ID: 1143107558

View in Genome Browser
Species Human (GRCh38)
Location 17:4537158-4537180
Sequence CCTTCCTTTCAAGGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143107547_1143107558 26 Left 1143107547 17:4537109-4537131 CCATGGGTGGGACAGCAGGCTGC 0: 1
1: 0
2: 1
3: 18
4: 245
Right 1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG 0: 1
1: 0
2: 1
3: 34
4: 244
1143107548_1143107558 2 Left 1143107548 17:4537133-4537155 CCTTCCAGTAAATTAGCTCCCCT 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG 0: 1
1: 0
2: 1
3: 34
4: 244
1143107549_1143107558 -2 Left 1143107549 17:4537137-4537159 CCAGTAAATTAGCTCCCCTTTCC 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG 0: 1
1: 0
2: 1
3: 34
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143107558 Original CRISPR CCTTCCTTTCAAGGGCTGGG TGG Intronic
901388163 1:8924778-8924800 CTTTCCTTTCTAGGGCTGGCAGG + Intergenic
901728264 1:11259510-11259532 CCTGCCTGACAAGGGCTAGGGGG - Intronic
901827916 1:11874570-11874592 CCTCCATTTAAAGGGCTGTGCGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902766139 1:18616748-18616770 CCTTCCTTTTAGGGAGTGGGAGG - Intergenic
902922826 1:19677386-19677408 CCTTCCTTTCAGTGGCTGCTGGG + Intronic
903052170 1:20609545-20609567 CCTTCCTTTCATGGCCTGTAAGG - Intronic
903194366 1:21673772-21673794 CCCTGCTTTCAAGGACTTGGAGG - Intergenic
904396754 1:30227524-30227546 CTTTCCTTGGAAAGGCTGGGAGG - Intergenic
905504740 1:38468656-38468678 CCTGGCTCTCAAGGGCTGGGAGG - Intergenic
905870195 1:41399194-41399216 CCTTTGCTTCCAGGGCTGGGAGG - Intergenic
906075960 1:43052378-43052400 CCTTCATTCCAAGTGTTGGGCGG + Intergenic
908690564 1:66774787-66774809 CCTTACTTTCACTGGCTGAGGGG + Intronic
911649906 1:100376141-100376163 CCTGCCTGTCATGGGGTGGGGGG + Intronic
912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG + Intergenic
917300359 1:173567746-173567768 CCTTCATTGAAAGGGCTGGAAGG - Intronic
917496948 1:175549123-175549145 CCTTCCTATCAGGGGCCTGGGGG - Intronic
918174764 1:182033727-182033749 GGTTCCTTTTAAGGGCTGTGAGG + Intergenic
920259204 1:204677565-204677587 CCTTCCTTTCACTGCCTGGGTGG - Intronic
922219006 1:223543663-223543685 CCTTCCAATGAAGGGATGGGGGG - Intronic
922740122 1:228009822-228009844 CCTGCCTCCCCAGGGCTGGGTGG + Intronic
1062928785 10:1338842-1338864 GCTTCCTTGCATGGGCTGGAGGG + Intronic
1063103426 10:2971646-2971668 CCTTCCTTTCAAGGGGAAGAAGG - Intergenic
1064615668 10:17152999-17153021 CCTTCCCTACAAGGGGTAGGTGG - Intronic
1065101607 10:22336573-22336595 CCTTCGTTCCAGGGGCTGCGGGG + Intergenic
1065118757 10:22507662-22507684 CATTCTTTTTAAGGGCTGTGTGG + Intergenic
1067810070 10:49419206-49419228 CATTCCTGCCAAGGGCTGTGGGG + Intergenic
1069826394 10:71257504-71257526 CCTTCTTGCCAGGGGCTGGGAGG - Intronic
1069837347 10:71317844-71317866 CCTTCCTCTCCTGGGCCGGGGGG + Intergenic
1069990461 10:72312290-72312312 GGTTCCTTCCAAGGGCTGGGAGG + Intergenic
1070364865 10:75726694-75726716 CCTTCCTTTGGAGGACTGTGCGG + Intronic
1070733054 10:78844970-78844992 ACTGCCTTTCACGGGCTTGGGGG - Intergenic
1071189440 10:83082497-83082519 AGTTCCTTACAAGGGCTGAGAGG + Intergenic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1072200700 10:93156125-93156147 CATTCCTTTGAAAAGCTGGGTGG + Intergenic
1073254473 10:102141913-102141935 GCTTCCTTAGACGGGCTGGGTGG - Exonic
1073324400 10:102634080-102634102 CCTGCCTCTCCAGGGCTGGGGGG + Intergenic
1073327562 10:102651344-102651366 CCTTCCTGTCCAGTCCTGGGGGG - Intronic
1075936835 10:126350230-126350252 TGTTCATGTCAAGGGCTGGGTGG + Intronic
1076371029 10:129953751-129953773 CCCTCCTTGCTTGGGCTGGGTGG - Intronic
1076426283 10:130369807-130369829 CCTTCCTTGCTAGGGACGGGAGG - Intergenic
1076589870 10:131575506-131575528 CCATCCTTTCTAGAGCTGAGTGG - Intergenic
1077176931 11:1195329-1195351 CCACCCTTCCAAGGGCTGGAGGG + Intronic
1077827424 11:5826319-5826341 CCTTCCCATCACAGGCTGGGAGG + Intronic
1078152695 11:8772827-8772849 CCTGCCTTTCCAGGGGTGAGTGG + Intronic
1080050653 11:27855827-27855849 CCTTTCTTACCTGGGCTGGGGGG - Intergenic
1082272655 11:50188693-50188715 AAGTCCTATCAAGGGCTGGGGGG + Intergenic
1083264484 11:61540237-61540259 CCCTCCCTGCAAGGGGTGGGTGG + Intronic
1084484988 11:69443077-69443099 CCTTCCTGGCCAGTGCTGGGGGG - Intergenic
1086492326 11:87368251-87368273 TGTTCATATCAAGGGCTGGGAGG - Intergenic
1087279063 11:96190261-96190283 ACTTCCTTTCTAGGGCTGTTGGG - Intronic
1088760147 11:112921935-112921957 CCTACCTTTCATGTGCAGGGTGG + Intergenic
1089906973 11:122049966-122049988 CCTTCCTTTAAAAGGCTGAATGG + Intergenic
1090195514 11:124813089-124813111 CCTCACTTACAAGGGCTGAGGGG - Intergenic
1090650301 11:128800326-128800348 CCTTGCTCTCAATGACTGGGTGG - Intronic
1091334659 11:134757410-134757432 CCCCCCTTTCCAGAGCTGGGAGG - Intergenic
1092083931 12:5740259-5740281 CCCTCCTTTCAGGTGCTGCGTGG - Intronic
1092193057 12:6534056-6534078 TCTTTCTTTCAAAGGCTGAGAGG - Exonic
1093598744 12:20995431-20995453 TGTTCCTTTTAAGGGCTGAGTGG + Intergenic
1095509167 12:42930480-42930502 CCATTCTCTCAATGGCTGGGTGG - Intergenic
1096704342 12:53409350-53409372 CCTCACTTTCAGGGGCTCGGGGG + Exonic
1096939456 12:55326059-55326081 CCTTCTGTTAAGGGGCTGGGGGG - Intergenic
1102930146 12:116855944-116855966 CCTTCCCTTCAGGGTTTGGGCGG + Intergenic
1102988627 12:117298742-117298764 GGTTCCTTCCGAGGGCTGGGAGG - Intronic
1103358960 12:120342499-120342521 CCCTCCTCTCCAGGGCTGGAGGG + Exonic
1104136183 12:125941130-125941152 CCTTCCTTTCTATGGTTGGATGG - Intergenic
1104411124 12:128558702-128558724 TCTTCCTTTCAGTGGCTGGTTGG + Intronic
1105859208 13:24394773-24394795 CCTTGCCCTCATGGGCTGGGAGG + Intergenic
1107027971 13:35823012-35823034 CTTTCCTTTCAAAGGCTCGAAGG + Intronic
1107310579 13:39073313-39073335 CCTTCCCTTCCTTGGCTGGGTGG - Intergenic
1110502826 13:76248929-76248951 CCTTCCTTTCAGAGGCTCTGAGG + Intergenic
1110715195 13:78694639-78694661 CCTTCCTTTCTGGGCTTGGGAGG + Intergenic
1112426520 13:99306554-99306576 ACTTCCTTTAAAGGGCAGTGAGG - Intronic
1113615375 13:111676643-111676665 CCTGCCTTTCTTGGGGTGGGTGG + Intergenic
1113620842 13:111761556-111761578 CCTGCCTTTCTTGGGGTGGGTGG + Intergenic
1113626584 13:111852439-111852461 CCTTCCCTTCAAGGGCAGTGTGG - Intergenic
1114269089 14:21090597-21090619 CCTTCCTGCGAAGGACTGGGAGG + Exonic
1114657823 14:24326499-24326521 CCTCCCCTTCAAGGGCAGGTGGG - Intronic
1114975057 14:28085586-28085608 CCTCCCTTTCAAGGGAAGAGGGG + Intergenic
1115674810 14:35660775-35660797 CCTTCTTTTTAAAGGCTGAGTGG - Intronic
1115783334 14:36795718-36795740 CCTTCCTTACAAGGACAGGTGGG + Intronic
1116605456 14:46987689-46987711 CCTTCCCTTCAAGATCAGGGAGG - Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1119233589 14:73000879-73000901 CCTTCCTTTTTATGGCTGCGTGG - Intronic
1119543250 14:75454287-75454309 CCTGCTCTTCAAGGGGTGGGTGG - Intronic
1119632947 14:76249898-76249920 CCTTCAGTTAAAGGGCTGAGAGG - Intronic
1120278548 14:82409443-82409465 CTTTTCTTTAAAGGGGTGGGGGG + Intergenic
1120840985 14:89084561-89084583 GCTTCCTTCTAAGGGCTGTGCGG + Intergenic
1121342371 14:93113267-93113289 TCTTCCTTTAAAGGGGTGGGAGG - Intronic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1121696565 14:95917974-95917996 TCTTCCTGCCAGGGGCTGGGTGG - Intergenic
1121812195 14:96901026-96901048 CCTATCTTTCAAGGTCTGGAAGG + Intronic
1122861695 14:104585354-104585376 TCTGCCTTTCAAGGGCTCTGGGG - Intronic
1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG + Exonic
1123211305 14:106763104-106763126 CTTTCCCTTGAAGGCCTGGGAGG - Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1128112144 15:65083338-65083360 CTTTTCTTTCAAGGGAAGGGAGG + Intergenic
1129199628 15:73991327-73991349 GCTTCCTGTCCAGGGTTGGGAGG - Intronic
1132626222 16:892846-892868 CCCTCCCTTCACGGGGTGGGTGG - Intronic
1132699003 16:1214316-1214338 CCTTCTTCTAAAAGGCTGGGAGG - Intronic
1133684362 16:8151646-8151668 CATTCCTTTTAATGGCTGCGTGG + Intergenic
1134096838 16:11423948-11423970 CCTTCCTCTCCAGGGCTGCGCGG + Intronic
1135920147 16:26642372-26642394 CCCTCCTTTCAAAGGCTGTATGG - Intergenic
1136419212 16:30122071-30122093 CCTCCCTGCCAAGGCCTGGGTGG - Intronic
1137599229 16:49744608-49744630 CCTTGCTGTCACTGGCTGGGGGG - Intronic
1137736706 16:50729860-50729882 CATTCCTTTCAAGGGCCTGCAGG - Exonic
1138653064 16:58472752-58472774 CCTTCCTCGCAAGGGCAGTGTGG + Intronic
1139659943 16:68413905-68413927 ACCTCCTGTCAAGGTCTGGGTGG + Intronic
1142864994 17:2785297-2785319 CCTTCCTTAACAGGGCTGGAAGG - Intronic
1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG + Intronic
1143309711 17:5978196-5978218 CCTCCCTGTTTAGGGCTGGGAGG - Intronic
1144208259 17:12994301-12994323 GCTTCCTATCAAGGGCTATGGGG - Intronic
1144482370 17:15638684-15638706 CCTTCCTTGCCAGGGATGGGAGG - Intronic
1144916313 17:18726348-18726370 CCTTCCTTGCCAGGGATGGGAGG + Intronic
1145035460 17:19537486-19537508 CCTTCCATTCAAAGGGTGAGAGG + Intronic
1145978653 17:28998634-28998656 CCCTCCTCTCAAGGGGTAGGGGG - Intronic
1146642663 17:34552986-34553008 CTTTCCTTTCCAGGGCAGGAGGG - Intergenic
1147879881 17:43646478-43646500 CCTTCCTTTCCACGGTTGCGGGG + Intronic
1148797724 17:50205099-50205121 CCTTCCTTTCCAGGGTTAGGGGG + Intergenic
1150226955 17:63529502-63529524 ACTGACTTTCAAGGGCTGGGAGG - Intronic
1150830135 17:68511901-68511923 CCTCCCTTGCAGGGGCTGCGGGG + Intronic
1152198932 17:78934051-78934073 GCTTCCTTTCATGGGCGGGTTGG + Intergenic
1152458850 17:80430985-80431007 CCGGCATGTCAAGGGCTGGGGGG - Intronic
1152859432 17:82687007-82687029 CCCTCCTGTCCAGTGCTGGGGGG + Intronic
1153078539 18:1193576-1193598 GCTTCCTTTCTAGGGGAGGGTGG + Intergenic
1153989570 18:10384576-10384598 CCTGCCATTCAATAGCTGGGTGG - Intergenic
1157484250 18:48075742-48075764 CCTCCCTTTCAACTGCAGGGAGG - Intronic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1160867555 19:1262504-1262526 TCTGCCCTTCCAGGGCTGGGCGG - Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161316705 19:3620653-3620675 CCTCCCTTTCCAGGGCCTGGAGG - Intronic
1162830621 19:13282166-13282188 CCTTCCTTCCCAGGCCTGGCAGG - Intronic
1163068973 19:14822036-14822058 CCTTCTTTTTAAAGGCTGAGTGG + Intronic
1163214398 19:15864963-15864985 GTTTCCTTCCAAGGGCTGGGTGG - Intergenic
1163679083 19:18670210-18670232 CTTTCCCTTCAAGGGCTCTGTGG + Exonic
1164740307 19:30570982-30571004 TCTTCCTTTGAGGAGCTGGGGGG - Intronic
1167384260 19:49154964-49154986 CCTCCTTTTCACGGTCTGGGTGG + Exonic
925802034 2:7611015-7611037 CCTTCATTCCAGGGGTTGGGAGG - Intergenic
929230280 2:39552533-39552555 CCTTCTTTTTAAAGGCTGAGTGG + Intergenic
929259726 2:39852067-39852089 TCTTCTTTTCAAGGGAAGGGTGG - Intergenic
929798866 2:45082587-45082609 CCTTCCTCTCAGGTCCTGGGGGG + Intergenic
929816635 2:45237849-45237871 ACTTCAGCTCAAGGGCTGGGTGG - Intergenic
930102307 2:47612947-47612969 TCCTCCTGGCAAGGGCTGGGAGG - Intergenic
932798888 2:74722150-74722172 AATTCTTTGCAAGGGCTGGGAGG + Intergenic
933402662 2:81818830-81818852 CCTTTCTTGCAGGGGCAGGGAGG + Intergenic
934706558 2:96485589-96485611 CCTTCCTTTGAAGGAATGGGTGG - Intergenic
937680634 2:124640659-124640681 CCTTCCTTTTAAAGGTCGGGCGG + Intronic
938082873 2:128379566-128379588 CCAGCCTTTGAAGGGCTTGGTGG + Intergenic
938196458 2:129333391-129333413 GCTTCCTTCTAAGGGCTGGGAGG + Intergenic
941156578 2:161986441-161986463 CCTTGCTTCTAAGGGCAGGGTGG + Intergenic
943322608 2:186464270-186464292 CGTTCCTTTTAATGGCTGAGTGG - Intergenic
946928474 2:224648909-224648931 CCTTTCTTTCAAAGGCAGTGAGG - Intergenic
947592103 2:231391744-231391766 TCTTCCTTTGAAGGGGTGGGAGG - Intergenic
947826217 2:233107685-233107707 CCTTGCTGTCCAGGGCTGGGGGG - Intronic
947848646 2:233266067-233266089 CCTTCTTTTCAATGGTTGGTTGG - Intronic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1171487382 20:25494568-25494590 CCTTTCCTTCCAGGGCTGGCTGG - Intronic
1171980895 20:31628011-31628033 GGTTCCTTTTAAGGGCTGTGAGG - Intergenic
1173479595 20:43388722-43388744 TGTTCCTTCCAAGTGCTGGGGGG - Intergenic
1173912132 20:46678209-46678231 CCTTCTTACCAAGGCCTGGGAGG - Intronic
1174115423 20:48223636-48223658 ACTTCATTACATGGGCTGGGAGG - Intergenic
1174165192 20:48579185-48579207 ACTTCATTACATGGGCTGGGAGG + Intergenic
1175404257 20:58716605-58716627 CCTTGATTTCCAGGGCTGTGGGG - Intronic
1178287570 21:31338087-31338109 CCTTTCTTTCAAGGGCTGTCTGG - Intronic
1179036572 21:37763271-37763293 CCTTGCCTTCAAGTCCTGGGTGG - Intronic
1181749640 22:24980107-24980129 CCTTCTTTTTAAAGGCTGGATGG + Intronic
1182593237 22:31398401-31398423 ACTTCCCTCCCAGGGCTGGGTGG + Intergenic
1182626414 22:31649968-31649990 GCTTCCTTTGGAGGGCTGTGAGG - Intronic
1183371593 22:37435611-37435633 CCTTCCTACCAGGGGCTGAGTGG + Intergenic
1183954572 22:41371713-41371735 CCTTCCTTTGAAGAACTGGATGG + Intronic
949871587 3:8594139-8594161 CCTTCCTGTCACTGGCTGTGTGG - Intergenic
952240852 3:31530431-31530453 CCTCCCTTCCTAGGGCTGGCTGG + Intergenic
953963370 3:47283287-47283309 CTTTCCTTTCAAGGGCTGAAAGG - Intronic
954571377 3:51643862-51643884 CCTTCCTTCCTAGGGCTAGATGG + Exonic
954584462 3:51721264-51721286 CCCTCCTCTCCTGGGCTGGGGGG + Intergenic
955182062 3:56682361-56682383 CTCTGCTTTCAGGGGCTGGGAGG + Intronic
955289244 3:57675634-57675656 GCTTCCTTGCAGGGGCTGTGGGG - Intronic
955487558 3:59449846-59449868 CCTTCATTTCAAGGGGAGGAGGG + Intergenic
955900249 3:63745980-63746002 CTTTCCTTTCAAAGACAGGGAGG - Intergenic
955909435 3:63845093-63845115 CCTTCTTTTCTGGGGGTGGGGGG + Intronic
955983678 3:64551561-64551583 CCTTCCTTTAGACAGCTGGGTGG - Intronic
956552336 3:70475217-70475239 TCTTGCTTTCAAGGGCAGGGGGG - Intergenic
961459424 3:127040816-127040838 CCTTCCTTTCAAAGGCTGAATGG - Intergenic
962847122 3:139282569-139282591 CCTTCCTCTCACTTGCTGGGTGG - Intronic
963055497 3:141182995-141183017 CCTTCCCTAGAAGGGCTGGGTGG - Intergenic
965635694 3:170777996-170778018 GCTTCCTTTTGAGGGCTGTGAGG - Intronic
968000618 3:195203604-195203626 CCTTACTTTAAAGGCCTGAGTGG - Intronic
968381915 4:103675-103697 TGTTACTTTCTAGGGCTGGGAGG - Intergenic
968490547 4:888630-888652 CTTTCCTTTCATCGCCTGGGGGG - Intronic
968511466 4:997619-997641 GCTTCCGTTCCCGGGCTGGGCGG + Intronic
968885850 4:3331800-3331822 CGTTCCTTCCCAGGACTGGGTGG - Intronic
971955196 4:33408368-33408390 CATTCCATTAAAGGGCTTGGAGG - Intergenic
972167668 4:36307305-36307327 TGTTCCTTCCAAGGGCTGTGAGG + Intronic
973182896 4:47291063-47291085 CCCTCCCATCAAGGGCTAGGAGG + Intronic
976530808 4:86150110-86150132 CATTCCTTTTAATGGCTGAGTGG - Intronic
977227482 4:94410576-94410598 ATTTCTTTTCAAGGGATGGGGGG + Intergenic
978449463 4:108815465-108815487 CTTTCCTTTCTGGGGATGGGTGG + Intronic
980572450 4:134638061-134638083 GGTTCCTTCCAAGGGCTGAGAGG - Intergenic
983597994 4:169492505-169492527 CCTGGCTTGCAAGGGCTGAGGGG - Intronic
985073426 4:186190941-186190963 CCCTCCCTTCCCGGGCTGGGTGG + Intergenic
986064068 5:4218807-4218829 CCCTCCTGTGAAGGGCTGGAGGG - Intergenic
988496257 5:31748641-31748663 CATTCCTGGCAAGGGGTGGGTGG + Intronic
990507654 5:56460422-56460444 CCTTCCTTTAAACTACTGGGTGG + Intronic
991707068 5:69368885-69368907 CCTTCCTTTTAAGGGGCGGGGGG + Intronic
991939971 5:71841277-71841299 GGTTCCTTCCAAGGGCTGTGAGG - Intergenic
992734743 5:79707737-79707759 CCTTCCTTTCCGGGGCTTGAAGG - Intronic
997747186 5:136309551-136309573 CCTTCTTGTGAAGGGGTGGGAGG + Intronic
1001420970 5:171586840-171586862 CCTTGCTTTCTGGGGGTGGGGGG + Intergenic
1003538966 6:7001600-7001622 ACTTCTTTTCAAAGGCTGTGGGG + Intergenic
1005435533 6:25807345-25807367 CCTTCTTTTTAATGGCTGAGTGG - Intronic
1005651643 6:27890525-27890547 CCTTCGTTTCCAGAGCTCGGCGG - Exonic
1007086098 6:39146761-39146783 CCTGTCTTACAAGGGCTGGAAGG - Intergenic
1007426064 6:41746973-41746995 CCTGCCATTCAAGGGCTGCTTGG + Intronic
1007745671 6:44041601-44041623 CATTCCCTGCAAGGGCAGGGAGG + Intergenic
1009625014 6:66127500-66127522 CCATCTTTGCAAGGGGTGGGAGG + Intergenic
1010922068 6:81694265-81694287 CCTTCCTTTCTAGGGCTGAATGG + Intronic
1013363927 6:109420960-109420982 ACTTCCTTTCAAGAGCTGCCTGG - Intronic
1014486230 6:122002680-122002702 CCTTCCTTTCATGGCCTAGAAGG + Intergenic
1015291809 6:131546162-131546184 CCTTTGTTGCAAGGGCTGGGTGG - Intergenic
1015612927 6:135045134-135045156 CATTACTTTCAAAGGGTGGGTGG + Intronic
1016693415 6:146965274-146965296 CCTTCCCATCACAGGCTGGGAGG + Intergenic
1016708173 6:147138133-147138155 GCTTCCTTCTGAGGGCTGGGAGG - Intergenic
1021571645 7:22072096-22072118 CATTTCATTCAAGGGCTGGAGGG + Intergenic
1023877023 7:44292088-44292110 GGTTCCTTCCTAGGGCTGGGAGG + Intronic
1024095030 7:45976383-45976405 CCATCCTCACCAGGGCTGGGAGG + Intergenic
1025035841 7:55592094-55592116 CCTTCCGTTCAAGGACAGGGTGG - Intergenic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1027506917 7:79027362-79027384 CCTTCTTTCTAAAGGCTGGGTGG - Intronic
1028281512 7:88935558-88935580 CCTTACTTTCAAGTGTAGGGTGG + Intronic
1028621727 7:92834663-92834685 CCTCCCTTTCAAAGGGTGGGGGG + Intronic
1030717600 7:112828306-112828328 TCTTCCTTTTGAGGGCTGTGAGG + Intronic
1031679479 7:124653289-124653311 GCTGCCTTTCCAGGGGTGGGTGG - Intergenic
1034487952 7:151377730-151377752 TCTTCCTTCCAAGTGCTGTGGGG + Exonic
1034546761 7:151794427-151794449 CCTTCTTATCACGGGCTGGTGGG + Intronic
1036641907 8:10590035-10590057 CCATCCTTCTAATGGCTGGGAGG + Intergenic
1036762052 8:11516071-11516093 CCTTCCTTTCAAAGGCTGAGTGG - Intronic
1037106077 8:15110614-15110636 CCTTCCTTCCTAGGGCAGAGTGG + Intronic
1037215625 8:16447917-16447939 GGTTCCTTTCAAGGGCTATGAGG - Intronic
1037419434 8:18686759-18686781 CCTTCCATGCATGGGCTGAGTGG - Intronic
1037737632 8:21580138-21580160 GCTGCCTTCCAAGGGCAGGGAGG + Intergenic
1039143861 8:34423351-34423373 CTTTGTCTTCAAGGGCTGGGAGG - Intergenic
1039905242 8:41781696-41781718 CCTTCCCATGAAGGGCAGGGAGG - Intronic
1041830076 8:62143915-62143937 CCTTCCCTCCGAGGGCTTGGAGG + Intergenic
1042660104 8:71144985-71145007 CCTTTCTTCCAAGGGGTGGGGGG - Intergenic
1044791232 8:95849253-95849275 CCTTCCTCTTCAGGGCTTGGGGG - Intergenic
1045018691 8:98022623-98022645 CCTTTCTTTCCAGGGTAGGGTGG - Intronic
1046733002 8:117745926-117745948 CCTTCCTTAGTAGGACTGGGAGG - Intergenic
1047353704 8:124100141-124100163 CCTTCCTTCCCAGGGCAGGGAGG - Intronic
1049393619 8:142385222-142385244 CCATCCTTTCAGGGTCTTGGAGG - Intronic
1050979134 9:11986861-11986883 CATTCCTTTCTATGGCTGTGTGG + Intergenic
1051099772 9:13507478-13507500 CCTACTTTTCATGGGGTGGGTGG - Intergenic
1051655353 9:19376077-19376099 GGTTCCTTTCAGGGGATGGGTGG - Exonic
1055324179 9:75111369-75111391 CCTTCTCTTCAGGGACTGGGTGG + Intronic
1056555114 9:87681680-87681702 CTCTCCTTTCAAGGTCTAGGGGG + Intronic
1057303366 9:93899119-93899141 CCTACCTTTCTAGGACTTGGAGG + Intergenic
1057591078 9:96373994-96374016 ACTTACTTTCAAAGGCTGGAGGG + Intronic
1059068649 9:111111033-111111055 CCTTTCTTTCAGGTGCTAGGAGG - Intergenic
1060445095 9:123680381-123680403 CCCTCCTTACAAGGGCCGGTGGG - Intronic
1187186515 X:16991892-16991914 CGTTCCTTCTAAGGGCTGTGAGG - Intronic
1187530590 X:20093074-20093096 CCTTCTTTTCACTGGCTGGGAGG - Intronic
1188571948 X:31597936-31597958 CCTTCCTTTCAATGACTAAGGGG + Intronic
1189848707 X:45158384-45158406 CCTTCTTTCCAAGGGCAGGGTGG - Intronic
1190344169 X:49322273-49322295 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190345264 X:49331818-49331840 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190346358 X:49341384-49341406 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190347609 X:49532413-49532435 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190348710 X:49541969-49541991 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190349810 X:49551525-49551547 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190350915 X:49561078-49561100 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190352016 X:49570636-49570658 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190353117 X:49580185-49580207 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190354218 X:49589732-49589754 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190355320 X:49599256-49599278 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1192212116 X:69134245-69134267 CAATCCCTTCCAGGGCTGGGAGG - Intergenic
1194052925 X:89094342-89094364 GCTTCCTTACAAGAGCTGAGAGG - Intergenic
1196819779 X:119693285-119693307 CCCTACTTTCAAGGGGTGGGCGG - Exonic
1197192786 X:123666785-123666807 CCCTCCTTTCAGTGGGTGGGAGG - Intronic
1197391046 X:125865141-125865163 CCTTCCCTTCAAGGCCAGGAAGG + Intergenic
1199742740 X:150751017-150751039 CCTTCCTTTCTAGGCATGGGGGG + Intronic
1199914080 X:152320026-152320048 CCATCCTTTCAGGAGCTAGGTGG - Intronic