ID: 1143110516

View in Genome Browser
Species Human (GRCh38)
Location 17:4550266-4550288
Sequence GCTGCCGCTCAGGGTCATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143110512_1143110516 -8 Left 1143110512 17:4550251-4550273 CCACTAGCACGGCCAGCTGCCGC 0: 1
1: 0
2: 0
3: 13
4: 351
Right 1143110516 17:4550266-4550288 GCTGCCGCTCAGGGTCATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 144
1143110509_1143110516 17 Left 1143110509 17:4550226-4550248 CCTTGGTTGGTGACAGATGAGAA 0: 1
1: 0
2: 1
3: 20
4: 182
Right 1143110516 17:4550266-4550288 GCTGCCGCTCAGGGTCATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143110516 Original CRISPR GCTGCCGCTCAGGGTCATCC TGG Exonic
901835711 1:11922791-11922813 GCTGCACCTCAAGGCCATCCTGG - Exonic
903171491 1:21557243-21557265 CCTCCCGCTTAGGGTCATCATGG + Intronic
903729637 1:25482742-25482764 GATGCAGCCCAAGGTCATCCAGG - Intronic
912473957 1:109924121-109924143 GCTGGTGCCCAGTGTCATCCTGG + Exonic
912712247 1:111958320-111958342 GCTGCAGCTCAGGGTCCTGCAGG - Intronic
913386377 1:118262194-118262216 GCTGCTACTCAGTGTCAGCCAGG - Intergenic
914713248 1:150234356-150234378 GCTTGCTATCAGGGTCATCCCGG - Intronic
920290684 1:204921086-204921108 GCTGTCACTCAGGAGCATCCAGG - Intronic
921365951 1:214373945-214373967 CCTGCAGCTCAGGGTGATCAGGG + Intronic
1065520537 10:26567173-26567195 GCGGGAGCTCAGGGTCATCGAGG - Exonic
1066371850 10:34824350-34824372 GCTGGCGCTGAGGGTAATTCAGG + Intergenic
1067250376 10:44581487-44581509 CCTGCAGCTCTGGGACATCCTGG + Intergenic
1073196420 10:101695093-101695115 GCGGCCGCTCATGGGCAGCCAGG - Exonic
1075951213 10:126479254-126479276 GCTGGGGCTCAGGTTCATGCTGG + Intronic
1076420033 10:130324763-130324785 GCTGCCTCTCAGGGATCTCCTGG - Intergenic
1077197683 11:1289399-1289421 GCTGCTGCTCAGTGTGGTCCTGG - Intronic
1077353554 11:2104171-2104193 GCTGCCGCTCAGGGTACTCCCGG + Intergenic
1078551228 11:12281671-12281693 GTTACCCCACAGGGTCATCCTGG - Intronic
1084858857 11:72005319-72005341 CCAGCTGCTCAGGCTCATCCTGG + Exonic
1085365376 11:75937250-75937272 TCTGCCTCTCAGGTTCATCTGGG - Intronic
1089574341 11:119430976-119430998 GCTGTAGCTCAGGGGCTTCCAGG + Intergenic
1090265524 11:125350893-125350915 GCTGGAACTCAGGGTCCTCCTGG + Intronic
1090844501 11:130519528-130519550 GGAGCCGCTCAGGGTGAACCTGG + Intergenic
1093124683 12:15313986-15314008 GCTGCTGCTCAGGGTCATGATGG + Intronic
1095967904 12:47881908-47881930 GCTGCAGCTCCGAGTCATCGTGG + Intronic
1100315594 12:93441854-93441876 GCTGCCCCGCAGGATCATCAAGG - Exonic
1102905376 12:116670544-116670566 GCTGCAGCTCAGGACCAGCCTGG + Intergenic
1103888060 12:124217501-124217523 GCTGCAGCACAGGGGCAGCCCGG + Intronic
1104280763 12:127374363-127374385 ACTGAGGCTCAGGGACATCCAGG + Intergenic
1109484236 13:62997423-62997445 GCTGCAGCTCAGTATCTTCCAGG + Intergenic
1109721698 13:66283568-66283590 GCTGCTGCTCAGGATCACCTTGG - Intergenic
1111540976 13:89666987-89667009 GCTGCCTGTCGGGGTCATGCAGG - Intergenic
1111927507 13:94478997-94479019 GCCACAGCTCACGGTCATCCTGG + Exonic
1113878324 13:113608284-113608306 GCAGGCGCTCATGCTCATCCTGG + Intronic
1117935498 14:60900960-60900982 ACTCCAGCTCAGGGTCACCCAGG - Intronic
1118178414 14:63465820-63465842 GCTGACTCTCAGGCACATCCTGG - Intronic
1125603910 15:40929491-40929513 GCTGCCGCTGTAGGTAATCCAGG - Exonic
1125726822 15:41872363-41872385 GCTGCTGCTCAGGGACTTCGGGG + Exonic
1125805556 15:42490842-42490864 GCTGCGGCTCAGGGGCAACCTGG - Intronic
1128217496 15:65944557-65944579 CCTGTCGCTCAAGGCCATCCTGG - Intronic
1128875359 15:71197174-71197196 CCTGCCCCACAGGGTTATCCTGG + Intronic
1128944980 15:71813836-71813858 GCTGGGGCTCAGGGTCTCCCAGG - Intronic
1129210635 15:74065955-74065977 GCTGCCCCGCAGGCTCCTCCAGG - Intergenic
1129727835 15:77910588-77910610 GCTGCCCCGCAGGCTCCTCCAGG - Intergenic
1129840042 15:78738272-78738294 GCTGCCCCGCAGGCTCCTCCAGG + Intergenic
1131189346 15:90301344-90301366 GCTGCCCCTCAGGCTCCTTCCGG + Intronic
1132561312 16:595523-595545 GATGCCAGCCAGGGTCATCCCGG - Intronic
1132891585 16:2207419-2207441 GGGGCCGCTAAGGGACATCCAGG - Intronic
1134531578 16:14988432-14988454 GCTGCACCTCAAGGCCATCCTGG - Intronic
1135615078 16:23904158-23904180 GCTGCAGGCCAGGTTCATCCTGG - Intronic
1141824046 16:86466801-86466823 GCTGCCGCTGAGGTTCGTCAGGG - Intergenic
1142290365 16:89191462-89191484 GGCGCCGCTCACCGTCATCCTGG - Exonic
1142395319 16:89828473-89828495 TCCGCCGCGCAGGGTCAGCCTGG - Intronic
1143110516 17:4550266-4550288 GCTGCCGCTCAGGGTCATCCTGG + Exonic
1143444673 17:7000458-7000480 GCTGCAGCCCATGGTCATCCAGG + Exonic
1146156708 17:30530430-30530452 GCTGCTACCCATGGTCATCCAGG + Intergenic
1147160794 17:38568425-38568447 GCGCCTGCTCAGGGCCATCCTGG - Intronic
1147165676 17:38591947-38591969 GCTGCCAGACAGGGGCATCCTGG - Intronic
1147546699 17:41407486-41407508 TCTGCCGCTCCAGGTCAGCCCGG + Intergenic
1147553680 17:41462921-41462943 TCTGCCGCTCCAGGTCAGCCCGG + Exonic
1147555694 17:41477609-41477631 TCTGCCGCTCCAGGTCAGCCCGG + Exonic
1147741541 17:42673398-42673420 GCTACTGCTCAGGGACATACAGG - Exonic
1147782900 17:42956406-42956428 GCTCCACCTCAGGATCATCCAGG + Exonic
1150039920 17:61849700-61849722 GCTCCTTCTCAAGGTCATCCAGG + Intronic
1151763903 17:76122365-76122387 GCTGCAGGCCTGGGTCATCCAGG + Intergenic
1152426632 17:80221607-80221629 GCAGGCGCTCGGGGCCATCCCGG - Exonic
1152701614 17:81822551-81822573 GCAGCACCTCAGGGTCAGCCTGG + Exonic
1153961080 18:10140673-10140695 GCTGCAGCTCAGCTTCCTCCTGG - Intergenic
1154449035 18:14459823-14459845 TCTGCCGCTCAGCCCCATCCTGG + Intergenic
1156088818 18:33440792-33440814 GCTGCTGCTCCGGGGCCTCCTGG + Intronic
1158571194 18:58598215-58598237 GCTGCCGCTCTGGATCCTCCAGG - Intronic
1159815213 18:73065353-73065375 GCTGCCGTTGAGGGTCTCCCTGG + Intergenic
1160021539 18:75185363-75185385 GCTGCCCTTCAGGGTAAGCCCGG - Intergenic
1162417504 19:10546945-10546967 GCTCCAGCTCAGGGGCACCCTGG - Exonic
1162741414 19:12775699-12775721 CCTGCCGCTAGGGGTCAGCCTGG + Intronic
1165829386 19:38722965-38722987 GCTGCCCATCCGGCTCATCCTGG - Intronic
1165895724 19:39139727-39139749 GCTGCGCCTTAGGGTCACCCGGG + Intronic
1167443685 19:49525064-49525086 GCTGCTGCTGCGGGTCTTCCTGG + Intronic
926111713 2:10188108-10188130 GCTGCAGCTCGGGGTCCTCAGGG - Intronic
932073493 2:68643544-68643566 GCTCCCGCCCAGGGCGATCCCGG + Intergenic
934110416 2:88736975-88736997 GCTGCCAATCAGGGTGTTCCAGG - Intronic
938291492 2:130153114-130153136 GCTGCAGCTCCGGGTCCCCCTGG + Exonic
938465054 2:131519849-131519871 GCTGCAGCTCCGGGTCCCCCTGG - Intergenic
940912897 2:159224682-159224704 GCTGCTGCTCAGAGTCACCTGGG - Intronic
943525088 2:189006378-189006400 CCTGGCGCTCCTGGTCATCCAGG + Exonic
946339882 2:219060276-219060298 GCTGGCGCCCAGGGTCTTCTCGG + Exonic
946361435 2:219221263-219221285 CATGCCGCTCAGGTTCAGCCTGG + Exonic
947915629 2:233830275-233830297 GCTGCCTCTCAGGCTAACCCCGG + Intronic
948730489 2:239960793-239960815 GCTGCCGCTCTGTGTCATTCAGG - Exonic
948885166 2:240878648-240878670 GCTGTCGGTCAGGGTCAGGCAGG + Intronic
1175903953 20:62370857-62370879 GCTATGGCTCAGGGTCTTCCTGG - Intergenic
1176150555 20:63588761-63588783 TCTGGCACTCAGGGTCCTCCCGG + Exonic
1178623552 21:34197237-34197259 GCTGTAGCTCAGGGACAGCCTGG + Intergenic
1179923539 21:44520472-44520494 GCTGGGGCACAGCGTCATCCAGG - Intronic
1181111035 22:20603102-20603124 GCTGCAGCTCCGGGTCCCCCTGG + Intergenic
1181463689 22:23099513-23099535 GCTGCCCCACAGGATCATTCAGG - Intronic
1181997288 22:26892877-26892899 GCTCCGGTTCAGGGTCATTCAGG - Intergenic
1184179880 22:42813609-42813631 GCTGCCTCACAGGCTCATGCTGG - Intronic
949573114 3:5312260-5312282 GCTGCCCCACCGGTTCATCCAGG - Intergenic
950487694 3:13282733-13282755 GCAGCCGCTCGGCGCCATCCCGG - Intergenic
958841041 3:99205599-99205621 GCTCCCACTCAGAGGCATCCAGG - Intergenic
961016022 3:123469030-123469052 CCTGCCGCTGAGGGACATCTGGG - Intergenic
964767458 3:160192561-160192583 ACTGCGGCTCAGGGTACTCCAGG - Intergenic
968782388 4:2592947-2592969 GCTGCCACCCAGGGTCCTGCAGG - Intronic
969220050 4:5753415-5753437 GCGGCAGCTCATGGTCATGCTGG + Intronic
970637205 4:18022050-18022072 GCTCCCGCTCAGGGTTTTCGCGG - Intergenic
971551841 4:27967086-27967108 ATTGCCTTTCAGGGTCATCCTGG - Intergenic
979674808 4:123398783-123398805 GCCGCCGCTCCGGGTAATCGGGG - Intronic
985559205 5:574010-574032 TCTGCAGCTCAGGGTCCTGCTGG - Intergenic
985696751 5:1345140-1345162 GCTGCCGCGCACGCGCATCCAGG + Intergenic
986026323 5:3854617-3854639 ACTGCAGCTCCGGCTCATCCCGG - Intergenic
994353783 5:98773655-98773677 GCTGCCGCGCAGAGATATCCGGG + Intronic
1000021709 5:157323973-157323995 GCTGCTCCTCAGGGTCTTCTTGG - Exonic
1002175309 5:177398193-177398215 GCTGCCCCCCAGGGTCTTCCTGG + Exonic
1003188422 6:3852288-3852310 GCTGTCCCTTAGGGTCATCAGGG + Intergenic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1007142179 6:39587179-39587201 CCTGGGGCTCAGGGTTATCCCGG + Intronic
1008203617 6:48624826-48624848 GCTGTCATTCAGGATCATCCAGG - Intergenic
1011281051 6:85678431-85678453 GCCGCCGCTCAGGCACATGCCGG + Intergenic
1015238150 6:130994213-130994235 GTTACAGCTCAGGGTCATCTTGG - Intronic
1015711505 6:136146505-136146527 GCTTCTTCTCAGGGGCATCCAGG + Intronic
1017021469 6:150143302-150143324 GCAGCGGCTCAGGCTCCTCCCGG + Exonic
1017725236 6:157272497-157272519 GCTGCCCATCAGAGTCATCTGGG - Intergenic
1018183400 6:161243854-161243876 ACTTCAGCTCAGGGTCACCCTGG - Intronic
1018364462 6:163103720-163103742 GCTCCCAGTCATGGTCATCCAGG - Intronic
1019323666 7:426799-426821 GCTGCGAGTCAGGGTCTTCCTGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019425221 7:972248-972270 GCTGTCGCTTAGGCTCTTCCAGG - Intronic
1020513085 7:9084093-9084115 GCTGCCGACCAAGGGCATCCAGG + Intergenic
1021577265 7:22115957-22115979 ACTGCTGTTCAGGGTCTTCCAGG + Intergenic
1029224010 7:99011961-99011983 GCGGCCGCTCAGGGCCACCAAGG - Intronic
1034459171 7:151188398-151188420 GATGCCACCCAAGGTCATCCAGG - Intergenic
1035234094 7:157485081-157485103 GAAGCCGCTGAGGGTCAGCCCGG + Intergenic
1035999660 8:4586783-4586805 GCTGCAGCCCAGTATCATCCTGG - Intronic
1038788958 8:30650100-30650122 GGTGCCTCTCAGGGTAATTCTGG - Intronic
1039685904 8:39801669-39801691 GCTCAGGCTCAGGGACATCCGGG + Intronic
1040455355 8:47592578-47592600 GCTGCCCCGCAGGATCATCAAGG - Intronic
1040457994 8:47619528-47619550 GCTTCCTCTCAGGGTCATGTAGG + Intronic
1040604202 8:48913755-48913777 GCAGCAGGTCAGGGTCCTCCGGG + Intergenic
1041619324 8:59947702-59947724 GCTGCAGCACAAGATCATCCTGG - Intergenic
1055892920 9:81142266-81142288 GCTGCTGCTCAGGGGCACTCAGG + Intergenic
1055924507 9:81495860-81495882 GCTGCCACACAGGGTCAAGCGGG - Intergenic
1059227847 9:112689559-112689581 GCTGCTGCTCAGCGTGATCCCGG + Exonic
1059409259 9:114121987-114122009 GCAGCAGCTCAGGGTCCCCCCGG + Intergenic
1060701793 9:125759135-125759157 GCTGCCACTCAGTGTCACTCTGG - Intronic
1060794221 9:126503680-126503702 GCCGGCCCTCAGGGTCTTCCAGG - Exonic
1061005522 9:127926912-127926934 GCTGCCCCTCAGCGTCCTTCTGG + Intronic
1061605384 9:131706227-131706249 GCTGCAGATCAGGGTCATGGTGG + Intronic
1061811788 9:133166617-133166639 GCAGCAGCTCAGGGCCAGCCTGG + Intergenic
1190262356 X:48805441-48805463 GGAGCCGCTCAGGGCCTTCCGGG - Exonic
1197744392 X:129921406-129921428 GCAGTTGCTCAGGGTCCTCCTGG - Exonic
1199107203 X:143884109-143884131 GCTGCCCCACAGGATCATCAAGG + Intergenic
1200088817 X:153624933-153624955 ACTGCCACCCAGGGTCCTCCAGG + Intergenic
1201179758 Y:11333128-11333150 GCTGCGGGTCCGGGTCCTCCCGG - Intergenic