ID: 1143110853

View in Genome Browser
Species Human (GRCh38)
Location 17:4552042-4552064
Sequence CTAGTCCTGAGGTTCCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143110853_1143110856 -3 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110856 17:4552062-4552084 TAGTGGCCTAGCCCACTTCACGG 0: 1
1: 0
2: 0
3: 6
4: 48
1143110853_1143110862 8 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110862 17:4552073-4552095 CCCACTTCACGGACAGGGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 136
1143110853_1143110864 9 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110864 17:4552074-4552096 CCACTTCACGGACAGGGAAGGGG 0: 1
1: 0
2: 0
3: 22
4: 233
1143110853_1143110865 10 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110865 17:4552075-4552097 CACTTCACGGACAGGGAAGGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1143110853_1143110857 2 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110857 17:4552067-4552089 GCCTAGCCCACTTCACGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1143110853_1143110860 7 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110860 17:4552072-4552094 GCCCACTTCACGGACAGGGAAGG 0: 1
1: 1
2: 0
3: 6
4: 150
1143110853_1143110866 20 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110866 17:4552085-4552107 ACAGGGAAGGGGGCCGAGAGAGG 0: 1
1: 1
2: 6
3: 51
4: 634
1143110853_1143110859 3 Left 1143110853 17:4552042-4552064 CCTGGTGGGAACCTCAGGACTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1143110859 17:4552068-4552090 CCTAGCCCACTTCACGGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143110853 Original CRISPR CTAGTCCTGAGGTTCCCACC AGG (reversed) Intronic
900114171 1:1021420-1021442 GCAGTCCTGAGGCTCCCAGCAGG + Intronic
902684173 1:18065026-18065048 CTGCTCCTGAGGAGCCCACCTGG - Intergenic
903033495 1:20479854-20479876 CTAGGCCAGAGCTTCCCACCAGG + Intergenic
905652073 1:39663226-39663248 CTGGTCCTGAAGTTCCGAGCAGG - Intronic
905975337 1:42170078-42170100 GGAGTCTTCAGGTTCCCACCTGG - Intergenic
907121783 1:52014456-52014478 CTTGTCATGAATTTCCCACCTGG + Intergenic
915062377 1:153196932-153196954 CTCCTCCTAAGGTGCCCACCAGG - Intergenic
915661721 1:157410646-157410668 AGATTCCTGAGGCTCCCACCAGG + Intergenic
915994720 1:160550808-160550830 AGAGTCCAGAGGTTCCAACCAGG - Intronic
917510477 1:175665368-175665390 GCAGTCCTGAGGTCACCACCTGG - Intronic
922248543 1:223824868-223824890 CAAGTACAGAGGCTCCCACCTGG - Intronic
922415542 1:225419127-225419149 CTCTTCCACAGGTTCCCACCAGG + Intronic
922596359 1:226816603-226816625 CTGGTGCTGAGGTGTCCACCAGG - Intergenic
924544275 1:245010539-245010561 CTATTCCAGAGCTTCCCACAGGG - Intronic
1064048959 10:12043424-12043446 CTCTTCCTTAGGTTCGCACCAGG - Intergenic
1068619638 10:59167010-59167032 CTAGTTTTGAGTTTTCCACCAGG - Intergenic
1072621762 10:97084335-97084357 CTAGACCAGGGGTCCCCACCTGG + Intronic
1076475638 10:130749901-130749923 CTTGTCCTGAGATCCCCACCTGG + Intergenic
1077550530 11:3198121-3198143 CTTTGCCTGGGGTTCCCACCTGG - Intergenic
1078546494 11:12250915-12250937 CTAACCCTGAGGTCCACACCAGG + Intronic
1078977541 11:16495496-16495518 CTTGTCCTCAGGTTCCCAGGAGG - Intronic
1079990169 11:27238123-27238145 CTAGTCCTGAGGTACCAGCAAGG - Intergenic
1081669499 11:44935140-44935162 CAGGTCCTGTGCTTCCCACCTGG - Intronic
1084150797 11:67287076-67287098 CTAGTGCTGGGGTTCCCCTCAGG - Intergenic
1090436059 11:126687221-126687243 CTAGTCCTTATTTTCACACCTGG + Intronic
1090924089 11:131234434-131234456 CCAGTCCTGATGCCCCCACCTGG - Intergenic
1091389380 12:116720-116742 CTGCTCCTGAGGCTCCCACGAGG + Intronic
1094812526 12:34152643-34152665 CTAGTCCTTCGGTTGCCTCCTGG - Intergenic
1094841268 12:34343599-34343621 CCAGTCCTGAGGCGCCAACCCGG - Intergenic
1095981507 12:47977122-47977144 CTGGTCCTGAGGGTCCCATGGGG + Exonic
1099833708 12:87879279-87879301 CTTGTCTTAAGGTTCCCATCTGG + Intergenic
1100712969 12:97276963-97276985 CTAGACCTGAGTTTTCTACCAGG - Intergenic
1101633947 12:106521735-106521757 CAAGTCCAGTGGATCCCACCAGG + Intronic
1106754300 13:32806951-32806973 CAAAGCCTGAGGTTCCCACATGG - Intergenic
1107650562 13:42540799-42540821 CTAGACCAGTGGTTCCCAACTGG - Intergenic
1107868562 13:44726998-44727020 CTAGTCTTGTGGCCCCCACCCGG + Intergenic
1110716171 13:78706993-78707015 CTACTCCTCAGGTTCCCAATGGG - Intergenic
1117854689 14:60016129-60016151 CAGGTCCTGAGGTACCTACCTGG + Intronic
1119524078 14:75308456-75308478 CTAGTCCAGAGGCTCCCAAAGGG + Intergenic
1120881965 14:89420443-89420465 CTTGACCTGAGCTTCTCACCTGG + Intronic
1122393192 14:101404716-101404738 CTAACTCTGAGGTTCCAACCTGG + Intergenic
1123707179 15:22959033-22959055 ATTGTCCTGAGGGCCCCACCTGG - Intronic
1123994724 15:25710464-25710486 CTGCACCTGATGTTCCCACCAGG + Intronic
1127327793 15:57912314-57912336 CTAGGCCTCATGTTCCGACCTGG + Intergenic
1132843817 16:1990838-1990860 CTGGCCCAGAGGTTGCCACCTGG - Intronic
1136726947 16:32365535-32365557 CTATTCCTGAGATACCCAACTGG + Intergenic
1137250616 16:46737930-46737952 CCAGTCCTGAGGTTCTCGCTGGG + Exonic
1139046758 16:63070024-63070046 CTTGTCCTGAGTTTCACACCAGG + Intergenic
1139146517 16:64331532-64331554 CTTGTCCTGGGCTTCCCACAAGG + Intergenic
1140297932 16:73726997-73727019 CTAGTCCTGAGCTTCTCAATAGG - Intergenic
1141921405 16:87138147-87138169 CATCTCCTGAGGTTCCCAGCAGG - Intronic
1202999487 16_KI270728v1_random:152224-152246 CTATTCCTGAGATACCCAACTGG - Intergenic
1203131085 16_KI270728v1_random:1688623-1688645 CTATTCCTGAGATACCCAACTGG - Intergenic
1143110853 17:4552042-4552064 CTAGTCCTGAGGTTCCCACCAGG - Intronic
1146627937 17:34448139-34448161 CTAGGCCTTATGTTCCCTCCAGG + Intergenic
1146823332 17:36001909-36001931 CTATTCCTGTAGTTCCAACCAGG + Exonic
1147135848 17:38433885-38433907 CTGGTCCTGAGGTTGGCCCCGGG + Intronic
1149541257 17:57469885-57469907 CCTGTCCTGTGGTGCCCACCTGG + Intronic
1156474280 18:37395780-37395802 CCAGTCCTGAGGCCCCCACATGG + Intronic
1160863305 19:1246680-1246702 CTGGCCCTGTAGTTCCCACCTGG + Intergenic
1163524780 19:17814078-17814100 GTAGATCTGAGGTTCCAACCAGG - Intergenic
1165945841 19:39441659-39441681 CTAGGCCAGAGGACCCCACCTGG + Exonic
1166071885 19:40392839-40392861 TAAGTCCTGAGGCTCCCAGCAGG - Intergenic
1166599785 19:44083826-44083848 CCAGTCCTGAGGCCCCCACATGG + Intronic
1166867742 19:45850943-45850965 CTCGTCCCCAGGTTGCCACCTGG - Intronic
928195699 2:29215210-29215232 TTAGTCCTGAGGTGCCCACAGGG + Intronic
930590170 2:53317852-53317874 AAAGTCCTGAAGCTCCCACCTGG + Intergenic
933628820 2:84633365-84633387 TTAGTGCTGAGATCCCCACCAGG - Intronic
934319032 2:91955535-91955557 CTATTCCTGAGATACCCAACTGG - Intergenic
934673060 2:96228911-96228933 CGAGTCCTGAGGTGGCCACAGGG + Intergenic
936064472 2:109319997-109320019 CTATTCTGGAGGTTCCCAGCTGG + Intronic
936867948 2:117098280-117098302 CAAGTCCTCAGTTTCCCTCCAGG - Intergenic
946236786 2:218329284-218329306 CTAGGCCTGAGGGTCCCAGAGGG - Intronic
946904239 2:224401061-224401083 GTAGTCCTGAGTCTGCCACCTGG + Exonic
947859431 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG + Intergenic
947959281 2:234221453-234221475 CTAGTCCAGAGTTTCCCAACTGG + Intergenic
1171489903 20:25509479-25509501 CAAGAGCTGAGGTTCACACCAGG - Intronic
1173176352 20:40767694-40767716 AGAAGCCTGAGGTTCCCACCAGG - Intergenic
1174120625 20:48262549-48262571 CTAGGGCTGAGGTTCTAACCTGG + Intergenic
1175122048 20:56723308-56723330 CTAGTCCAAAGGTTCTCAACAGG - Intergenic
1175270621 20:57731378-57731400 CTAGCCCAGTGGTTCCCAACTGG - Intergenic
1179824521 21:43956753-43956775 CTACTCCTGAGGGGGCCACCTGG - Intronic
1179903448 21:44406866-44406888 GGGGTCCTGCGGTTCCCACCTGG + Intronic
1180307211 22:11139200-11139222 CTATTCCTGAGATACCCAACTGG - Intergenic
1180545731 22:16501384-16501406 CTATTCCTGAGATACCCAACTGG - Intergenic
1183438133 22:37807234-37807256 CTAGTACTTAGTTTCACACCCGG + Exonic
954040741 3:47885439-47885461 CAAGTCCTGAGATCCCTACCAGG + Intronic
954455044 3:50593178-50593200 CCAGGCCTGAGGCTCCCATCGGG - Intergenic
954906769 3:54069854-54069876 CAAGCCCAGAGGTTCCTACCAGG - Intergenic
956369040 3:68538084-68538106 CCAGTCCTGTGGCCCCCACCTGG - Intronic
961575177 3:127830196-127830218 CAGGTCCTGAGGTCCCCAGCAGG + Intergenic
962772949 3:138630091-138630113 CTAGCCCTGATGTTCACATCTGG - Intronic
963067930 3:141278595-141278617 CAAGTCCTGCAGTTGCCACCAGG + Intronic
972297948 4:37758023-37758045 CTTTTTCTGTGGTTCCCACCTGG + Intergenic
975209097 4:71678303-71678325 CTAGTCCAGAGCTTTCCAGCTGG - Intergenic
975367731 4:73548101-73548123 GTAATCCTGTGGTTCCCAGCTGG - Intergenic
977302331 4:95282009-95282031 CTAGACCTGTGGTTCTCAACTGG - Intronic
977951386 4:102974941-102974963 CTATTCCTGAGGTACCCAACGGG - Intronic
987620269 5:20331174-20331196 CTAGTCCTGAATTTCCCAAAGGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
1000804595 5:165774187-165774209 CTAGACCTGAGATGCCCACTAGG + Intergenic
1002193534 5:177490781-177490803 CTACTCCTGAGGCTCCCAGCTGG - Intronic
1004025433 6:11813730-11813752 CTTGCCTTGATGTTCCCACCAGG + Intergenic
1010036706 6:71333788-71333810 CTAGTCCTGGATTTTCCACCAGG + Intergenic
1014119769 6:117711503-117711525 CTAGTGCAGTGGTTCTCACCTGG + Intergenic
1017501040 6:155023217-155023239 CTAGAGCAGAGATTCCCACCTGG - Intronic
1019776672 7:2915653-2915675 CTGCACCTGAGGTTCCCACGGGG - Intronic
1021453577 7:20804830-20804852 CTAGTCGGGAGGTTCCCTTCAGG + Intergenic
1021531489 7:21651170-21651192 TGAGTCCTGAGGTGCTCACCAGG + Intronic
1026519304 7:71102532-71102554 CTGGTCCTGAGGTGTCCTCCTGG - Intergenic
1027024401 7:74840546-74840568 CTTGTCCCGAGGTTCCTTCCTGG + Intronic
1027063364 7:75103576-75103598 CTTGTCCCGAGGTTCCTTCCTGG - Intronic
1028926415 7:96361333-96361355 CCAGTCCCGAGGCTTCCACCAGG - Intergenic
1034503399 7:151466645-151466667 CTTGTCCTGAGTTTCTCACTTGG - Exonic
1034546559 7:151793540-151793562 CGAGGCCCGCGGTTCCCACCTGG + Intronic
1035027171 7:155833730-155833752 CTCGGCCTCAGGTTCCCAGCAGG - Intergenic
1040063753 8:43127700-43127722 CTAGTCCTCAGGACCCCAGCTGG + Intergenic
1042335377 8:67624758-67624780 CTGGTACAGAGCTTCCCACCTGG + Intronic
1043978822 8:86614762-86614784 CTAGGCATGAGGTTGCCAACCGG + Intronic
1049767155 8:144360191-144360213 CTGCTCCTGGGGCTCCCACCTGG - Exonic
1051229648 9:14942459-14942481 CTAGACCTGCGGTTCTCAACAGG - Intergenic
1055475136 9:76655752-76655774 CTATTTCTGAGTTTCCCACTTGG - Intronic
1055496475 9:76860120-76860142 CTGGTCCTGAGACTCCCTCCCGG - Intronic
1055887866 9:81085944-81085966 CTAGGCCTGAGGTTCTCATCTGG - Intergenic
1055971423 9:81916176-81916198 CTTGTCATGAGGCTGCCACCAGG - Intergenic
1057187403 9:93064641-93064663 CTAGTCATGAGCTCCCCACAGGG + Intronic
1057880441 9:98788860-98788882 CTGGGCCTCAGTTTCCCACCTGG + Intronic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1062107766 9:134765170-134765192 TCAGTCTTGGGGTTCCCACCAGG + Intronic
1185946920 X:4386951-4386973 CTAGTCTTGTGGTCCTCACCCGG + Intergenic
1186182093 X:6983367-6983389 CCAGTTCTGTGGTCCCCACCCGG - Intergenic
1196016910 X:110949330-110949352 CTAGTCCTCAGGTTACCAACTGG - Intronic