 CCTGGCCATCACTTCTCCTTGGG - Intergenic
1089396059 11:118136822-118136844 CCTGGCCATCCCTTGTCCCTGGG + Exonic
1089505596 11:118959945-118959967 CCTTTCCTTCCTCTTTCTTTTGG - Intergenic
1089852220 11:121509230-121509252 CCTGTGCTTCCCCATGCCTTGGG + Intronic
1090848697 11:130551558-130551580 CAAGCCCTTCCCCTTTCCCTTGG - Intergenic
1091198613 11:133753174-133753196 CCGACCCTTCCCCATTCCTTGGG - Intergenic
1092147111 12:6222342-6222364 CCTGGCCCTCCCTTTTCTCTGGG + Intronic
1092629540 12:10363284-10363306 CCCCTCCTTCCCCTTTCCCTAGG - Intergenic
1092785244 12:12020496-12020518 CCTGGCCATTCCATTGCCTTTGG - Intergenic
1093912191 12:24760796-24760818 CCTGGGTTTCCCCTGTCCTCAGG - Intergenic
1095182204 12:39159002-39159024 CCAGGCCATCCACTTTCCCTAGG - Intergenic
1095739752 12:45593792-45593814 CCTGCCCAGCCCCTTCCCTTGGG + Intergenic
1095955319 12:47802635-47802657 CTTGGCCTTCTTCTTTCCCTCGG - Intronic
1096832240 12:54323499-54323521 CTTGGCTTTCCCCTATCCCTTGG - Intronic
1097836045 12:64273751-64273773 CCTGGCATTCTCTTTTCCTTCGG - Intronic
1100115132 12:91294729-91294751 CCTTGGCTGCCCCTTCCCTTAGG - Intergenic
1103144162 12:118579897-118579919 CCTTTCCTTCCTATTTCCTTGGG + Intergenic
1103215896 12:119201167-119201189 CTTTGCATTCTCCTTTCCTTAGG + Intronic
1103960144 12:124604225-124604247 CCTGGCCATCCCCCTGCCTCAGG - Intergenic
1104711055 12:130986924-130986946 CCTGACTTTCCCCAGTCCTTTGG - Intronic
1104807736 12:131600161-131600183 CCTCACCTTCACCCTTCCTTTGG + Intergenic
1104925530 12:132312325-132312347 CCTGGCCCTCTGCTTCCCTTTGG + Intronic
1106911593 13:34468890-34468912 TGTGCCTTTCCCCTTTCCTTTGG + Intergenic
1107584092 13:41824961-41824983 CTTGGCCTTTTCTTTTCCTTGGG - Intronic
1108524682 13:51276667-51276689 CTTTTCCTTTCCCTTTCCTTTGG - Intronic
1108620589 13:52179690-52179712 TCTGTTCTTCCCCTTTTCTTTGG - Intergenic
1108666161 13:52633357-52633379 CCTATTCTTCCCCTTTTCTTTGG + Intergenic
1108698200 13:52921269-52921291 CGTGGCCTTCACCTTTTCTATGG + Intergenic
1109225636 13:59691229-59691251 TCTAGTCATCCCCTTTCCTTTGG - Intronic
1110042860 13:70787393-70787415 CATGACCCTCCCCTATCCTTAGG + Intergenic
1111531279 13:89541097-89541119 GCTGCCCTTCCCCATTCCATAGG + Intergenic
1111860380 13:93697150-93697172 CCTGGCCCCAGCCTTTCCTTTGG + Intronic
1112199585 13:97261902-97261924 CCTGTCCTTCCCCCTTCTTGAGG + Intronic
1112334577 13:98503525-98503547 CTTGCCCTTGCCCTTTCTTTTGG - Intronic
1112575879 13:100636286-100636308 CCCTCCCTTCCCCTTTCCCTAGG - Intronic
1112844236 13:103618268-103618290 GCTGGCCTGCACCTTTCCTAAGG + Intergenic
1113311457 13:109137224-109137246 CCTGGCCCCCTCCTTCCCTTGGG - Intronic
1117803012 14:59464494-59464516 CCTGGGCTTCTCCTTGCCCTGGG - Exonic
1118314490 14:64717292-64717314 CCTGGCCTTCCCCCTCCCTCAGG - Intronic
1118945192 14:70378954-70378976 CCTTGCCTGCTCCTTTCCTCTGG + Intronic
1119231698 14:72985001-72985023 CCTGGCCCTGCCCTTGCCCTAGG + Intronic
1120115652 14:80614364-80614386 CCAGGCTTACCCCCTTCCTTTGG + Intronic
1120797607 14:88652216-88652238 ACTCTCCATCCCCTTTCCTTAGG + Intronic
1121377919 14:93430898-93430920 CCTCGCTTTCCCCCTCCCTTAGG - Intronic
1121566697 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG + Intergenic
1121602655 14:95217713-95217735 CCTGGCCTTCCCTTTCACCTGGG + Intronic
1122378979 14:101288005-101288027 CCTGGCCATCTCCTTGCCTCAGG - Intergenic
1122604922 14:102941809-102941831 CCTGCCCCTCCCCATCCCTTAGG - Intronic
1123770427 15:23523004-23523026 CCTGGCAATCTCCTCTCCTTTGG - Intergenic
1124580149 15:30946128-30946150 CCAGGCCTTGTCCTTTTCTTTGG + Intronic
1124614432 15:31231321-31231343 CCTTGCCTTCACCTGTCCTTGGG - Intergenic
1124883058 15:33659929-33659951 CCAGGCCCTGCCCTTTCCTGTGG + Intronic
1125417178 15:39466151-39466173 CCTCGCCTTGCTCTTTCCTGTGG + Intergenic
1125609540 15:40961130-40961152 CCTGGCCTCACCCTTGCCTCAGG + Intergenic
1125720822 15:41844417-41844439 CTTGGCCTTCCCCATCCCTAGGG + Intronic
1126738632 15:51755957-51755979 CATGTCCTTCCTCTTGCCTTTGG - Intronic
1127682316 15:61309864-61309886 CTTGGCCTTCTGCTCTCCTTGGG + Intergenic
1128252721 15:66174241-66174263 TCTGGCCTTATCCTTCCCTTTGG - Intronic
1128293106 15:66494418-66494440 CCTGGCTTTCCCCCTCCTTTAGG + Exonic
1128499517 15:68218138-68218160 CCTGTCCTTCCCCATTACCTTGG - Intronic
1129230342 15:74193782-74193804 CCAGGCCTGCCCCTTTACCTTGG + Exonic
1131967418 15:97859065-97859087 CCTGGTTTTCCTCCTTCCTTTGG - Intergenic
1132056013 15:98650304-98650326 CCTGGCCTTGCCCGTCACTTTGG + Intronic
1132196579 15:99918334-99918356 GCTGGCCTTGCCCTTTCTTGCGG - Intergenic
1132484077 16:181235-181257 CCAGGCCCTCGCCTTTCCTTGGG - Intergenic
1132555549 16:570357-570379 CAGGGCCTTCCCCTCTCATTTGG - Intronic
1132573744 16:655519-655541 CCTGGGCCTCCCCTTCCCTGAGG + Intronic
1132761034 16:1508789-1508811 CCTGCCCTTCCCGTGTCCATCGG - Intronic
1132864248 16:2085781-2085803 CCAGGCCCTGCCCTTTCCCTTGG - Intronic
1133575445 16:7084538-7084560 CTTGACATTCCCCTTTCTTTTGG - Intronic
1134609379 16:15596174-15596196 CCTCGCCTACCCTTCTCCTTTGG + Exonic
1135729732 16:24883965-24883987 CCTGGCCTTCCAGGTTCCCTTGG + Intronic
1135765800 16:25176855-25176877 CCTGGCCTTCACATTCCTTTTGG + Intronic
1136024364 16:27460495-27460517 CAGGGCCTTCCCTCTTCCTTTGG + Intronic
1136383246 16:29906836-29906858 CCCTGCCTTCCTCTTGCCTTGGG - Exonic
1136923888 16:34353316-34353338 CCTGCCCTTCCTCTTTCACTGGG - Intergenic
1136980686 16:35058490-35058512 CCTGCCCTTCCTCTTTCACTGGG + Intergenic
1137032100 16:35532991-35533013 CCTGGTCTGCCCCTCTCCTGGGG + Intergenic
1137400064 16:48146122-48146144 CCTTGCCTCCTCCTGTCCTTTGG - Intronic
1138247916 16:55480608-55480630 CCTGGCCTGCCTCTCTCCTCAGG - Intronic
1139642810 16:68305055-68305077 TCTGTCTTTCCCCTCTCCTTAGG - Intronic
1140007568 16:71093891-71093913 CCATGCCTTCCCCTTTGATTCGG + Exonic
1140333113 16:74076743-74076765 CCTGGCCTTGGCCTTTCTCTTGG - Intergenic
1141149218 16:81552593-81552615 CTTTGCCTTCCTCTTTCATTGGG + Intronic
1141524000 16:84599639-84599661 CCTCCCCTTCCCCCTTTCTTTGG - Intronic
1141582845 16:85011879-85011901 CCTTACTTTCCCATTTCCTTCGG - Intergenic
1141891386 16:86928955-86928977 ACTGGCCTTCCACTGACCTTTGG + Intergenic
1142402802 16:89869787-89869809 CCTTGCATTTCCATTTCCTTGGG - Intronic
1142403054 16:89871123-89871145 CTTGCCCTTTCCCTTTCCCTGGG + Exonic
1143107521 17:4536979-4537001 CCTGGCCTTCCCCTTTCCTTAGG - Intronic
1143428018 17:6855577-6855599 GCTGAGCTTCCCCTTGCCTTAGG + Intergenic
1143525243 17:7468073-7468095 CCTGGCCTTGCTCTTCCCTCTGG - Intronic
1144834624 17:18150458-18150480 GCTGGCCTCCCCCTTTCATGCGG - Exonic
1144837872 17:18166807-18166829 CTTTGCATTCCCCTTTCCTTCGG + Intronic
1145988934 17:29066388-29066410 CCTGGGCTTCCCTTTTACTAGGG + Intergenic
1146202395 17:30870992-30871014 TCTGTCCTCCCCTTTTCCTTTGG + Intronic
1146668162 17:34718459-34718481 CCTGGCGTTCTCCATTCCTGTGG - Intergenic
1146724942 17:35148951-35148973 CTTCTCCTTCCCCTTTCCTCAGG + Exonic
1147456038 17:40538721-40538743 GCTTGCCGTCCCCTTTCCTTTGG + Intergenic
1147755154 17:42762648-42762670 CCTGGGCTTCCCCAATCCCTTGG + Exonic
1148050587 17:44768186-44768208 CCTGGCCTTCCCCTGCCCCTGGG - Intronic
1148263532 17:46205780-46205802 CCTGGCCTTTCCATTTAGTTAGG - Intronic
1148370098 17:47092844-47092866 CCTGGCCTTTCCGTTTAGTTAGG - Intergenic
1148747909 17:49928569-49928591 CCTAGCCTGCCCCTTTCCCTCGG - Intergenic
1148798937 17:50211025-50211047 CGTGGCCTCCCCCTTTTCTGCGG - Intergenic
1148822312 17:50366772-50366794 CCTGCCCTTCCCCTTTCTCCAGG + Intergenic
1149573566 17:57695344-57695366 TCTGCCCTGCCCCTTTCCTGGGG + Intergenic
1150007179 17:61477092-61477114 GCTGGCAGTGCCCTTTCCTTGGG - Intronic
1151265830 17:72954336-72954358 CTTGGCCTTGGCCTTTCCTCAGG - Intronic
1151900312 17:77008051-77008073 TCTGGCCTTGCCCTTCCCTCTGG + Intergenic
1151968917 17:77447272-77447294 CCTCCCCTTGCTCTTTCCTTGGG + Intronic
1152123951 17:78435229-78435251 CCAGGCCTTCCCTTGTCCTTGGG - Intronic
1152125801 17:78445793-78445815 CCTGTCCTGCCCCTTTGGTTTGG + Intronic
1203165385 17_GL000205v2_random:88600-88622 CATGGCCTCTCCCTGTCCTTTGG - Intergenic
1154025851 18:10706408-10706430 CCAGGGCTTCCCCTTCCCTGTGG + Intronic
1154325844 18:13389777-13389799 TTTGGCCTTTCCCTTTCCTTTGG - Intronic
1155054174 18:22170457-22170479 CCTGGCGTCCCACTTTCCCTGGG + Intronic
1155322035 18:24629226-24629248 CTTGGCCTTACCCTTGCTTTAGG + Intergenic
1156562159 18:38137514-38137536 CCTGGCCTTGGCCTGGCCTTTGG - Intergenic
1156910000 18:42400473-42400495 CCTCTTCTTCCCCTTTCCTGTGG + Intergenic
1157468422 18:47968401-47968423 CCTGGTCCTCTCCTTTCTTTTGG + Intergenic
1159922343 18:74237456-74237478 CCTGGCCTTCCTCTGCCCTGGGG + Intergenic
1160862990 19:1245456-1245478 CCTGACCTCCTCCCTTCCTTGGG + Intergenic
1161069766 19:2254203-2254225 CCTCTCCTTCCCCGTTCCTGGGG + Exonic
1161705081 19:5816269-5816291 TTTAGCCATCCCCTTTCCTTTGG + Intergenic
1162796671 19:13090768-13090790 CCTAGCCCTCCCCTTTCCCCTGG + Intronic
1164619701 19:29687321-29687343 CCTGGCCTTCCCCTTGCAGCGGG - Intergenic
1165123530 19:33578711-33578733 CCTGGCCACCCCCTTGCCTATGG + Intergenic
1165460075 19:35939259-35939281 CCTGGCCTTCCTCTGGCTTTTGG + Intronic
1167067084 19:47194627-47194649 ACTGGCTGTGCCCTTTCCTTGGG + Intronic
1167568425 19:50271684-50271706 CCTCTCCTTCCCATTCCCTTGGG - Intronic
1167608375 19:50493707-50493729 GGTGCCCTTCCCCTTTCCTAGGG + Intergenic
1167782973 19:51612422-51612444 CCTTTCCTTCCCCTTTACTCAGG - Exonic
1168351297 19:55677669-55677691 CTTGGGCTTCCGCTATCCTTGGG + Exonic
1168694314 19:58396182-58396204 CCTGGTCTTCCCCTCTGCTTGGG - Exonic
925311692 2:2889166-2889188 CTTGGCCTTCTCCTTTCCTGTGG - Intergenic
926056665 2:9777745-9777767 CCTGTCCTTGGCCTTGCCTTTGG + Intergenic
929468915 2:42170957-42170979 TTTGGCCTTCCCTTTTTCTTGGG + Intronic
931201107 2:60097994-60098016 CCTGGCTTAACCCTTTGCTTTGG - Intergenic
931445448 2:62323514-62323536 CCTGGGCTTCCCTTCTCCCTGGG + Intergenic
931750848 2:65328609-65328631 CCTTTCCTTCCCCTCCCCTTGGG + Intronic
933609281 2:84416927-84416949 CCTTGCCTTTCTCTTTCATTTGG + Intergenic
934706306 2:96484091-96484113 TCTGGGCATCCCCTTTCCTGGGG - Intergenic
935081505 2:99801600-99801622 CTTGTACTTCCCATTTCCTTCGG + Intronic
935495950 2:103782111-103782133 CATGGCATTCCCCTTTACTGGGG + Intergenic
937049787 2:118879066-118879088 CCTCCCTTTCCCCTTTCCTGAGG - Intergenic
937379498 2:121363746-121363768 ACAGGCCTTCCACTGTCCTTAGG - Intronic
937899504 2:127007172-127007194 CCCGTGCTTCCCCTATCCTTGGG + Intergenic
938556697 2:132430923-132430945 CCTGGACTTCCCCTTCCCCCTGG + Intronic
940556230 2:155232312-155232334 CCTGGCCTTCTTGTTTGCTTTGG + Intergenic
940811340 2:158246170-158246192 CCTGGCTTTCCCTTTTCCTAAGG - Intronic
941494340 2:166181531-166181553 CCTGCACTTCTCCGTTCCTTAGG - Intergenic
942246216 2:174011766-174011788 CCTGTCCGCCCCCTTTACTTTGG - Intergenic
944292920 2:198028370-198028392 ACTGGCCTTCCCCCTTGCTACGG + Intronic
944435844 2:199688629-199688651 TCTGGTCTTCCCCTGGCCTTAGG + Intergenic
944742888 2:202629451-202629473 CTTGGCTCTCCCCCTTCCTTGGG - Intergenic
944755791 2:202760470-202760492 CTTTGTCTTCGCCTTTCCTTGGG + Intronic
945330392 2:208532969-208532991 TCTGGCCTCCCCCTTTCCTGAGG + Intronic
945813437 2:214575246-214575268 CCTGTCCTTCTCTTTTCCTGTGG - Intronic
946146802 2:217737408-217737430 TCTGGCCTTCCTCTGGCCTTGGG + Intronic
946158074 2:217819999-217820021 CCTGACCTTCTCCTTGCCCTTGG - Intronic
946185259 2:217977306-217977328 CCTTGTCTTCTCCTTTCCTGCGG - Intronic
947744009 2:232498301-232498323 CCTGGCCTTCCCAGGTCTTTGGG - Intergenic
948044812 2:234935523-234935545 CCTGGGCTTCGCCTTTCCCTCGG - Intergenic
948559421 2:238841602-238841624 CTTGGGCTCCCCCTATCCTTTGG - Intergenic
948682882 2:239648367-239648389 CCTGGCCTTCCACTTCTCTTTGG + Intergenic
948758292 2:240172261-240172283 CCTGGCCTGGCCACTTCCTTGGG + Intergenic
1168856507 20:1012942-1012964 CCTCTCCTTCCCATCTCCTTGGG - Intergenic
1169276008 20:4234179-4234201 CCTGGCCATTCCTGTTCCTTAGG - Intronic
1169319224 20:4617578-4617600 GCTGGGCTTTCCCTTTCGTTTGG - Intergenic
1169720163 20:8667526-8667548 CCAGGCCTTTGCCTTTCCTCAGG - Intronic
1169999969 20:11605008-11605030 CCTTCCCTTCTCCTTTCCCTGGG - Intergenic
1170827151 20:19806540-19806562 CCTGTACTTCCCCTTTGCTCTGG + Intergenic
1172123620 20:32612600-32612622 CCAGGCCTGCCCAGTTCCTTAGG + Intergenic
1173523711 20:43716785-43716807 CCTTGCCTGGCCCTTGCCTTGGG + Intergenic
1173907231 20:46638064-46638086 CCTGGCTCTCACCTTTCTTTGGG - Intronic
1174191356 20:48742887-48742909 CCTGGCCCCCCTCATTCCTTTGG - Intronic
1174376327 20:50128918-50128940 CCTGCCCATCCCCTTCCCTGGGG - Intronic
1174582102 20:51579383-51579405 AATGTCCTTCCCCTTTCCCTGGG - Intergenic
1174706635 20:52662992-52663014 CCTGGACTTCTGCTTTTCTTAGG + Intergenic
1175047981 20:56125382-56125404 CCTGGCCTTTCACTCTCCTCTGG - Intergenic
1176211083 20:63922165-63922187 CCTGGACTGCCTATTTCCTTGGG - Intronic
1176222721 20:63977739-63977761 CCTGACCTCACCCTTGCCTTGGG + Intronic
1176406367 21:6370479-6370501 CATGGCCTCTCCCTGTCCTTTGG + Intergenic
1177442562 21:21145925-21145947 CCTGGCCTTTCTTCTTCCTTCGG - Intronic
1178741492 21:35206298-35206320 CCTGGCTTTCCATTTGCCTTGGG + Intronic
1178836866 21:36105525-36105547 CCTCTCCTTCCCCTTTCCCTAGG - Intergenic
1180840329 22:18956097-18956119 CATGGCCTTGCCCATCCCTTGGG + Intergenic
1181061159 22:20282679-20282701 CATGGCCTTGCCCATCCCTTGGG - Intronic
1182183160 22:28372636-28372658 CCTGGCCTGGCCCTTTAGTTGGG - Intronic
1182733340 22:32512886-32512908 CCTAACCTGACCCTTTCCTTGGG + Exonic
1182782669 22:32880592-32880614 CGTGGCCTTCTCCATTTCTTGGG - Intronic
1183019573 22:35016413-35016435 TCTAGCTTTCCCATTTCCTTTGG - Intergenic
1183156724 22:36081410-36081432 CCTGGCCTTTCCTTCTCCTCTGG + Intergenic
1184040791 22:41942179-41942201 CCAGGCCTGCTCCATTCCTTTGG - Intronic
1184246447 22:43238084-43238106 CCTGGGCTTCCTGTTTCCTGAGG + Intronic
1184333468 22:43840217-43840239 CCTGGCCTTACCCCTCCCTCTGG - Intronic
1184335507 22:43850655-43850677 CCTGGACCTCCCCCTACCTTGGG + Intronic
1184998138 22:48225534-48225556 CCTGGCCTGCCACTTCCTTTAGG + Intergenic
949434712 3:4016327-4016349 CTTGACCTTCTCCCTTCCTTTGG - Intronic
953171157 3:40508911-40508933 CCTGGCCTTACAGTTTTCTTTGG + Intronic
953428178 3:42812982-42813004 CCCGGCCTTCAGCTTTCTTTTGG + Intronic
953821017 3:46207428-46207450 CCTGGCCAGCTCCTTGCCTTTGG + Intronic
953876724 3:46670900-46670922 CCTGTCCTGCCCCTTGCCTTGGG + Exonic
953922322 3:46960717-46960739 CCTGGCCCTCTTCCTTCCTTCGG - Intronic
953927409 3:46989444-46989466 CCTGGCCGTCACCCCTCCTTGGG - Intronic
953996670 3:47524987-47525009 CCCGGCCTTCCCCTTTACCCAGG - Intergenic
954604490 3:51898101-51898123 CCTCTCCTTCCCCTTCCCCTAGG - Intronic
954871046 3:53767713-53767735 GCTGGCCTCCCCTTTTCATTGGG + Intronic
956595743 3:70965244-70965266 CCTGGCCTCCGCCTTTCCTGTGG + Intronic
959960751 3:112295186-112295208 GCTGGGCTGCCCCTTTTCTTGGG + Intergenic
960054981 3:113270779-113270801 CCTGGCCCTGCCCTTTCCACAGG + Exonic
960503718 3:118467952-118467974 CCTGGCCCTGCCCTATCATTTGG - Intergenic
961181965 3:124884848-124884870 CTTGCCCTTCCCCTCTACTTGGG - Intronic
962809157 3:138946886-138946908 CCTCTCCTTCCCCTTCCCCTAGG + Exonic
963004905 3:140717938-140717960 CCTTGACTTCTCCTTTCCTTAGG + Intergenic
964756838 3:160096490-160096512 CCTAGCCTTCCCCTTACCACCGG + Intergenic
965975786 3:174620136-174620158 CATGGCCATCCTCTTTCATTTGG + Intronic
966611602 3:181873513-181873535 CCTGGCCTCCACCTTTGTTTTGG - Intergenic
966659326 3:182396946-182396968 CTTTGCCTTCCCCTGTGCTTTGG - Intergenic
967072376 3:185973093-185973115 GCCGGCATTCCCCTTCCCTTTGG + Intergenic
967725041 3:192853997-192854019 CATGGGCTTCCCTATTCCTTGGG + Intronic
968083332 3:195862474-195862496 GCTGGGCTTCCCCATTCTTTCGG - Intergenic
968813471 4:2810286-2810308 CCTGGCCTGCTCCTCTCCTCTGG + Intronic
969215119 4:5715537-5715559 CCTGGCACTCCCCTTTTGTTAGG + Intronic
969217888 4:5736793-5736815 ACTGGCCATTCCCTCTCCTTGGG + Intronic
969423544 4:7110871-7110893 CCGTGCCTGCCCCTTTCCATGGG + Intergenic
969885676 4:10213219-10213241 CCTGGCCGTGACCTTTCCCTGGG + Intergenic
970092901 4:12430259-12430281 CCTCTCCTTCCCCTTCCCGTAGG + Intergenic
970466083 4:16324302-16324324 CTTGGCCTTCCCCCTTCATCTGG + Intergenic
971074968 4:23137595-23137617 CCTGACCTTTCCTTTCCCTTAGG + Intergenic
971253066 4:24989292-24989314 TCTGGCCCTCCCCTTCCCTCTGG - Intergenic
972784751 4:42315798-42315820 CCTCTCCTTCCCCTTTCCCTAGG - Intergenic
973122322 4:46537270-46537292 CCTTGACTTACTCTTTCCTTGGG - Intergenic
977795634 4:101161787-101161809 ACTGGCCTTCCCTGTTCTTTTGG - Intronic
977910842 4:102534293-102534315 CTTAGCCTTCCTCCTTCCTTTGG + Intronic
978423740 4:108560933-108560955 CATGGTTTTTCCCTTTCCTTTGG - Intergenic
979635863 4:122953766-122953788 CTTGGCCATCTCCTTTCCTTTGG + Intronic
980459911 4:133095988-133096010 TCTGTCCTACTCCTTTCCTTTGG - Intergenic
980550400 4:134327829-134327851 ACTGGCTTTCCCCTCTGCTTGGG - Intergenic
980613786 4:135192964-135192986 CCAGGCTTTCCCCTGTCCCTTGG + Intergenic
981045506 4:140261477-140261499 CCATGCCTTCCCCATTCATTTGG + Intronic
981400859 4:144312834-144312856 CCTGGGCTTCACCTTTCTCTGGG + Intergenic
981567333 4:146114956-146114978 CCTGGCCTGCTTCTTTCCTGAGG - Intergenic
985894806 5:2742277-2742299 ACTAGCCCTCCCCTTTGCTTGGG - Intergenic
989248694 5:39282515-39282537 CCATGCCATCCCCTTTTCTTGGG + Intergenic
991500220 5:67269272-67269294 CCTTGCCTTCCCCTTCCCTAGGG + Intergenic
992758208 5:79929135-79929157 CCTGGCCTTCCCTTCTGCTCAGG - Intergenic
993055415 5:82974790-82974812 CCTCTCCTTCCCCTTCCCCTAGG + Intergenic
993632436 5:90302389-90302411 CCTGGCCTGGCTCCTTCCTTGGG - Intergenic
996100242 5:119437734-119437756 CCTGTCCTTCCCCCTTCCCTGGG - Intergenic
996452597 5:123642489-123642511 CATGGCCTTCAGTTTTCCTTCGG + Intergenic
998127668 5:139635433-139635455 TCTGTCCTTCCCCTTACCTTGGG + Intergenic
998552786 5:143093736-143093758 CCTCTCCTTCCCCTTCCCCTAGG + Intronic
999203787 5:149833920-149833942 CCTGGCTTTCAGCTTTTCTTTGG + Intronic
999295937 5:150459428-150459450 CCTGGCACTGCCCTTCCCTTTGG - Intergenic
1000694137 5:164358949-164358971 CCTTGCCTACTCCTTTCTTTTGG + Intergenic
1002535684 5:179874224-179874246 CCTGGCCCTGCCCCTTCCCTGGG - Intronic
1002839140 6:890881-890903 CCTGGCCTTCGCCTCTTCTCAGG - Intergenic
1005616510 6:27578094-27578116 CCTCTCCTTCACCTTTCCCTAGG + Intergenic
1005959031 6:30683530-30683552 CCTGGACTTTCCCTCCCCTTAGG - Intronic
1006016037 6:31081740-31081762 CCTCCCTTGCCCCTTTCCTTAGG + Intergenic
1007203541 6:40131159-40131181 CTTGGCTGTTCCCTTTCCTTTGG - Intergenic
1007556703 6:42772402-42772424 CCTGGAATTCCCTTTTCCTGTGG - Intronic
1007970631 6:46048676-46048698 CCTGGCCTTCCTCCTTGCCTGGG + Intronic
1008265460 6:49419846-49419868 CATGGCCATTGCCTTTCCTTGGG + Intergenic
1009678214 6:66855300-66855322 ACTGACCTTCTCCTTTCTTTTGG + Intergenic
1010075224 6:71790001-71790023 CCTCTCCTTCCCCTTTCTGTTGG - Intergenic
1011570130 6:88725812-88725834 CCTCTCCTTCCCCTTCCCCTAGG - Intronic
1013040712 6:106430722-106430744 CGTGGCCTTTCCCTCTCCATGGG + Intergenic
1013355663 6:109343948-109343970 CCCTGCCTTCTCCTTTCTTTTGG + Intergenic
1014826411 6:126052918-126052940 CCTGCCCTTCTTGTTTCCTTAGG - Intergenic
1015662035 6:135586563-135586585 CCTGGCATTCCCCCTTCTGTTGG + Intergenic
1017455248 6:154595622-154595644 CCTGGCATTCCCTTTTCCATAGG - Intergenic
1017781661 6:157720299-157720321 CCTCCCCTTTCCCTTTCCTAAGG + Intronic
1017835446 6:158173371-158173393 ACTGGCCATACCCTTTCCTTTGG - Intronic
1018191613 6:161314362-161314384 CCTCTCCTTCCCCTTCCCCTAGG + Intergenic
1019270360 7:143664-143686 CCTGGGCGTTCCCTTGCCTTCGG - Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1021941447 7:25682695-25682717 CCTGGTGTTTCCCTTTCCTTAGG + Intergenic
1022500234 7:30878130-30878152 CCTGGCCTGGCCCTCTCCTCAGG + Intronic
1022942665 7:35254825-35254847 CCTGACCTTCGCCTTCTCTTCGG - Intergenic
1023798852 7:43815473-43815495 CCTCTCCTTCCCCTTCCCCTGGG - Intergenic
1023815126 7:43943696-43943718 CCTGGGCTTCTCCTTCCCTTTGG - Intronic
1025871738 7:65440703-65440725 CCTGGGCTTCCCCAAGCCTTTGG + Intergenic
1026094488 7:67332923-67332945 CCTGGTCTTCCCCTTCAATTAGG + Intergenic
1026893510 7:73996916-73996938 CCTGGGCTTCCCCAGTCCTTAGG + Intergenic
1027266637 7:76498379-76498401 CCTGCCCTTCCCCTGCCCTGGGG + Intronic
1027318018 7:76996497-76996519 CCTGCCCTTCCCCTGCCCTGGGG + Intergenic
1028793523 7:94879002-94879024 CCTCTCCTTCCCCTTCCCCTCGG - Intergenic
1028869172 7:95748507-95748529 CCTGGTCTCCCCCTCTTCTTAGG - Intergenic
1031946579 7:127848056-127848078 CCTGGCCTTCTTGTTTCCATAGG + Intronic
1032268389 7:130383797-130383819 ACCGGCCTTCTCCTGTCCTTGGG + Intronic
1032382802 7:131502414-131502436 CCTGGCCTTCCTTTTCCCCTAGG + Intronic
1033261212 7:139845428-139845450 CATGTCCTTCCCCCTTCATTTGG + Intronic
1033738172 7:144245246-144245268 CCTGGCCTTCACTTTTTCTTAGG + Intergenic
1033744881 7:144305707-144305729 CCTGGCCTTCACTTTTTCTTAGG - Intergenic
1034266933 7:149785577-149785599 ACTGGCCTTCACCTATCCTGGGG + Intergenic
1034421903 7:150995060-150995082 TCTGGCGTTCCCCATGCCTTAGG - Intronic
1034437761 7:151071286-151071308 CCTGGCCGTACCCTTATCTTGGG - Exonic
1035460488 7:159035600-159035622 CCTGACCTTCCACTTTGCTCCGG + Intronic
1035577617 8:717873-717895 CCTGGCCTGCCCCCGTCCCTGGG - Intronic
1036222565 8:6932910-6932932 CCTCGTCTGGCCCTTTCCTTTGG + Intergenic
1036519012 8:9473212-9473234 CCTGAACCTCCGCTTTCCTTGGG - Intergenic
1036755630 8:11468936-11468958 CCTCCCCTTCCTCTTTCCTCTGG - Intronic
1037193166 8:16152359-16152381 CCTGGCCCGCCCCTTCCCATAGG - Intronic
1037690293 8:21176154-21176176 CCTGCCATTCCCCTTACCTAGGG - Intergenic
1037947624 8:22999294-22999316 CGGGGTTTTCCCCTTTCCTTCGG - Intronic
1038679524 8:29653929-29653951 CCTGGCCTGAGCATTTCCTTAGG + Intergenic
1039120710 8:34143119-34143141 CCTGGCCTTGCCACTTGCTTTGG - Intergenic
1039474105 8:37830372-37830394 CCAGGGCATCCCCTTTCCCTCGG + Intronic
1040277005 8:46018947-46018969 ACTTGCCGTCCCCTTTCTTTGGG + Intergenic
1040455613 8:47594450-47594472 CCTGGACTTCCCCCCTCATTGGG - Intronic
1042114034 8:65412204-65412226 CTTGGCCTTTCCCTTTATTTAGG + Intergenic
1042559385 8:70061609-70061631 CCTGGCCTTCCTGCTTCCTGGGG + Intronic
1042803597 8:72747212-72747234 CCCTGCCTTGCCCGTTCCTTTGG - Intronic
1042961028 8:74303866-74303888 AATAGCCTTCCCCTATCCTTGGG + Intronic
1043301915 8:78744474-78744496 GGTGGCCTTCCCCTCTCCCTGGG + Intronic
1044749481 8:95402370-95402392 CCTGCCATTCCTTTTTCCTTTGG + Intergenic
1046885913 8:119366904-119366926 TCTAGCCTACCCCTGTCCTTTGG + Intergenic
1046948091 8:119993419-119993441 CCAAGCCTTCCCTTTTGCTTTGG - Intronic
1047907193 8:129484741-129484763 CCTGCCCTTCCCTTTTCCCCAGG + Intergenic
1048270062 8:133021302-133021324 CCTTGGCGTCCCCTTTCCCTTGG - Intronic
1049067494 8:140328943-140328965 CCTGCCCTTCCTCTGACCTTGGG - Intronic
1049321957 8:142001378-142001400 CCTGGCCTTCCCGTGTCCCCTGG - Intergenic
1049403172 8:142439934-142439956 TCTGTCCTCCCCCTTTCCTCAGG - Intergenic
1049461608 8:142732071-142732093 CCTCTCCTTCCCCTTCCCCTGGG + Intronic
1049658453 8:143809181-143809203 CCTGGCCTTCAGCTTTTCTCAGG - Intronic
1049833647 8:144718753-144718775 CCTGGCCTTACTGTTTTCTTAGG - Intergenic
1050535383 9:6626261-6626283 CCTAGCCTTCTCCTTCCTTTGGG - Intronic
1050721812 9:8599911-8599933 CCTGGCCGGCCCCTCCCCTTTGG + Intronic
1053540235 9:38966029-38966051 CCTGGCTTTCCCCATTTCTCAGG + Intergenic
1053804582 9:41788187-41788209 CCTGGCTTTCCCCATTTCTCAGG + Intergenic
1053862494 9:42401235-42401257 CCTGGCCCTCCCCATTGCCTAGG - Intergenic
1054140703 9:61527276-61527298 CCTGGCTTTCCCCATTTCTCAGG - Intergenic
1054625905 9:67397894-67397916 CCTGGCTTTCCCCATTTCTCAGG - Intergenic
1054912131 9:70464594-70464616 CCTGGCCGTCGCCTATACTTCGG + Intergenic
1055232087 9:74078034-74078056 GCTGTGCTTCCCCTTCCCTTAGG - Intergenic
1055323080 9:75100938-75100960 CCTGGCCTTCCCGTTCTCTGGGG + Intronic
1056058458 9:82855184-82855206 TCTGCCTTTCCCCTTTCTTTGGG - Intergenic
1056755730 9:89381022-89381044 CCTCGACGTCCCATTTCCTTTGG - Intronic
1058452947 9:105114054-105114076 CCTGGGCTTCCTGTGTCCTTTGG - Intergenic
1059327997 9:113516270-113516292 CCTGGCCTTAGCCTTTCTGTGGG + Intronic
1059443458 9:114323878-114323900 CCTGGCCTTGGCCTTCCCATGGG + Intronic
1059444649 9:114330649-114330671 CCTGGCCTTGGCCTTCCCATGGG + Intronic
1059568550 9:115409142-115409164 CCTGGTTTTCCCCTTTGCCTAGG - Intergenic
1060033019 9:120231851-120231873 CCTGGCTTTTCTTTTTCCTTTGG + Intergenic
1060432333 9:123561178-123561200 CCTGGCCTTTCTCTTTCATTCGG + Intronic
1061217748 9:129231571-129231593 CCTGGCCTTGGCCTCTCCTTTGG + Intergenic
1061466251 9:130782517-130782539 CCTGGCTTTCCCCTTAACTTGGG + Intronic
1061767356 9:132889770-132889792 CCTTTCCTTCGCCTTTACTTGGG + Intronic
1062277269 9:135736881-135736903 CCTGGCCTCCCCCCTTCCCCGGG - Intronic
1062548039 9:137072480-137072502 CCAGCCCTTCCCCATCCCTTAGG - Intergenic
1186081792 X:5941740-5941762 TCTGGCTTTCTCCATTCCTTTGG - Intronic
1186433398 X:9523370-9523392 CCTGGGGTGCCCCTTTCCCTGGG + Intronic
1186699596 X:12075881-12075903 CCTCTCCCTACCCTTTCCTTAGG + Intergenic
1186788410 X:12974572-12974594 GCTGGCGTTCCTCTTGCCTTGGG - Intergenic
1188368800 X:29343418-29343440 CCAGGTATCCCCCTTTCCTTGGG + Intronic
1189124588 X:38432969-38432991 CCTCTCCTTCCCCTTTTATTAGG + Intronic
1189329432 X:40134224-40134246 CCTCGTCTTCCCCTCTCCTCTGG - Intronic
1189949044 X:46209906-46209928 CCTGATTTTCCCCATTCCTTAGG + Intergenic
1190948406 X:55118491-55118513 CCTGGCCTTTCCCTATCTCTTGG + Intronic
1192152441 X:68720520-68720542 TCTGGCCTTCCCCCTCACTTGGG + Intronic
1192319269 X:70076489-70076511 GCTAGCCTTCCCCATTACTTAGG - Intergenic
1192503095 X:71665883-71665905 CCTGGCCTCCACCTTTCCCAAGG + Intergenic
1195895254 X:109739686-109739708 GCTAGCCTTTCCCTTTCCATTGG + Intergenic
1196175994 X:112639469-112639491 CCTGGTCTTCCCTTACCCTTTGG - Intronic
1196229620 X:113206463-113206485 CCTGGGCTTGCCCTTGCCTGTGG + Intergenic
1196874357 X:120144178-120144200 CCTCTCCTTCCCCTTCCCCTAGG - Intergenic
1197152508 X:123235232-123235254 CCTGCCCCTCCCCTTTTCTGAGG - Intronic
1197706802 X:129640003-129640025 CCTGGAGTTCCTCTCTCCTTTGG - Intergenic
1197765552 X:130057359-130057381 CCTGGCCTCCCCCTGGCCTCTGG + Exonic
1199637516 X:149827166-149827188 CCTCTCCTTCCCCTTTCCCTAGG - Intergenic
1201411325 Y:13702395-13702417 ACTGGCGTTCCTCTTGCCTTTGG - Intergenic
1202498269 Y:25461683-25461705 CCAGGCCTGCCCCTTCCCTCTGG - Intergenic