ID: 1143111272

View in Genome Browser
Species Human (GRCh38)
Location 17:4554354-4554376
Sequence TGGGAGAAGTTGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 900
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 838}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143111272_1143111285 22 Left 1143111272 17:4554354-4554376 CCTTCCCCCTTCAACTTCTCCCA 0: 1
1: 0
2: 1
3: 60
4: 838
Right 1143111285 17:4554399-4554421 CACCTTCTATGTACCTTCTATGG 0: 1
1: 0
2: 0
3: 4
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143111272 Original CRISPR TGGGAGAAGTTGAAGGGGGA AGG (reversed) Intronic
900040468 1:458297-458319 TGGCAGAAGATCAAGTGGGATGG + Intergenic
900061898 1:693268-693290 TGGCAGAAGATCAAGTGGGATGG + Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
902042162 1:13500547-13500569 TGGGACAACTTGAAGTGGGGAGG - Intronic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902735122 1:18395501-18395523 TGGCAGAAGGTGAAGGGGAGCGG - Intergenic
903895262 1:26598825-26598847 TAGGAGAAGTTGAGCTGGGAAGG + Intergenic
904009621 1:27382404-27382426 TGAGAGAAGGTGCAGGGGGGAGG + Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904014388 1:27408805-27408827 GGTGAGATGATGAAGGGGGAGGG + Intronic
904456247 1:30649886-30649908 TGGGAGCAGGTGAACGGGCAGGG - Intergenic
904495502 1:30884224-30884246 GGGGAGGAGTGGAATGGGGAGGG + Intronic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
904990310 1:34587231-34587253 TGGGAGGAGGTAAAGGGAGAAGG + Intergenic
905046880 1:35011295-35011317 AGGGGGAAGTTTTAGGGGGAAGG - Intronic
905264122 1:36739380-36739402 TGGGAGAACTTGAGGGAGGGAGG - Intergenic
905470529 1:38188297-38188319 TGGGAGGAGGAGGAGGGGGAGGG + Intergenic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
907286145 1:53381064-53381086 GGGAAGAAGTAGAAGAGGGAAGG - Intergenic
907438455 1:54464054-54464076 TGGGAGAAGACGTAGGTGGAGGG - Intergenic
908268066 1:62397698-62397720 TGGGGGAGGTTGAAGGGGTTGGG - Intergenic
910121581 1:83796430-83796452 TGGGACAACTTGAAGAGGGGAGG + Intergenic
910248474 1:85168173-85168195 GGGGTGAAGTTTAAGGGGGTGGG - Intronic
910332513 1:86090565-86090587 TGGTGGAAGTAGAAGGGGGTGGG - Intronic
910491430 1:87776680-87776702 TAGGAGAAGATGCAGGTGGAAGG - Intergenic
911032146 1:93500487-93500509 TGGAAGAAGAGGAAGAGGGATGG + Intronic
911248902 1:95552554-95552576 TTTGAGAAGATGAAAGGGGACGG - Intergenic
911441633 1:97934358-97934380 TGGGAGAAGTTTCATGGAGAGGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912258561 1:108085787-108085809 TGGGGGATGGTGCAGGGGGAAGG + Intergenic
912511405 1:110192564-110192586 TGGGAGAAGTTGACGTGGGGTGG - Exonic
912720980 1:112019764-112019786 CAGGACAAGTTAAAGGGGGAGGG + Intergenic
914230276 1:145759788-145759810 TAGGAGAAGTTGATGGGAGTGGG - Intronic
914886943 1:151593262-151593284 TGGGACAACTGGAAGGGGGTTGG + Intergenic
915831998 1:159140035-159140057 TGGGGGAAGGGGAAGGGGAAGGG - Intronic
916172427 1:162010962-162010984 TGGGTGAAGCTGGAGTGGGAGGG + Intronic
916460956 1:165023742-165023764 TGGCAGAAGGTGAAAGGGTAAGG + Intergenic
917051276 1:170926789-170926811 TGGGAGAACTTGAGAGGAGAGGG + Intergenic
917732901 1:177893899-177893921 GGGAAGTACTTGAAGGGGGAGGG + Intergenic
918469243 1:184853664-184853686 TGGGAGAAGATTCAGTGGGAAGG - Intronic
918513466 1:185336763-185336785 TGGGAGAAGTTGTGGGGAGCAGG - Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918833978 1:189435521-189435543 TGGGAGAGGGGGAAGGGGAAGGG + Intergenic
918844627 1:189593921-189593943 TGGAAGAAGGTGAAGGGGAAAGG - Intergenic
919362005 1:196608426-196608448 TGGGAGAAGGGGAAGGGGACAGG + Exonic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919865050 1:201775118-201775140 TGGGAGCAGATGGAGGGGAATGG - Intronic
920084927 1:203408523-203408545 TGGGAGTAGTAGTAGGAGGAGGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920344782 1:205299152-205299174 GGCGAGAAGCTGAAGGGTGAGGG - Intergenic
920392220 1:205614831-205614853 TGGGAGAGATTGGTGGGGGAGGG + Exonic
920579799 1:207095896-207095918 TGGCAGAAGGCAAAGGGGGAGGG - Intronic
920654637 1:207866678-207866700 TTGGAGTAGATGCAGGGGGAAGG - Intergenic
920693287 1:208163169-208163191 TGGCAGAAGTGGCATGGGGAAGG + Intronic
920933388 1:210409315-210409337 TGAGAGGAGTTAGAGGGGGATGG + Intronic
921343703 1:214159888-214159910 TTGGACAACTTGAAGTGGGAAGG - Intergenic
922777665 1:228223949-228223971 GGGGAGAAGTGGCCGGGGGATGG + Intronic
922905008 1:229167645-229167667 AGGGAGAAGTGGGAGGGAGAGGG + Intergenic
922982539 1:229839848-229839870 AGGGAGCTGTTGAAGGGGAAGGG + Intergenic
923186013 1:231574318-231574340 AGGCAGAAGTTGCAGTGGGACGG - Intronic
923259780 1:232257878-232257900 GGGGAGAATTTGGAGGGTGAGGG - Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923912048 1:238459846-238459868 TGGGAGAAGTGGAAGTGGAAGGG + Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924298607 1:242614051-242614073 TGAGAGGAGTGGAAGGGGCAGGG + Intergenic
924323431 1:242871888-242871910 TGGGACAAGTAGAAAGGGCATGG + Intergenic
924430214 1:243990089-243990111 TGGGTGGAGTGGAAGGGTGAGGG + Intergenic
1063323465 10:5074108-5074130 TGGGACAACTTGAAGTGGGGAGG - Intronic
1064102797 10:12477731-12477753 GGGAAGAAGCTGAAGGCGGAGGG + Intronic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1065981738 10:30904500-30904522 GGGCAGAAGTGGAAGTGGGAGGG - Intronic
1067766792 10:49092988-49093010 TGGGGGAGGTAGAAGGGAGACGG - Intronic
1067852271 10:49761683-49761705 CGGGAGATGTGGGAGGGGGACGG - Intronic
1068317392 10:55364165-55364187 TGGCAGAAGGGGAAGGGGAAGGG - Intronic
1068538262 10:58264953-58264975 TGGGAGAATGAGTAGGGGGAAGG + Intronic
1068720149 10:60236330-60236352 TGGGAGAATTTGAACATGGAGGG - Intronic
1068942286 10:62691776-62691798 AGGGAGAAGTTAAAGGTGTAAGG + Intergenic
1069029504 10:63580377-63580399 TCTGAGAAGCTGAAGTGGGAAGG - Intronic
1069270404 10:66519645-66519667 TGGGACAAGTAGAAATGGGAAGG - Intronic
1069280231 10:66646457-66646479 TGGGGCAAGTGGAAGGGGTAGGG + Intronic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071971901 10:90916067-90916089 GGGGAGAAGGAGGAGGGGGAGGG + Intronic
1071988367 10:91075278-91075300 TGGCAGAACTAGAAGGTGGAAGG + Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072537536 10:96374884-96374906 TGGGATAAGGTGAGCGGGGACGG + Intronic
1072873134 10:99142176-99142198 AGGGTGAGGTTGAAGGGGCAGGG - Intronic
1073077076 10:100830815-100830837 TAGGAGAGGTTGCAGGGGGAAGG + Intergenic
1074204685 10:111272367-111272389 TGGGAGGGGTGGAAGCGGGAAGG + Intergenic
1074442821 10:113493899-113493921 AGGGAGAGGTTTAAGGGGGTGGG - Intergenic
1074460441 10:113631924-113631946 TGGGAGAAGACAAAGGGGAAAGG - Exonic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076785737 10:132749024-132749046 TGGGTGAAGCTGACGTGGGAGGG - Intronic
1076966741 11:94520-94542 TGGCAGAAGATCAAGTGGGATGG + Intergenic
1077003913 11:341704-341726 TGGCAGAAGGTGAAGAGGAAGGG - Intergenic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077593773 11:3513940-3513962 TGGGATAACTTTAAGGGAGAAGG + Intergenic
1078241049 11:9531116-9531138 TGGCAGCAGTTGCAGGGTGAGGG - Intergenic
1078334052 11:10450482-10450504 TGGGAAAAGTTGTGCGGGGAGGG + Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078936006 11:15950930-15950952 TGGGAGAGGGAGAAGGGGAATGG - Intergenic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079508996 11:21188123-21188145 TTGGGGAAGATGAAGGGGAAAGG + Intronic
1081112736 11:39157003-39157025 TGGGGGAAGGGGAAGGGGGGAGG - Intergenic
1081715458 11:45246834-45246856 TGGCAGAAGGTGAAGGGTAATGG - Intronic
1082132362 11:48506207-48506229 AGGGGGAAGTGGAAGAGGGAAGG - Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082565825 11:54676827-54676849 AGGGGGAAGTGGAAGAGGGAAGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1083310412 11:61780903-61780925 TGGGAGAGCTTGAGGGGAGAGGG - Intronic
1083315616 11:61813364-61813386 CGGGAGAAGATGAAAGGTGAGGG + Intronic
1083421205 11:62554301-62554323 TGGGAGACTTTCAAGGTGGAAGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083670426 11:64297048-64297070 TGGGGGAAGGTGCAGGGAGACGG + Intronic
1083715794 11:64576205-64576227 TGGGAGGATTTGACTGGGGAGGG - Intergenic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1084249587 11:67886668-67886690 TGGGATAACTTTAAGGGAGAAGG + Intergenic
1084823226 11:71708821-71708843 TGGGATAACTTTAAGGGAGAAGG - Intergenic
1084907436 11:72358828-72358850 TGGGGGAAGTGGAAGAGGGGTGG - Intronic
1085273456 11:75283713-75283735 GGGGAGAGGTGGGAGGGGGAAGG - Intronic
1085678960 11:78552693-78552715 TGGGAGAACTCGAAGTGGGGAGG - Intronic
1085816337 11:79741336-79741358 GGAGAGAATGTGAAGGGGGAAGG - Intergenic
1087693320 11:101347236-101347258 TGGAAGAGGTGGAAGGTGGAAGG - Intergenic
1087793300 11:102430039-102430061 TGGGAGAGGTGGCATGGGGAAGG - Intronic
1088028532 11:105217275-105217297 AGGGAGGAGTTGAACTGGGAAGG + Intergenic
1088722490 11:112606731-112606753 AGGGAGAGGTTAAAGTGGGAAGG + Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1088799604 11:113293499-113293521 GGGGAGGAGTTGGAGGAGGAGGG - Intergenic
1088809938 11:113385449-113385471 TGGGAGAAGTTGTAAGTGGAGGG - Intergenic
1089058360 11:115606243-115606265 TGGAATAAGTGGAAGGTGGAGGG - Intergenic
1089064280 11:115650593-115650615 AGGGAGGAGTTGCAAGGGGAGGG - Intergenic
1089083363 11:115796199-115796221 TGGGAGAATTTGGGGAGGGATGG + Intergenic
1089480945 11:118804665-118804687 TGGCATGAGTTGAAGAGGGAGGG - Intergenic
1089500960 11:118930884-118930906 GGAGAGAAGCTGAAGGGGGTTGG - Intronic
1089688580 11:120172206-120172228 TGGGAGAGCTAGAAGGTGGATGG + Intronic
1090636573 11:128693673-128693695 TGGGGGAAGGTGATGGGGGGAGG + Intronic
1090914633 11:131152405-131152427 TGGGATATCTTGAAGGGGTAGGG + Intergenic
1090988589 11:131795767-131795789 TGGGAGCAGTTGACTGGGGTTGG + Intronic
1091563896 12:1633860-1633882 TGGAATAAGTGGGAGGGGGAAGG - Intronic
1091856713 12:3746417-3746439 TGGGAGAGGAAGAAGGGAGAGGG - Intronic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1091930851 12:4394174-4394196 TGGGTGAAGCTGGTGGGGGAAGG - Intergenic
1092229619 12:6769319-6769341 TGGGAGAACTTGATGGGGGTGGG + Intronic
1092419872 12:8322067-8322089 TGGGATAACTTTAAGGGAGAAGG + Intergenic
1092647432 12:10591426-10591448 TGGGATAAGGTGCAGGGTGAAGG - Intergenic
1092998975 12:13977922-13977944 TAGGCGAGGTTGAAAGGGGAGGG - Intronic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1094172421 12:27507662-27507684 TGGGAGAGGTGGGATGGGGATGG - Intergenic
1094220200 12:27984807-27984829 TGGGAGAAGCTGAAAGGACATGG + Intergenic
1094339390 12:29393646-29393668 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1094468299 12:30778276-30778298 TGGGACAACTTGAAGCGGGGAGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095168081 12:38998380-38998402 GGGGAGAAAGGGAAGGGGGAGGG - Intergenic
1095598994 12:43993548-43993570 TTGGAGAAGATGGAGGGGGGTGG + Intronic
1095856697 12:46867478-46867500 TGGGACAATTTAAAGTGGGAAGG + Intergenic
1096363323 12:51007104-51007126 TGGGACAACTTGAAGTGGGGAGG - Intronic
1096531214 12:52243997-52244019 TTGGAGGTGTTGATGGGGGAAGG + Intronic
1096858482 12:54504498-54504520 TGAGAAAAGTTGAAGGGCAAAGG + Intronic
1097268319 12:57758665-57758687 TAGGAGGAGATGCAGGGGGAGGG + Exonic
1097440304 12:59599722-59599744 TGGGATGAGTTGAAGGGAGGAGG - Intronic
1098126518 12:67300449-67300471 TGGGAGATGGGGAAGGGGCAGGG - Intronic
1098819027 12:75207252-75207274 TGGGAGAAGTTGAAGCAGCAGGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100588879 12:96005591-96005613 AGGTAGAAATTGAAGGTGGAGGG - Intronic
1101018237 12:100524703-100524725 TAGGAGCAGTTGAAGAGGGTAGG - Intronic
1101332823 12:103770860-103770882 TGGGAGGTGATTAAGGGGGAGGG + Intronic
1101673285 12:106896583-106896605 GGGGAGGAGAGGAAGGGGGAGGG + Intergenic
1101673294 12:106896603-106896625 GGGGAGGAGAGGAAGGGGGAGGG + Intergenic
1101965596 12:109279900-109279922 TGGGAGGAGATGAAGGATGAGGG - Exonic
1102388011 12:112527131-112527153 TGGGAGAAGTTTCAAGGAGAGGG - Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1102760608 12:115381600-115381622 GGGGAGTAGATGAATGGGGAGGG - Intergenic
1102805058 12:115772427-115772449 TGAGAAAAGTTAAAGGGTGATGG - Intergenic
1103095990 12:118132828-118132850 TAGGATAACTTGAAGTGGGAGGG + Intronic
1103261974 12:119595349-119595371 TGGGCGGACTTGATGGGGGACGG - Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103933070 12:124460773-124460795 TGGGAGAGGTTCAGGTGGGAAGG - Intronic
1103948850 12:124541031-124541053 GGGGTGGAGATGAAGGGGGATGG + Intronic
1104133571 12:125917199-125917221 TGGGGGAAGTTCCAGGGTGAGGG + Intergenic
1104304176 12:127594340-127594362 TGGGCTAACTTGAATGGGGAGGG + Intergenic
1104748038 12:131221998-131222020 TGGGGGAAGGTGGAGGGAGATGG + Intergenic
1104842735 12:131832380-131832402 TGGGGGAACGGGAAGGGGGAAGG + Intronic
1105379913 13:19877261-19877283 GCTGAGAAGTTGAAGGGGCATGG + Intergenic
1105963447 13:25363844-25363866 TGGGATGGGGTGAAGGGGGAGGG + Intergenic
1106627266 13:31433587-31433609 TGGGTGTAGTTTAAGGGGAAAGG - Intergenic
1107257862 13:38451897-38451919 TGGGAGAATTTCATGGGGAAAGG - Intergenic
1108117983 13:47151051-47151073 TGTGAGAAGTTGAACTGGAAAGG - Intergenic
1108996678 13:56743193-56743215 TGTGAGAAGTGGAAAGAGGATGG - Intergenic
1109585237 13:64392906-64392928 GGTGAGAAGTTGATGGGGGCGGG - Intergenic
1110425716 13:75364062-75364084 TGGGAGAACTCAAAGGGGCAGGG + Intronic
1111093246 13:83474866-83474888 TGTCAGAAGTTAAAGGGGGGAGG - Intergenic
1112479189 13:99758261-99758283 TGGCATCAGGTGAAGGGGGAAGG + Intronic
1113218575 13:108071380-108071402 TGTGGGAAGTTGAGGGGGGCAGG + Intergenic
1113680143 13:112238230-112238252 TGGCAGAAGGTGAAGCAGGAGGG + Intergenic
1114260113 14:21030517-21030539 GGGGTGAAGGAGAAGGGGGAGGG - Exonic
1114261396 14:21039163-21039185 TGGGAGGGAGTGAAGGGGGAAGG - Intronic
1114288402 14:21267580-21267602 GGGGAAAAGTTGAAGAAGGATGG - Intronic
1114552995 14:23544846-23544868 TGGGAGAAGGAGAAGTGGAATGG - Intronic
1116093223 14:40335248-40335270 TGGGACAACTTGAAGTGGGGAGG + Intergenic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1117079602 14:52137589-52137611 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1118240843 14:64057250-64057272 TGGGGGAGGTGGAAGGGAGATGG - Intronic
1118319944 14:64747188-64747210 TGGCACACGTGGAAGGGGGAGGG + Exonic
1118405670 14:65421354-65421376 TGGTAGAGGTGGAAGGGGGAAGG + Intronic
1118798417 14:69166801-69166823 TGGAAGAATTTGGAAGGGGAGGG + Intergenic
1119533032 14:75376483-75376505 TGGTGGAAGGTGAAGAGGGAGGG - Intergenic
1119630212 14:76224229-76224251 TGGGAAAAGGGGAATGGGGAAGG + Intronic
1119940274 14:78633454-78633476 TGGGATATGTTGAAGGGGAGTGG - Intronic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1120993160 14:90396645-90396667 TTGGAGATGTTGAGGTGGGAGGG + Intronic
1121307828 14:92917986-92918008 TGGGAGAAGATGGGTGGGGAGGG - Intergenic
1121780799 14:96620948-96620970 GGGGAGAAGTGGAATGGGCATGG - Intergenic
1122556015 14:102580502-102580524 AGTGAGAATTTGAAGGGGGCAGG + Intergenic
1122884319 14:104703847-104703869 TGGCAGAAGTGAAATGGGGAAGG + Intronic
1123062865 14:105602078-105602100 AGAGAGAGTTTGAAGGGGGAGGG - Intergenic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1123541059 15:21292023-21292045 GGGGGGAAGTTAATGGGGGAAGG + Intergenic
1123917388 15:25046418-25046440 TGGGAGCACTTGAAGGTAGAAGG - Intergenic
1125628937 15:41132010-41132032 AGGGAGAGATTGAAGGGTGAAGG - Intergenic
1125720270 15:41841994-41842016 TGGGAGGAGGTGCAGAGGGAGGG - Intronic
1125779771 15:42254686-42254708 TGCCAGGAGTTGAAGGGGAAGGG + Intronic
1127415044 15:58749597-58749619 AGGGAGAAGCTGAAGGGGCTTGG + Exonic
1127842918 15:62846107-62846129 TGGGAGATGCTGTAGTGGGAGGG + Intergenic
1127883224 15:63176253-63176275 GGGGAGAAGGTGAAGGGGGTAGG - Intergenic
1127905661 15:63374050-63374072 TGGTAGGAGGTGGAGGGGGAAGG - Intronic
1128089343 15:64908759-64908781 TGGGTGAATTTTAAGGGGCAGGG + Intronic
1128254042 15:66184374-66184396 TGGGAGCTGTGGAAGAGGGAGGG - Intronic
1128485538 15:68082850-68082872 TGGGGTATGTTAAAGGGGGAAGG + Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1129057835 15:72834516-72834538 TGGCAGAGGATGAAGGAGGAGGG + Intergenic
1129171527 15:73811022-73811044 TGGGGGAAGTTGGAGAGGCAAGG + Intergenic
1129306364 15:74666693-74666715 TGGGGGAAGTTGAACAGGTAAGG + Intronic
1130161123 15:81401340-81401362 TGGGAGAAAGTGAAGGGGGCTGG + Intergenic
1130535887 15:84784697-84784719 TGGGAGAGGATGAAGGGGCTGGG - Exonic
1130844728 15:87734140-87734162 TGGGAGTGGATGAAGAGGGATGG + Intergenic
1130990116 15:88871122-88871144 TGGGAGAGGGTGAGGGGGGAGGG + Intronic
1131011144 15:89019507-89019529 TGGGTGAAGTAGGAAGGGGAAGG - Intergenic
1131202770 15:90414212-90414234 TGGGAGATGGAGAAGGGGGCGGG + Intronic
1131284738 15:91047920-91047942 GGGGAGAAGCGGAGGGGGGAAGG - Intergenic
1131342493 15:91615600-91615622 TGGGAGAAGCTGATTTGGGAAGG + Intergenic
1132023820 15:98387395-98387417 TTGGGGAAATTGTAGGGGGAGGG + Intergenic
1132200232 15:99948089-99948111 TGGCAGAAGTTGAAGAGGTAAGG - Intergenic
1132272034 15:100534935-100534957 TGGGACAATTTGAAGTGGGGAGG - Intronic
1132441438 15:101869326-101869348 TGGCAGAAGATCAAGTGGGATGG - Intergenic
1202949372 15_KI270727v1_random:19164-19186 GGGGGGAAGTTAATGGGGGAAGG + Intergenic
1132495615 16:261916-261938 TGGGAGATGTGGAAGGGTAAGGG - Intronic
1132498925 16:276132-276154 TGGGTGAAGGCGAAGTGGGACGG + Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1133971421 16:10570904-10570926 TGGAAGAAGAAGAAGGGCGAGGG + Intronic
1134086901 16:11363468-11363490 TGTGAGAAGTTGAAGGGAGGGGG + Intronic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134449249 16:14353824-14353846 GGAGAGTAGTAGAAGGGGGAGGG + Intergenic
1134449349 16:14354080-14354102 TGGGAGGAGGGGGAGGGGGAGGG + Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1135187625 16:20328816-20328838 TATCAGAAGTTGGAGGGGGAAGG - Intergenic
1135265033 16:21017502-21017524 TGGGACAACTTGAAGTGGGGAGG - Intronic
1135991613 16:27222025-27222047 TGGGGTAACTAGAAGGGGGATGG + Intergenic
1136393011 16:29977287-29977309 TGTGAGAGGTTGAGGGAGGAGGG + Intronic
1136672469 16:31871109-31871131 TGGCAGAATTTGAAGGTGGCAGG - Intergenic
1137543146 16:49378307-49378329 TGGGAGAGGTCGGAGGGGCAGGG - Intronic
1138221137 16:55251266-55251288 TGGCCGATGCTGAAGGGGGAAGG - Intergenic
1138328421 16:56193300-56193322 AGGTAGAGGTGGAAGGGGGAGGG + Intronic
1138530229 16:57630775-57630797 TGGGAGAAGGTGGGAGGGGAAGG + Intronic
1138705610 16:58912172-58912194 TGGCAGAAGGCAAAGGGGGAGGG - Intergenic
1138837722 16:60458763-60458785 GGGCAGAAGTTGAAGAGGGCTGG - Intergenic
1138877918 16:60975366-60975388 TGGGAGAGGATGCTGGGGGAAGG + Intergenic
1138932559 16:61678145-61678167 TGGGACAACTTGAAGGGTGTTGG - Intronic
1139327483 16:66163676-66163698 TGGGAGGAATTGGAGGGAGAGGG + Intergenic
1140355253 16:74299730-74299752 TGGGAAAAGTTTAAAGGTGAAGG + Intronic
1141973072 16:87495790-87495812 TGGGAGATGGGGATGGGGGAGGG - Intergenic
1142112433 16:88339638-88339660 TGGGGGACGTGGCAGGGGGATGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1143022811 17:3925514-3925536 TGGGAGAAGTGGAGGATGGAAGG - Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143289926 17:5820764-5820786 GGGGAGAAGATGAAGAGGCAGGG - Intronic
1143686770 17:8523653-8523675 AGGGAGAAGTGGAAGTGGGGAGG + Intronic
1143887534 17:10076198-10076220 AGGGAGAAGTGGGAGGGGGAGGG + Intronic
1144273535 17:13643179-13643201 GGGGTTAAGGTGAAGGGGGAGGG - Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144582889 17:16469847-16469869 TGGGAGAGGATGAAGGGAGAGGG + Intronic
1144967519 17:19087363-19087385 TGGAAGAAGACGGAGGGGGAAGG + Intergenic
1144980400 17:19164702-19164724 TGGAAGAAGACGGAGGGGGAAGG - Intergenic
1144987822 17:19213530-19213552 TGGAAGAAGACGGAGGGGGAAGG + Intergenic
1145890077 17:28407994-28408016 AGGGAGGAGTTGGAAGGGGAGGG - Intergenic
1146552046 17:33789094-33789116 TGGCAGAAGCTGAACGGGGCAGG - Intronic
1147236840 17:39064385-39064407 TGTGAGAAGTTTTAGGGGCAGGG + Exonic
1147334317 17:39717455-39717477 TGGGTGCAGTTGATGGGGCAAGG - Exonic
1147882408 17:43662695-43662717 TGGGTGGAGGTGAAGGGGGCAGG - Intergenic
1148485976 17:47991307-47991329 GGGGTGAAGTGAAAGGGGGAGGG - Intergenic
1148535674 17:48436713-48436735 TGGAGGAAGTTGATGGGGGCAGG - Intergenic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148738769 17:49880372-49880394 AGGGAGAAGGTTAAGGGGCAAGG - Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149128309 17:53262906-53262928 TGGGAGAAATGGAAGAAGGAAGG + Intergenic
1149522037 17:57324720-57324742 TGGAAGAAAGTGAAGGAGGAGGG - Intronic
1149587320 17:57800655-57800677 TGGCAGAAGGTAAAGAGGGAGGG - Intergenic
1149696456 17:58620181-58620203 AGGCAGGAGATGAAGGGGGAGGG + Intronic
1149995903 17:61405795-61405817 TGGGAGAGGTGGAACGGGAAGGG - Exonic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150897874 17:69235155-69235177 TGGGATAACTTGGAGGGAGATGG - Intronic
1151117269 17:71751617-71751639 AGGAAGGAGTTGAAGGGAGAAGG - Intergenic
1151159276 17:72151058-72151080 CGGGAGAGGAGGAAGGGGGAGGG + Intergenic
1151408236 17:73903108-73903130 AGGGAGGAGTGGAAGGGGGCGGG + Intergenic
1151724274 17:75875542-75875564 TGGGAGGAAGTGAAGGGGGTAGG - Intronic
1151780532 17:76242044-76242066 TGGGAGAAGCTGCCGGGGCAGGG - Intergenic
1151879624 17:76887316-76887338 TGGGAGAATTTGCTGAGGGATGG - Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152609199 17:81307399-81307421 GGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1152803468 17:82343005-82343027 TGGGAGATGATCAAGGGTGAGGG + Intergenic
1152850290 17:82629952-82629974 TGGGAGGAGGTGAGGAGGGAAGG - Intronic
1152979928 18:267604-267626 GGGGAGCTGCTGAAGGGGGAGGG - Intronic
1153051219 18:905045-905067 CGGGAGGAGTTGAAGGGTAAGGG + Intronic
1154133600 18:11757484-11757506 TGGGAGAGCTTGCAGTGGGAGGG + Intronic
1155286483 18:24293864-24293886 GGGCAGAAGCTGTAGGGGGAAGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156060906 18:33075009-33075031 TGTGAGAAGGTGAAAGAGGATGG + Intronic
1156384831 18:36595447-36595469 GGGCAGGAGTTGAAGGGTGAAGG - Intronic
1156411716 18:36835160-36835182 AGGAAGGAGTTGATGGGGGAGGG + Intronic
1156651575 18:39232989-39233011 TGGGAGAGGTTGAGTGGGGTGGG - Intergenic
1157472295 18:47999188-47999210 TGTGTGAAGGTGAAGGGGCAAGG - Intergenic
1157487580 18:48099578-48099600 TGTGAGAGGTTGCAGGGAGAGGG + Intronic
1157672194 18:49540139-49540161 TGCTAGAAGTTGCAGGGGGTTGG + Intergenic
1157791527 18:50535851-50535873 TGGGAGGAGGGGATGGGGGAAGG + Intergenic
1158113820 18:53972410-53972432 TGGAAGGAGTTGATGGGGAAGGG - Intergenic
1158428417 18:57360773-57360795 AGGGAGTAGTTGCAGAGGGAAGG - Exonic
1158432117 18:57398696-57398718 AGGGAGTAGTTGAGGAGGGATGG + Intergenic
1158446368 18:57525872-57525894 TGTGAGCAGTTGAAGTGGGAAGG + Intergenic
1158617452 18:59001318-59001340 TGGGACAACTGGAAGGGGGTGGG + Intergenic
1158915331 18:62120203-62120225 TGGGGGAAGGGGAAGGGGAAGGG + Intronic
1158980489 18:62755984-62756006 TGGCACAAATTGAAGGGGGGGGG - Intronic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159370047 18:67517213-67517235 TGGGAGGAGCTGGAGTGGGAGGG + Intergenic
1159947939 18:74457634-74457656 TCAGAGAAGTTGGTGGGGGAGGG - Intronic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160226515 18:77016279-77016301 TCTGAGAAGTGGAAGGGGGGAGG - Exonic
1160643544 19:164143-164165 TGGCAGAAGATCAAGTGGGATGG + Intergenic
1160747450 19:718808-718830 TGGGAGCTGATGAAGGGTGAGGG + Intronic
1161055793 19:2190141-2190163 TGGGGGAGGTCCAAGGGGGAAGG - Intronic
1161112678 19:2478937-2478959 TGGGAGAAGTAGGAGGTGGCTGG - Intergenic
1161504333 19:4635934-4635956 TGGGAGAGGGGTAAGGGGGAGGG + Intergenic
1161933691 19:7357821-7357843 TGGGGGCAGTTGATGGGGAAGGG - Intronic
1162359572 19:10210440-10210462 TGGGAAGAGTTGAGGGAGGAAGG - Intronic
1162798286 19:13097833-13097855 TGAGAGATGTTGAATGGGGGCGG - Intronic
1163166962 19:15505245-15505267 GGGGTGAGGTTGAAGTGGGAGGG - Intergenic
1163232177 19:16012299-16012321 TGGGAGTGAATGAAGGGGGACGG + Intergenic
1163850223 19:19658678-19658700 TTGGTGAAGATGAAGGGAGAGGG + Intronic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164858549 19:31544341-31544363 TGGCAGAAGGTGGAGGGGGCAGG + Intergenic
1164949520 19:32325240-32325262 TGGGAAAGATTGAAGAGGGAGGG - Intergenic
1165194850 19:34093880-34093902 TGGCAGAAGGCAAAGGGGGATGG + Intergenic
1165353613 19:35290918-35290940 GGGGGGGAGTTGGAGGGGGAGGG - Intergenic
1165355588 19:35301945-35301967 TGGGATAGGATGATGGGGGAAGG - Intronic
1165369359 19:35394442-35394464 TTGGAGAAGGTGCAGGGGAAGGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166214187 19:41325135-41325157 CGGGAGAACTGGGAGGGGGATGG - Intronic
1166835314 19:45664140-45664162 TGGGAGAAGTTTAGGTTGGAAGG - Intergenic
1167058997 19:47131576-47131598 TCGGAGAGGCTGGAGGGGGACGG + Intronic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167747067 19:51358131-51358153 TGGGAGAAGAGGAAGAGGGCAGG - Intronic
1168314190 19:55476851-55476873 GCGGAGAAGTTGCAGGGGGTGGG + Intronic
1168434416 19:56305964-56305986 TGGGGGCAGGAGAAGGGGGAGGG + Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
926071109 2:9892478-9892500 TGGGTGAAGCTGAGGAGGGAGGG - Intronic
926389064 2:12368720-12368742 TTGGAGAGGTGGAAGGGGAAGGG + Intergenic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927064861 2:19461073-19461095 TGGGGGCAGTTGCAGGGGGAGGG - Intergenic
927139782 2:20121970-20121992 TGGGAGGAGTTGAAGTCAGAGGG - Intergenic
927504760 2:23605537-23605559 TGAGAGAAGATGAAGGGCAAGGG - Intronic
927559651 2:24060989-24061011 TGGGTGAAGGTGGAGGTGGAGGG - Intronic
929210326 2:39349740-39349762 TGGGAAAAGTTGAGAGGGGGAGG + Intronic
929768826 2:44874349-44874371 TGGCAGAAGTTGGGGGTGGATGG - Intergenic
929794171 2:45046330-45046352 AGGGAGAAGTTTCAGGAGGAGGG + Intergenic
929857671 2:45650601-45650623 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
930722193 2:54648359-54648381 GGGGAGAAGTTGGAGGGAGGGGG + Intronic
931415623 2:62077858-62077880 TGGGACAACTTGAAGTGGGGTGG + Intronic
931450410 2:62363471-62363493 TGAGGGGAGTTGGAGGGGGATGG - Intergenic
931473232 2:62561519-62561541 CCAGGGAAGTTGAAGGGGGAGGG - Intergenic
931493070 2:62770998-62771020 TATGGGAAGTTGAAGGGTGAAGG + Intronic
931940779 2:67249568-67249590 TGGGAGAAGTAGGAGGGAAATGG - Intergenic
932132437 2:69200100-69200122 TGGGAGCACGTGAAGTGGGATGG - Intronic
932836393 2:75042091-75042113 TGGGAGGAGCTGTAGGGAGATGG - Intergenic
933409118 2:81902860-81902882 TGGCAGGAGTTGGAGGGTGAAGG + Intergenic
933876488 2:86625233-86625255 GGGGAGGAGTTGGAAGGGGATGG + Intronic
934061545 2:88298711-88298733 GGGGAGAAGGTGAGGGGAGAGGG + Intergenic
934579906 2:95429701-95429723 AGGGAGAAGTAGATGGGAGAAGG - Intergenic
934599541 2:95647024-95647046 AGGGAGAAGTAGATGGGAGAAGG + Intergenic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
935986168 2:108675316-108675338 TGGGGGAAGAGGAGGGGGGAAGG + Intronic
936058527 2:109279615-109279637 TGGGAAAAGGTGAAGGGGTGGGG - Intronic
936138609 2:109918931-109918953 TGGGGGAAGAGGAGGGGGGAAGG + Intergenic
936206087 2:110452554-110452576 TGGGGGAAGAGGAGGGGGGAAGG - Intronic
936532880 2:113289032-113289054 AGGGAGAAGTAGATGGGAGAAGG + Intergenic
936954068 2:118006867-118006889 TGGAAGAAGTGGAAGGTAGATGG + Intronic
937113219 2:119383586-119383608 TGGCAGAAGTTCAAGAGGGCCGG - Intergenic
937675307 2:124583658-124583680 TGGGAGGTTTGGAAGGGGGAAGG + Intronic
938188872 2:129256387-129256409 TGTGAGAAGGTGAAGGAGTAAGG - Intergenic
939442738 2:142270930-142270952 TGGGAGAATTTGAAAGAGGGAGG - Intergenic
939617828 2:144380229-144380251 TGGGACATGTTGATTGGGGAAGG + Intergenic
940420734 2:153477573-153477595 TGGGAGAAGGGGTGGGGGGAGGG - Exonic
940588134 2:155683298-155683320 GGGGAGATGATGAAGAGGGATGG + Intergenic
940795899 2:158078627-158078649 TGGGAAGAGTAGCAGGGGGATGG + Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941179990 2:162247946-162247968 TAGGAGGAGTTGAAGATGGAAGG + Intergenic
941904819 2:170710632-170710654 AGGAAGAAGGTGAAGGGGAAAGG - Intergenic
942560482 2:177213189-177213211 TGGGAGGAGGTGGTGGGGGAGGG + Intronic
942661259 2:178267431-178267453 TGGGAGAAGTGAAGTGGGGAAGG - Intronic
942846772 2:180436056-180436078 TGGGACCAGTTGGAGGGTGAAGG - Intergenic
945854432 2:215051643-215051665 TGTGTGAAGGTGATGGGGGAAGG + Intronic
945975210 2:216265069-216265091 TGGGAAAAAGGGAAGGGGGATGG + Intronic
946390696 2:219415082-219415104 TGGGAGGAGGGGAAGGTGGAGGG + Intergenic
947119267 2:226799263-226799285 TGGGAGGAGGCGAAGGAGGAGGG - Exonic
947620959 2:231590757-231590779 TGGGAGAGGTGGAGGAGGGAGGG + Intergenic
947832701 2:233153012-233153034 TGGGAAAAGGTGAACGGGGTGGG + Intronic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947894579 2:233657402-233657424 TGGCAGAAGGTGAATGTGGAAGG + Intronic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948255866 2:236567763-236567785 TGGGGGACGTCGAAGGGCGAGGG + Intergenic
948294075 2:236847944-236847966 GGGGTGTAGTAGAAGGGGGAGGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
1169213290 20:3779170-3779192 TGGGAGAAGCTGGAGCGGGGTGG + Intronic
1169258441 20:4117551-4117573 TGGCAGAAGGGGAAGGGGGAGGG + Intergenic
1169452631 20:5725266-5725288 TGGGAAAAGATGAAGTGGGCTGG + Intergenic
1170311041 20:14991705-14991727 TGGGGGAAGATGAAAGGGTAAGG + Intronic
1170451583 20:16489249-16489271 TAGGCGAGGCTGAAGGGGGAGGG + Intronic
1170725290 20:18920689-18920711 TGGCAGATGGTGAAGGGGGCTGG - Intergenic
1171732693 20:28729922-28729944 TGGGAGGAGGGGGAGGGGGAGGG - Intergenic
1172580828 20:36046549-36046571 AGGGAGAAGAGGAAGGGTGAAGG - Intergenic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172871684 20:38139656-38139678 TGGCAGAGGTAGAAAGGGGAAGG + Intronic
1172950587 20:38721036-38721058 TGGGAGAATTTGGAGGTTGATGG + Intergenic
1173335977 20:42112698-42112720 AGGGAGAGTTTGCAGGGGGAAGG - Intronic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173911474 20:46674176-46674198 TGAGAGATGTTGACGGGGTATGG - Intronic
1174062711 20:47843945-47843967 AGGGGGAAGTGGAAGGGGAAGGG + Intergenic
1174718171 20:52782901-52782923 TGGGACAAGATGAAGAAGGATGG - Intergenic
1174744551 20:53048549-53048571 TGGTAGGTGTTGAAGGGAGAGGG - Intronic
1174794468 20:53510697-53510719 TAGGGGAAGCTGAAGGGTGAGGG - Intergenic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175496223 20:59416237-59416259 TGTTAGGAGTTCAAGGGGGAGGG - Intergenic
1175907971 20:62391146-62391168 TGGGAAATGTGGAAGAGGGAAGG - Intronic
1176173517 20:63707247-63707269 TGGGAGAAGTTACAGAGGGACGG - Intronic
1176520195 21:7818475-7818497 AGGGAGGAGTGGAAGGCGGAAGG + Exonic
1176531093 21:7958999-7959021 TGGGAGGAGGGGGAGGGGGAGGG - Intergenic
1177113964 21:17063323-17063345 TGGGAGAAGTTCCTAGGGGAAGG - Intergenic
1178294539 21:31398054-31398076 TGGGGGAGGTTGTAGGGGGGAGG - Intronic
1178417654 21:32416844-32416866 TGTGAGAAGTAGAAGGGACAGGG + Intronic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178654221 21:34448487-34448509 AGGGAGGAGTGGAAGGCGGAAGG + Intergenic
1178732830 21:35120547-35120569 TGGGTGCTGTTGGAGGGGGATGG + Intronic
1179130994 21:38636964-38636986 TGGGAGACTTTAAATGGGGATGG + Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179603374 21:42496149-42496171 TCGGAGGAGTTGGAGGAGGAGGG - Exonic
1179783032 21:43714739-43714761 TGAGACAACTTGAAGGGGGTTGG - Intergenic
1179947420 21:44687629-44687651 TGGGTGAAATTGACTGGGGAAGG + Intronic
1180095994 21:45555453-45555475 TGGGGGAGGTTGTGGGGGGAAGG + Intergenic
1180105952 21:45618176-45618198 TGGGAGAAGTTACAGAAGGAAGG - Intergenic
1181868936 22:25882678-25882700 TTGGGGAAGATGAAGTGGGAAGG - Intronic
1181976739 22:26736121-26736143 TGGGAGGAGGTGAGAGGGGATGG - Intergenic
1182501460 22:30751108-30751130 TGGGACAACTTGAAGTGGGCAGG - Intronic
1182723487 22:32423556-32423578 TGGGAGGAGTTGTAGGGTGTGGG + Intronic
1182915353 22:34024321-34024343 TGGGAGATGAGGAAGGGGGTAGG - Intergenic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183256600 22:36766347-36766369 CGAGAGAAGATGAAGGGGAAAGG + Intronic
1183259705 22:36786589-36786611 TGGGAGAAGTTGAAAGGGTCTGG - Intergenic
1183285078 22:36957100-36957122 TGGCAGAAGGTGAAGAGAGAAGG + Intergenic
1183360394 22:37380180-37380202 TGGGAGGGGTTGAGGGGGGTTGG + Intronic
1183590173 22:38775444-38775466 TGTGAGAAGGTGGAGGGTGAGGG - Intronic
1183738502 22:39657129-39657151 TGGGGGAAGTTGGAGGGGTCCGG - Intronic
1184244908 22:43231031-43231053 TGGGAGAAAGTGCAGGGGGTGGG - Intronic
1184553193 22:45216609-45216631 TGGGAAAGGGTGAAGGGAGAAGG - Intronic
1184729859 22:46366177-46366199 TGGGGGAAGGTGCAGGGGAAGGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
949375762 3:3388730-3388752 TGGGGTTAGTTGAAGGTGGAGGG - Intergenic
949392741 3:3580514-3580536 TGGGGGAAGTCGAAAGAGGAAGG + Intergenic
949604389 3:5637277-5637299 TGGGAGAATTAGAAGGAGGGAGG + Intergenic
949918577 3:8984176-8984198 AGGGAGTGGGTGAAGGGGGAGGG + Exonic
949999760 3:9647908-9647930 TGGGAGGAGTTGGGGGGGCAGGG + Intergenic
950362119 3:12456859-12456881 TGGGTGAAGCTGAAGGTGGACGG - Intergenic
950890724 3:16401500-16401522 TGGGAGGAGGTCAAGTGGGAGGG - Intronic
951138261 3:19129942-19129964 TGGGACAACTTGAAGGGGAGTGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952760332 3:36907919-36907941 TGTAAGAAGCTGAAGGGGCAAGG + Intronic
953116741 3:40000026-40000048 TGGGAGGAGGGGAGGGGGGAGGG + Intronic
953150147 3:40317198-40317220 CAGAAGAAATTGAAGGGGGACGG + Intergenic
953160479 3:40415082-40415104 TGTAAGAAATTGAAGGGGGTGGG + Intronic
953285474 3:41602383-41602405 AAGGAGAATTGGAAGGGGGAAGG + Intronic
953395091 3:42562708-42562730 TGGGAGAAGAGGAATGGAGATGG - Intronic
953440435 3:42911369-42911391 GGGGAGTAGTGGAAGGGGTATGG + Intronic
953478805 3:43230937-43230959 TGGGAGAGGTTGCAGGGGAAGGG + Intergenic
953861508 3:46547797-46547819 TGGGAGAAGTTGTAGTGGCTTGG + Intronic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954718512 3:52539443-52539465 TGGAAGATGTTGAAGGTGAAGGG + Intronic
955271589 3:57505245-57505267 TGGGAGAAGTGGGCGGGGGGTGG - Intronic
955719972 3:61870000-61870022 GAGGACAAGTCGAAGGGGGAGGG - Intronic
956339986 3:68211715-68211737 TGGCAGAAGGTGAAGGGAGCTGG + Intronic
956616713 3:71179460-71179482 TGGAAGAAGATGAAGAGGGGAGG + Intronic
957459115 3:80494517-80494539 TGGAAGAAGTTGGGGGTGGAGGG - Intergenic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957875028 3:86133437-86133459 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
958038177 3:88194266-88194288 TGGGACAACTTGAAGCGGGGAGG - Intergenic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958562372 3:95763422-95763444 TGGGACAAGTTGAAAAGGGAAGG + Intergenic
958636439 3:96752751-96752773 GGGGAGAAGTTAAGGAGGGAAGG + Intergenic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960270026 3:115663453-115663475 TGGGAGAAGAGGGAGGGAGAGGG - Intronic
960636093 3:119786348-119786370 TGGCACAATTTGAAGGGGGCTGG + Intronic
960734756 3:120766573-120766595 AAGGAGAAGATGAAGGGGTAAGG - Intronic
961031967 3:123614123-123614145 TGGAGGAAGGTGAAGGGGAAGGG - Exonic
961087923 3:124085050-124085072 TGGGGGAAGCTGAAGGTGGTGGG - Intronic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961302714 3:125932595-125932617 TGGGGGATGGTGGAGGGGGAGGG - Intronic
961792248 3:129384673-129384695 TTGGAGAAGGTGGAGGGGTAGGG - Intergenic
961806270 3:129491581-129491603 TGGAAGAAGGTGGAGGGGTAGGG - Intronic
961885351 3:130093193-130093215 TGGGGGATGGTGGAGGGGGAGGG + Intronic
962072167 3:132044611-132044633 AGGGAGGGGATGAAGGGGGAGGG + Intronic
962120125 3:132552542-132552564 TGGGACAACTTGAAGCGGGGAGG - Intergenic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962249806 3:133829029-133829051 TGGGGGAAGTGGACGGGTGAAGG - Intronic
962713447 3:138107001-138107023 TTGGAGAAGATGCAAGGGGAAGG + Intronic
962749189 3:138420737-138420759 TGGGACAACTTGAAGGGAGAAGG + Intergenic
962898588 3:139737402-139737424 AGGAAGATGTTGAGGGGGGATGG + Intergenic
962920225 3:139943762-139943784 TGGGAGAGGTTGGAGGTGGGTGG - Intronic
963173586 3:142275948-142275970 TGGGAGGCGAGGAAGGGGGAAGG + Intergenic
963852739 3:150224395-150224417 TGGGAGAACATGAATGGGAATGG + Intergenic
964793504 3:160474341-160474363 TGGGACAACTAGAAGGGTGATGG - Intronic
965409140 3:168307564-168307586 TTGGAGATGTTGGAGGGTGAGGG - Intergenic
965528361 3:169745716-169745738 TGGGAGAAGTTGAACATGGCTGG - Intergenic
965679181 3:171232862-171232884 AGGGAGGAGTTGAAGGAGTAGGG - Intronic
965969131 3:174532174-174532196 TGGGGGAAGGAGAAGGGGAAGGG + Intronic
965977037 3:174638559-174638581 TAGGAGATGTTGAAGAAGGAGGG + Intronic
966941470 3:184750603-184750625 TGGGAGAAGTGGAAGGCAGTTGG + Intergenic
966941925 3:184753242-184753264 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966941962 3:184753397-184753419 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966941966 3:184753410-184753432 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966941984 3:184753481-184753503 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966941988 3:184753494-184753516 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966941992 3:184753507-184753529 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966941996 3:184753520-184753542 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942061 3:184753789-184753811 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942065 3:184753802-184753824 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942069 3:184753815-184753837 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942093 3:184753915-184753937 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942097 3:184753928-184753950 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942101 3:184753941-184753963 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942105 3:184753954-184753976 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942123 3:184754025-184754047 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942127 3:184754038-184754060 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942131 3:184754051-184754073 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942148 3:184754122-184754144 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942152 3:184754135-184754157 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942156 3:184754148-184754170 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942181 3:184754251-184754273 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942184 3:184754264-184754286 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966942203 3:184754338-184754360 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942207 3:184754351-184754373 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942211 3:184754364-184754386 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942236 3:184754467-184754489 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966942239 3:184754480-184754502 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966942250 3:184754522-184754544 TGGGAGAAGGTGGTGGGAGAAGG + Intergenic
966985716 3:185178567-185178589 GGGGAGGACTGGAAGGGGGATGG + Intergenic
967429365 3:189363895-189363917 TGGGAGAGGTTGGGGGGGGGGGG - Intergenic
968208890 3:196830025-196830047 GGGGGGAAGTTAATGGGGGAAGG - Exonic
968339276 3:197941387-197941409 TGGGAGAGGAGGGAGGGGGAAGG - Intronic
968339285 3:197941407-197941429 TGGGAGAGGAGGGAGGGGGATGG - Intronic
968339294 3:197941427-197941449 TGGGAGAGGAGGGAGGGGGATGG - Intronic
968751476 4:2391637-2391659 TGGGGGAGGTGGAATGGGGAGGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969007728 4:4034826-4034848 TGGGATAACTTTAAGGGAGAAGG + Intergenic
969069515 4:4523931-4523953 TGGGAGGGGTTAAAGGGAGAGGG - Intronic
969727882 4:8934838-8934860 TGGGACAAGTTGAAGTGGGCAGG - Intergenic
969745883 4:9071236-9071258 TGGGATAACTTCAAGGGAGAAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970918059 4:21358863-21358885 TAGGACAACTTGAAGGGGAAGGG - Intronic
971156888 4:24092651-24092673 GGGTAGAAGTTGCAGGGAGAAGG - Intergenic
971211566 4:24622690-24622712 TGGGAGAAATTGCAGGCTGAAGG + Intergenic
971632923 4:29018177-29018199 TGGCAGAAGGTGAAGGGCCATGG - Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972322914 4:37989359-37989381 TGGGACAACTTGAAGGTGGAGGG - Intronic
972656306 4:41066868-41066890 TGGGTGGATTTGAAGGGGGCAGG + Intronic
972718797 4:41675434-41675456 GTGGGGAAGTTGACGGGGGATGG - Intronic
972749085 4:41970693-41970715 TGGGGGAGGCTGAAGTGGGAAGG + Intergenic
972782894 4:42301357-42301379 TGGGACAAGTTACAGGGGTAGGG + Intergenic
972896267 4:43624806-43624828 TGGGGGAAGGGGAAGGGGGTTGG - Intergenic
973806066 4:54527333-54527355 TGTGAAGAGTTGAAGGGGGTGGG - Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974592223 4:63967771-63967793 TGTGAGAAGTTGGAGGGTGGAGG + Intergenic
975171576 4:71237788-71237810 TGCGGGAAGTTGAGGGGGGCGGG - Intronic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975308571 4:72877349-72877371 TGGGAGAGGGGGAAGGGGGAGGG - Intergenic
975360231 4:73460962-73460984 TGGGAGAGGGGGGAGGGGGATGG - Intergenic
975731128 4:77338210-77338232 TGGGGGGAGGGGAAGGGGGAGGG - Intronic
976480238 4:85534550-85534572 TTGGAGAAGATGAAGTGGGGTGG + Intronic
976566371 4:86554669-86554691 TAGGAGAGATTGATGGGGGAGGG - Intronic
976753733 4:88477244-88477266 GGGGAGAGGAGGAAGGGGGAGGG + Intronic
977323716 4:95549283-95549305 TGGGGGGAGTTGGAGGAGGAGGG + Intergenic
977540803 4:98316526-98316548 TGGCAGGAGTTGAAGGGGAGAGG + Intronic
977625001 4:99180420-99180442 TGGGAAAACTTGGAGGGGCAAGG - Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979234138 4:118380587-118380609 ACAGAGAAGTTTAAGGGGGAAGG - Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980306548 4:131068085-131068107 TGGCAGAAGGTGAAGGTGAAGGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
982025387 4:151248669-151248691 TTGGAGAAGTGGAAGGCGCATGG + Intronic
982098342 4:151944096-151944118 TTGGAGAATTTGTTGGGGGAAGG + Intergenic
982261487 4:153498126-153498148 TGGGAGAAGATGTAGGAGGATGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983349464 4:166569688-166569710 TGGGAGAAGATGATGTGGGGAGG - Intergenic
983639994 4:169936259-169936281 TGGGAGCAGGTGCAGGTGGAAGG - Intergenic
984070387 4:175103526-175103548 AGGGAGGAGTGGGAGGGGGAGGG + Intergenic
984170378 4:176351350-176351372 TGGGACAACTTGAAGTGGGGAGG + Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985132302 4:186750857-186750879 TGGGAATAGGTGAAAGGGGAGGG + Intergenic
985511853 5:317948-317970 TGGGAGTAGGTGGAGGGTGAAGG - Intronic
985690117 5:1304258-1304280 GAGGAGAAGTGGAAGGGGAAGGG - Intergenic
986185575 5:5433347-5433369 TTTGAGAAGGTGAAGGGGAATGG - Intronic
986198187 5:5557299-5557321 TGGGAGAAGTGGTAGGGGGACGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986992487 5:13570313-13570335 TGGGTGAAATTGAAGTTGGAAGG + Intergenic
987266030 5:16255944-16255966 TGGCAGAAGATGAAGGGGATGGG - Intergenic
987566383 5:19593585-19593607 TGGGTGAAGTAGAAGGGGAGGGG - Intronic
987762609 5:22185115-22185137 TGCCAGAAGTAGAAGGGAGAAGG - Intronic
988641308 5:33043219-33043241 TGAGAGAGGTGGAAGGGGAAAGG + Intergenic
988987009 5:36630163-36630185 TGGGAGAAGGGGGAGGGGGCGGG + Intronic
989105707 5:37861424-37861446 AGGGAAAAGTTGGAGGGGGGAGG - Intergenic
990677636 5:58205632-58205654 TGGGAGATTTGGAAGGAGGAAGG - Intergenic
990705775 5:58527767-58527789 TGGGAAAAGTTGGAGGGAAAAGG + Intergenic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991897400 5:71418500-71418522 TGCCAGAAGTAGAAGGGAGAAGG - Intergenic
991939847 5:71839914-71839936 GAGGAGAAGTTCAAGGAGGATGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992292982 5:75299407-75299429 TGAGACAACTTGAAGTGGGAGGG - Intergenic
992453208 5:76891820-76891842 TGGGAGAGGGAGGAGGGGGAGGG + Intronic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993962285 5:94314087-94314109 TCAGAGAAGTTGAAGGTGGTAGG - Intronic
994606263 5:101971072-101971094 TGGAGGAAGTTGAAGTAGGAAGG - Intergenic
995778846 5:115754957-115754979 TGGGTGAATTTGAAGGGGCTGGG - Intergenic
995830571 5:116350465-116350487 TGGCAGATGTGGAAGGTGGAAGG + Intronic
995845503 5:116489471-116489493 TGAGAGAAGTTGAAGAGAGAGGG + Intronic
995958095 5:117804558-117804580 TGGGAGAAGTGACAGGGAGAAGG + Intergenic
996378694 5:122842492-122842514 TGAGAGAACATCAAGGGGGAAGG - Intergenic
996646390 5:125823399-125823421 TGGAAGGAGTTGAAGGATGATGG - Intergenic
996672997 5:126141116-126141138 TGGGGGAAGTTACAGGGAGAGGG - Intergenic
996992458 5:129651431-129651453 CAGGAGAAGTTAAAGGGGGCAGG - Intronic
997399691 5:133592781-133592803 TGGTAGAAGGTGAAAGGGAATGG - Intronic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998391280 5:141788517-141788539 TGGGAGAAGTAGGAGAGAGAAGG - Intergenic
1000083397 5:157868255-157868277 TGGGAGAAGATAAAGGGACATGG - Intergenic
1000357395 5:160413060-160413082 TGGGAGTAGTAGAAAGGGAATGG - Intronic
1001743314 5:174071096-174071118 GGGGAGAAGCTGCAGTGGGAGGG + Intronic
1002170444 5:177371507-177371529 TGGGGGACGCTGGAGGGGGATGG - Exonic
1002557461 5:180054448-180054470 TCGGAGAAGTTAGAGGGAGAGGG - Intronic
1002733379 5:181360648-181360670 TGGCAGAAGATCAAGTGGGATGG - Intergenic
1002751162 6:113470-113492 TGGCAGAAGATCAAGTGGGATGG + Intergenic
1003268251 6:4585457-4585479 TGGGAGAAGAAGAGGGGAGAAGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1003995836 6:11538269-11538291 TCGGGGAAGATGAAGGCGGAGGG + Exonic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1004880542 6:20003085-20003107 TGGGAGAAGTGGAGTGGGGCTGG - Intergenic
1005322587 6:24669299-24669321 CGGGACAACTTGAAGCGGGAAGG + Intronic
1005512754 6:26526098-26526120 AGGGAGAAGAGGAAGGGCGAAGG + Intergenic
1006146608 6:31963322-31963344 TGGGTAAAGTTGGAGGGGTAGGG + Intronic
1006527563 6:34620132-34620154 TGGGACTAGCTGAAGGGGGCAGG + Intronic
1006702263 6:35985137-35985159 TGGGACAAATTGAAGGGGTGGGG - Intronic
1007662449 6:43495189-43495211 TGGGAGAAGGTAAAGGGGTGAGG - Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007720088 6:43879601-43879623 AGGGAGAGGTGGAAGGGGGTCGG + Intergenic
1007829220 6:44625484-44625506 TGGGAAAAGGAGATGGGGGAAGG - Intergenic
1008294903 6:49763668-49763690 AAGGAGAAGTTGAAGGGGTAAGG - Intergenic
1008461898 6:51785155-51785177 TGGGAGGAGGTAAAGGAGGAAGG + Intronic
1008517316 6:52330350-52330372 TTGGAGAAAGTGAAGGGTGAGGG + Intergenic
1008781693 6:55114123-55114145 GGGGAAAAGTGGAAGGGTGAGGG + Intronic
1008828319 6:55726785-55726807 TGGCAGAAGGTGAAAGAGGAAGG + Intergenic
1010010435 6:71042034-71042056 CGGGACAACTTGAAGTGGGAAGG + Intergenic
1010053780 6:71539737-71539759 TGGGGAAGGTTGAAAGGGGATGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1011417427 6:87137290-87137312 GGGGAGGAGGGGAAGGGGGAAGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011685030 6:89817093-89817115 TGGGACAACTCGAAGGGTGAGGG - Intronic
1012462697 6:99481655-99481677 TGGGAGAGATTGAGGGAGGAAGG - Intronic
1012602843 6:101119293-101119315 TGGCAGAAGGTGAAGGGAGCAGG - Intergenic
1012660767 6:101887721-101887743 TGGGAGAGGGGGAAGGGGGAAGG + Intronic
1012677572 6:102136801-102136823 TAGGGGAAGGTGAAGGGGAAGGG + Intergenic
1015554105 6:134443196-134443218 AGAGAGAAGTTGAAGAGGGGTGG + Intergenic
1015866032 6:137727672-137727694 AGGGAGAAGTAGAAGGGGTTTGG + Intergenic
1015911467 6:138171541-138171563 TGGGGGAAGTTATAGTGGGAGGG - Intronic
1016163381 6:140908476-140908498 GGGGAGAAGTGGCAGGGGGCTGG + Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1017027425 6:150193608-150193630 TGGGAGAAGGGGAGGAGGGAGGG + Intronic
1017779780 6:157706846-157706868 TGGGACAACTTGAAGTGGGGAGG + Intronic
1018175159 6:161172229-161172251 TGCGAGAAGTGCAAGGAGGAAGG + Intronic
1018443979 6:163838113-163838135 TGGGAGGAGGTGAAAAGGGAGGG + Intergenic
1018850595 6:167587729-167587751 AGGGAGAGGTGGAGGGGGGAGGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019237629 6:170632970-170632992 TGGCAGAAGATCAAGTGGGATGG - Intergenic
1019502892 7:1374012-1374034 AGGAAGAGGGTGAAGGGGGAGGG + Intergenic
1019649830 7:2150803-2150825 TGGGGGACGTGGAAGGGAGAAGG - Intronic
1020318822 7:6925743-6925765 TGGGGGATGGTGGAGGGGGAGGG + Intergenic
1020328250 7:6992957-6992979 TGGGATAACTTTAAGGGAGAAGG + Intergenic
1020692210 7:11369485-11369507 TGGAAGAAGATGAAAGGGGGAGG + Intergenic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021540087 7:21748059-21748081 TGGGAGCAGTTCAAGGGTTAGGG + Intronic
1021620327 7:22544822-22544844 TGGGGTCAGTTGAATGGGGATGG - Intronic
1021783276 7:24127690-24127712 TGTGAGAAGGTGAAGGAGGGAGG - Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1021972696 7:25981176-25981198 TGGAAGAAGGAGAAGGGAGAGGG + Intergenic
1021978309 7:26030396-26030418 TGGGTCAACTTGAAGGGGTAGGG + Intergenic
1022533482 7:31081383-31081405 TGGGAGAAAATGAAAAGGGATGG - Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022764948 7:33401540-33401562 TGGGACAACTTGAAGGGGTGGGG + Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1022901235 7:34812436-34812458 TAGGAGATGCTGAAGTGGGATGG + Intronic
1023142354 7:37114015-37114037 TGGGTGGAGTTGAGGGAGGAAGG + Intronic
1023350472 7:39315646-39315668 TGGGAGAGTTTGAAGGAGAAAGG - Intronic
1024034579 7:45496377-45496399 TGGGAGAGGTGGTAGGGGCAGGG + Intergenic
1025231729 7:57207190-57207212 AGGGGGAAGTGGAAGGGGAAGGG - Intergenic
1026091602 7:67304945-67304967 TGCGAGAAGCTGAGGTGGGAGGG - Intergenic
1026346226 7:69476420-69476442 TGGGAGAAGCTCTAAGGGGAAGG + Intergenic
1026501759 7:70948684-70948706 TGGTGGAAGGTGAAGGGGGCCGG - Intergenic
1026564884 7:71481580-71481602 TGGGAGATGTGGAAGGTGCAGGG + Intronic
1027731217 7:81875817-81875839 TGGGAGAAGGTTATGGGGGTTGG - Intergenic
1027978296 7:85186138-85186160 TGGGAGAAGGGAAAGGGGCAAGG - Intronic
1028930159 7:96404198-96404220 TGGCAGAAAATGAAGGGGAAGGG - Intergenic
1028966467 7:96807204-96807226 GAGGAGAAAGTGAAGGGGGAAGG + Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029420635 7:100470002-100470024 GAGGAGAAGTTGAAGGGTGGAGG + Intronic
1029932196 7:104384164-104384186 TGGGAGAAGTGGAAGAGCTAGGG + Intronic
1029952414 7:104601202-104601224 TGCTGGAAGATGAAGGGGGAAGG + Intronic
1030224396 7:107132699-107132721 TGGGAAAACTTGAAGGAGGAAGG + Intronic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031554913 7:123162548-123162570 TGGGAGAAGTTGGATGGCAAAGG - Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031866090 7:127039904-127039926 AGGGGGAAGGTGAAGGGGAAGGG + Intronic
1032174956 7:129615277-129615299 TGTGAAAAATTGAAGGGTGAGGG + Intronic
1033018753 7:137699781-137699803 CAGGTGAAATTGAAGGGGGAAGG - Intronic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033208863 7:139445485-139445507 TGGAAGGAGATGAAGAGGGAAGG + Intergenic
1033481336 7:141743986-141744008 AGGGGTAAGTTGAAGAGGGAAGG + Exonic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033850310 7:145487280-145487302 TGGGACAATTTGAAGTTGGAAGG + Intergenic
1033899414 7:146116740-146116762 GGGGAGAAGAGGAAGCGGGAGGG + Exonic
1034128960 7:148698724-148698746 GGGGAGAAGCTGTTGGGGGAGGG - Intronic
1035157873 7:156928914-156928936 TGGGACAATTGGAAGGGGCAGGG + Intergenic
1035510139 8:173641-173663 TGGCAGAAGATCAAGTGGGATGG + Intergenic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036296827 8:7544061-7544083 TGGGACAACTTGAAGGAGGGGGG + Intergenic
1036325740 8:7776958-7776980 TGGGACAACTTGAAGGAGGGGGG - Intergenic
1036368375 8:8141158-8141180 TGGGATAACTTTAAGGGAGAAGG - Intergenic
1036398536 8:8387747-8387769 TGGGGGAAGCTGTAGAGGGATGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036882513 8:12524484-12524506 TGGGATAACTTTAAGGGAGAAGG + Intergenic
1037143248 8:15542168-15542190 TGGGACAACTCAAAGGGGGAGGG + Intronic
1037985262 8:23287088-23287110 TGGGAGAAGTGGCTTGGGGATGG - Intronic
1038241048 8:25808223-25808245 TGGGTGATATTGAAGGGGAAAGG - Intergenic
1039126425 8:34207053-34207075 TGGGGGGAGTGGAAGAGGGAGGG + Intergenic
1039912305 8:41834943-41834965 CGGGAGAAGCTGGAGGGGCAGGG + Intronic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1040913606 8:52545553-52545575 TAAGACAAGTTGAAGGGGGATGG - Intronic
1042225191 8:66509817-66509839 TGGGGGATGTTGATGGGGGGAGG - Intronic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042398713 8:68320888-68320910 TGGGAGATGAGGAAGGGTGAAGG - Intronic
1042748053 8:72128816-72128838 TGGGATATCTTCAAGGGGGATGG - Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1044114758 8:88321879-88321901 GGGGAGAAGTTGAAGGAAGTGGG - Intronic
1044609206 8:94075690-94075712 TGAGAGAAGGTGACGGGTGATGG - Intergenic
1044794847 8:95886196-95886218 TGTGAGTAGTTGAAAGAGGATGG - Intergenic
1044885933 8:96777408-96777430 AGGGAGAAATGGAAGGGGAAAGG + Intronic
1045064916 8:98436225-98436247 TGGGAGAAATGGAAGAGGGAGGG - Intronic
1045498409 8:102727263-102727285 TGGGAGAAGGTGAACAGGTACGG + Intergenic
1045709543 8:104966991-104967013 TGGGGAAAGTGGGAGGGGGAGGG - Intronic
1045824432 8:106380110-106380132 TGGGAGAAGGGGAAGGGGAATGG - Intronic
1046173510 8:110544521-110544543 TGGGAGAATTTAAGGGGGAATGG - Intergenic
1046526409 8:115387010-115387032 TGGGATAGGGTGAGGGGGGAGGG - Intergenic
1046905707 8:119570306-119570328 TGGGGGAGGTTGAAGGGGGGTGG + Intronic
1046962668 8:120126483-120126505 TGGCAGCAGCTGAAGGGGGTGGG + Intronic
1047225900 8:122955225-122955247 TGGGGGCAGTGGCAGGGGGAGGG + Intronic
1047452840 8:124981767-124981789 TGGCAGAAGGTCAAGGGTGAAGG + Intergenic
1048357835 8:133667855-133667877 TGGGAGAGGTAGAAGAGGAAAGG - Intergenic
1049231780 8:141488453-141488475 TGGGAGGAGGGGTAGGGGGAAGG - Intergenic
1049589096 8:143447687-143447709 TGGCAGAAGGTGAAGTGGGAGGG + Intronic
1050045849 9:1544530-1544552 TGGAAGAAGGTGAAGGGAAAAGG - Intergenic
1050380220 9:5020541-5020563 TGGGAGCAGTTGTAGGGAGTTGG + Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050801017 9:9614989-9615011 GGGGAGAAATTGCAGGAGGAAGG + Intronic
1050938469 9:11427622-11427644 TGTGAGAAGCTAAATGGGGATGG + Intergenic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1050993394 9:12181748-12181770 TGGCAGAAGTTGAAAGTGGAAGG + Intergenic
1051144070 9:14007790-14007812 TGGGGGAAGGTGGAAGGGGATGG - Intergenic
1051804877 9:20981283-20981305 TGTGGGAAAATGAAGGGGGAAGG + Intronic
1052389793 9:27866348-27866370 TGGGAGAAGTTGTCTGGGGAAGG + Intergenic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053413445 9:37930407-37930429 TGGGGGATGTGGCAGGGGGAGGG + Intronic
1054809255 9:69421910-69421932 TGCGGGAAGTGGAAGGCGGAAGG - Intergenic
1055790065 9:79914103-79914125 TGGGAGGAGTTGGAGAGTGAAGG + Intergenic
1056098543 9:83278561-83278583 TGGGAGAAGTTTGACGGGAAAGG + Intronic
1056851534 9:90088639-90088661 TGAGAGAAAATGAAGGCGGAGGG - Intergenic
1057325454 9:94059340-94059362 TGGCAGAACTTGAAAGTGGAGGG + Intronic
1057942404 9:99296602-99296624 TGGCGGAAGTGGAAGGGGGCGGG - Intergenic
1058349401 9:104003428-104003450 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1058885632 9:109320009-109320031 TCGGAGAAGAGGATGGGGGAGGG + Intronic
1059008948 9:110435550-110435572 TGGGAGAAGTAGCTGGGAGAGGG - Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1060163935 9:121392976-121392998 TGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1060807204 9:126585397-126585419 GAGCAGAACTTGAAGGGGGATGG + Intergenic
1060830241 9:126709201-126709223 TGGCAGAAGGTGAAGGAGCAAGG - Intergenic
1061482812 9:130905435-130905457 TGGGAGAAGCTGAGGGGCGTAGG + Intronic
1061761972 9:132857540-132857562 TGGGAAAGGATGAAAGGGGATGG - Intronic
1062143736 9:134976726-134976748 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1062272241 9:135714827-135714849 CGGGAAAAGTTGAAGGGCGCCGG - Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062757783 9:138312960-138312982 TGGCAGAAGATCAAGTGGGATGG - Intergenic
1186135924 X:6520771-6520793 TTGGAGAGATTGGAGGGGGAGGG + Intergenic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186836037 X:13439065-13439087 TGGGAGCACTTGGATGGGGAAGG + Intergenic
1186979476 X:14943953-14943975 TGAAAGAAGTTGAATGGGGGTGG - Intergenic
1187354349 X:18552927-18552949 AGGGAGAATTTTAAGGGGAATGG + Intronic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187830246 X:23374010-23374032 TGGGAGTAGAAGAAGTGGGAAGG + Intronic
1188513346 X:30959897-30959919 TGGTAGAAGGTGAAGGGGAAGGG + Intronic
1188755087 X:33952570-33952592 TTGGTGAAAATGAAGGGGGAGGG + Intergenic
1189182358 X:39016305-39016327 TGGGAAAAGGTGGTGGGGGAGGG + Intergenic
1189364992 X:40381193-40381215 TGGGAGAGGTGGAGGGAGGAGGG - Intergenic
1189648013 X:43155348-43155370 TGGGTGGAATTGAAGAGGGAGGG - Intergenic
1189686467 X:43569041-43569063 TGGGAGAAGTGAAAGAGAGATGG + Intergenic
1189748331 X:44193247-44193269 TGGGACAATTTGAAGGGGTCGGG - Intronic
1189818062 X:44844181-44844203 TGGGAGAAGCTGTAGATGGAGGG - Exonic
1190179243 X:48177537-48177559 GGGGAGGGGGTGAAGGGGGAGGG + Intergenic
1190241683 X:48661537-48661559 TGGGAAAAGATGAGGGGGAACGG - Intergenic
1190291404 X:48995183-48995205 TGGGAGGAGTTGGAGGAGGAAGG + Intronic
1191646390 X:63486102-63486124 TGAGAGAAGGGGGAGGGGGAGGG + Intergenic
1192029638 X:67495485-67495507 TGGCAGAAGGGGAAGGGGAAGGG - Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192193754 X:69015288-69015310 TGGGGCAGGTTGAAGGGAGAAGG - Intergenic
1192368604 X:70495529-70495551 TGGGTGAGGGTGAAGGGTGAGGG + Intronic
1192491469 X:71579740-71579762 TGGGAGCAGTTGAAGGTGGCTGG + Intronic
1193248075 X:79253781-79253803 AGGGAGAAGATCAAGGGTGAAGG + Intergenic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1194296638 X:92133998-92134020 TGGGACAACTTGAAGTGGGGAGG + Intronic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195049096 X:101080504-101080526 TGGGAGGAGGGGAAGGGAGAAGG - Intronic
1195273324 X:103254414-103254436 TAAGAGACGCTGAAGGGGGAGGG - Intronic
1196575606 X:117314812-117314834 TGGGACTACTTGAGGGGGGAGGG - Intergenic
1196729140 X:118923718-118923740 TGGGAAATGTAGTAGGGGGAAGG - Intergenic
1196833214 X:119792100-119792122 CCGGAGAAGTTGGAGGGGGTTGG + Intergenic
1196835347 X:119808611-119808633 TGGAAGAAATTGAAGAGGGTGGG + Intergenic
1196836229 X:119816509-119816531 TGGAAGAAATTGAAGAGGGTGGG + Intergenic
1196837206 X:119824389-119824411 TGGAAGAAATTGAAGAGGGTGGG + Intergenic
1196899815 X:120371644-120371666 TGGGTTAACTTGAAGGGAGAGGG + Intronic
1197270876 X:124423638-124423660 GGGTGGAAGTTGAGGGGGGAGGG + Intronic
1197762769 X:130039364-130039386 TGGGAGCTGTTCAAGGTGGAAGG - Intronic
1197886092 X:131219983-131220005 TGGGAGAAGGGGAATGGTGAGGG + Intergenic
1198074233 X:133179511-133179533 CGGTAGGAGTGGAAGGGGGACGG - Intergenic
1198368406 X:135967028-135967050 TGGAAGGAGTGAAAGGGGGAAGG + Intronic
1198487704 X:137104902-137104924 TGGAAGAAACTGAAGCGGGAAGG - Intergenic
1198526514 X:137506862-137506884 TTGGAGGAGTGGAAGAGGGAGGG - Intergenic
1198641372 X:138759666-138759688 TTGGAAAAGTGGAAGGGGTATGG + Intronic
1199284706 X:146042871-146042893 TGGGAGAAATGGGAGGGGAAGGG + Intergenic
1199452957 X:147993906-147993928 TGGGAGAATCTGGAGGAGGAGGG - Intronic
1199827630 X:151515832-151515854 TGGGGGAAGAGGATGGGGGAGGG - Intergenic
1199880761 X:151972991-151973013 TGTGAGAAGTGGGGGGGGGAGGG + Intronic
1200048270 X:153414064-153414086 TTGGACAAGTTGAAAGGGGGAGG - Intergenic
1200154966 X:153970443-153970465 GGGGAGAAGGGGGAGGGGGACGG + Intronic
1200285855 X:154821551-154821573 TGGGACAACTTGAAGTGGGGAGG + Intergenic
1200614152 Y:5358568-5358590 TGGGACAACTTGAAGTGGGGAGG + Intronic
1200847427 Y:7845315-7845337 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
1201380492 Y:13371801-13371823 ATGGAGAAGTTGTAGGGGTATGG + Intronic
1201972449 Y:19812447-19812469 TGGGAAAATTTGAATGGAGAGGG - Intergenic