ID: 1143108589

View in Genome Browser
Species Human (GRCh38)
Location 17:4541427-4541449
Sequence ACCCGAACACGACCGCGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 12}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143108582_1143108589 -4 Left 1143108582 17:4541408-4541430 CCCAAGGCCCCCAAGAGGAACCC 0: 1
1: 0
2: 2
3: 20
4: 217
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12
1143108573_1143108589 25 Left 1143108573 17:4541379-4541401 CCCGGGCATGGCACTGCTGGCCG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12
1143108581_1143108589 -3 Left 1143108581 17:4541407-4541429 CCCCAAGGCCCCCAAGAGGAACC 0: 1
1: 1
2: 3
3: 32
4: 259
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12
1143108574_1143108589 24 Left 1143108574 17:4541380-4541402 CCGGGCATGGCACTGCTGGCCGG 0: 1
1: 0
2: 2
3: 20
4: 320
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12
1143108579_1143108589 5 Left 1143108579 17:4541399-4541421 CCGGGAGGCCCCAAGGCCCCCAA 0: 1
1: 0
2: 4
3: 21
4: 314
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12
1143108571_1143108589 29 Left 1143108571 17:4541375-4541397 CCAGCCCGGGCATGGCACTGCTG 0: 1
1: 1
2: 1
3: 16
4: 192
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12
1143108583_1143108589 -5 Left 1143108583 17:4541409-4541431 CCAAGGCCCCCAAGAGGAACCCG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143108589 Original CRISPR ACCCGAACACGACCGCGGAC TGG Intronic
904499817 1:30907635-30907657 ACCCTCCCACGACCACGGACGGG + Intronic
917625257 1:176839545-176839567 ACCCGAGCACCACTGCGGGCTGG + Intronic
917881878 1:179345025-179345047 ACCAGAACACGAGCGCTGAAGGG - Exonic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1072459871 10:95609223-95609245 ACCCCAACACGACAGAGGGCTGG + Intronic
1112271688 13:97975813-97975835 ATCCGAAGACGACCGCGGGCTGG + Intronic
1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG + Intronic
1161025442 19:2034707-2034729 ACCCGACCACGGCCGGGGAGGGG - Intronic
1165345986 19:35249082-35249104 ACACGAAGACGACCGCGTCCCGG - Exonic
968938512 4:3625941-3625963 ACCCGAACAGGAACGGGGGCTGG + Intergenic
998128815 5:139640903-139640925 ACCCGAACCCGATCCCGGGCAGG - Intergenic
1007631711 6:43276507-43276529 ACGCGCACACGGCCGCGCACGGG + Intronic
1046348769 8:112975937-112975959 ACCCCAACACGTCCAAGGACGGG - Exonic
1054452229 9:65409395-65409417 ACCCGAACAGGAACGGGGGCTGG - Intergenic