ID: 1143111945

View in Genome Browser
Species Human (GRCh38)
Location 17:4557965-4557987
Sequence CAGAGTTATCTGAAGCATGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143111945_1143111961 23 Left 1143111945 17:4557965-4557987 CCCCCATGCTTCAGATAACTCTG 0: 1
1: 0
2: 1
3: 20
4: 341
Right 1143111961 17:4558011-4558033 CCTGTTAGAACCCCTGGAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1143111945_1143111962 30 Left 1143111945 17:4557965-4557987 CCCCCATGCTTCAGATAACTCTG 0: 1
1: 0
2: 1
3: 20
4: 341
Right 1143111962 17:4558018-4558040 GAACCCCTGGAAGGGGCAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 312
1143111945_1143111955 17 Left 1143111945 17:4557965-4557987 CCCCCATGCTTCAGATAACTCTG 0: 1
1: 0
2: 1
3: 20
4: 341
Right 1143111955 17:4558005-4558027 CCCCATCCTGTTAGAACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 114
1143111945_1143111958 21 Left 1143111945 17:4557965-4557987 CCCCCATGCTTCAGATAACTCTG 0: 1
1: 0
2: 1
3: 20
4: 341
Right 1143111958 17:4558009-4558031 ATCCTGTTAGAACCCCTGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 66
1143111945_1143111959 22 Left 1143111945 17:4557965-4557987 CCCCCATGCTTCAGATAACTCTG 0: 1
1: 0
2: 1
3: 20
4: 341
Right 1143111959 17:4558010-4558032 TCCTGTTAGAACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143111945 Original CRISPR CAGAGTTATCTGAAGCATGG GGG (reversed) Exonic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
904295111 1:29515255-29515277 CAGAGTTCTGTGAAAGATGGGGG + Intergenic
905278131 1:36832428-36832450 CAGTGTTTTCTTAAGCTTGGAGG - Intronic
905562789 1:38940768-38940790 CTGAGTTAACTGAGGCACGGCGG - Intronic
905854448 1:41298965-41298987 GAGAGTTAGCTGAAGCCTGAAGG - Intergenic
906751793 1:48269593-48269615 AACACTTATCTGAAGAATGGAGG + Intergenic
907300427 1:53483391-53483413 CTGCGTTCTTTGAAGCATGGGGG + Intergenic
907680410 1:56557977-56557999 CAGAGTTCTCAAAAGCAAGGGGG - Intronic
907789754 1:57650799-57650821 CAGTGTTATCTTCAGAATGGAGG - Intronic
911037668 1:93567638-93567660 CTGAGTTATCTGCAGCACTGTGG - Intronic
911351330 1:96760049-96760071 GGGAGTTAACTGAATCATGGGGG - Intronic
912273515 1:108233151-108233173 CAGAGTTACCTGGGGCATGGTGG + Exonic
912294705 1:108461171-108461193 CAGAGTTACCTGGGGCATGGTGG - Exonic
912327683 1:108784475-108784497 TAGAGATAACTGAATCATGGGGG - Intronic
912400155 1:109384171-109384193 CTGAGGCATCTGAATCATGGAGG - Intronic
912690566 1:111801654-111801676 CAGAGTGCTCTGAAGAGTGGGGG - Intronic
915306607 1:154983415-154983437 CTCAGTAATCTGAAGCTTGGTGG + Exonic
916811525 1:168309618-168309640 CAGAGTTAAGTGTAGCATGGGGG + Intronic
917723949 1:177812272-177812294 CAGAGCTACATGATGCATGGAGG - Intergenic
918054810 1:181011471-181011493 CAGAATTTTCTAAAGCATGTGGG + Intronic
920844847 1:209585106-209585128 CAGAGCAATCTGCAGCATCGTGG - Intronic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921470735 1:215545320-215545342 CAGAATTCACTGAACCATGGTGG + Intergenic
921511172 1:216032681-216032703 CAGAGAGATTTGAAGCATGAGGG + Intronic
921599919 1:217095739-217095761 AAGAGATTTATGAAGCATGGTGG + Intronic
921649304 1:217658040-217658062 CAGAGATAATTGAATCATGGGGG - Intronic
922179542 1:223223312-223223334 CAGGGTTGTCCGAAGCAGGGTGG + Exonic
922772529 1:228194573-228194595 TAGAGTTATCTCAAGGATGCAGG - Intergenic
923511541 1:234657850-234657872 CAGGGTGATCTGAGACATGGTGG + Intergenic
923617936 1:235553145-235553167 CAGGCTTATCTGAAGCCTGCTGG + Intronic
924425811 1:243949290-243949312 CAAAGTTATGTGAAGCAGAGAGG - Intergenic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
1063550666 10:7029746-7029768 AAGAGGTAACTGAATCATGGTGG + Intergenic
1063604454 10:7509854-7509876 TAGAGATAACTGAATCATGGGGG + Intergenic
1063858744 10:10285295-10285317 GAGAGTTATTTGGATCATGGGGG + Intergenic
1064862917 10:19847040-19847062 GGGAGGTAACTGAAGCATGGGGG - Intronic
1065076767 10:22088184-22088206 CAGAATTTTCAGAAGAATGGTGG - Intergenic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1068470046 10:57448782-57448804 GAGGGTGACCTGAAGCATGGTGG - Intergenic
1069227229 10:65959357-65959379 GAGTGTTAGCTGAAGCAGGGAGG - Intronic
1071050024 10:81436139-81436161 GAGAGATAGCTGAATCATGGGGG - Intergenic
1071503974 10:86222000-86222022 CAGAGCCAGCTAAAGCATGGGGG + Intronic
1073794248 10:106970714-106970736 AAGAGTTGTCAGAAGCATTGCGG - Intronic
1073946442 10:108756047-108756069 CAGAGCTGTCTGAAAGATGGTGG + Intergenic
1074394323 10:113084956-113084978 CAGAGTTTTCTGAGGCAAAGAGG + Intronic
1075001588 10:118802637-118802659 CAGACATGTCTGGAGCATGGTGG + Intergenic
1077193255 11:1264972-1264994 CAGAGGTAATTGAATCATGGGGG - Intergenic
1077193587 11:1267212-1267234 CAGAGGTAATTGAATCATGGGGG - Intergenic
1079018800 11:16892228-16892250 AAGAGATATCTGAAACATGTGGG + Intronic
1079034666 11:17011782-17011804 TAGTGTGATCTGAAGCTTGGTGG - Intronic
1081222419 11:40477894-40477916 GAGAGATAACTGAATCATGGGGG + Intronic
1081305565 11:41508002-41508024 GAGAGTTAATTGAATCATGGGGG + Intergenic
1081376066 11:42359987-42360009 TAGAGTTAACTGAATCATGGGGG - Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1083043237 11:59708424-59708446 AAAAATTATCTGGAGCATGGTGG - Intergenic
1083229542 11:61307428-61307450 AAAAGTTATCTGAAGCAGGAGGG - Intronic
1085004021 11:73068087-73068109 GGGAGTTAACTGAATCATGGGGG - Intronic
1086788894 11:91009417-91009439 TAGAGATATCTGAATCATGGGGG + Intergenic
1087083870 11:94197296-94197318 CAGAGATAATTGAATCATGGGGG + Intergenic
1087474463 11:98619213-98619235 CAGAGGTGACTGGAGCATGGGGG - Intergenic
1087511470 11:99101205-99101227 GAGAGATAACTGAATCATGGGGG - Intronic
1087526296 11:99317952-99317974 CAGATTTGTCTGAAATATGGAGG - Intronic
1087570582 11:99922278-99922300 GAGAGGTAACTGAATCATGGGGG - Intronic
1089147642 11:116341559-116341581 CAGAGATAGTTGAATCATGGGGG + Intergenic
1089152124 11:116372299-116372321 TAGAGATAACTGAATCATGGGGG + Intergenic
1089405356 11:118192989-118193011 CAGAGGTCTCAGAATCATGGCGG - Intergenic
1093942958 12:25074668-25074690 CAGAATTATCAGCAGCATGAAGG + Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1095594170 12:43940015-43940037 GAGAGGTAACTGAATCATGGAGG - Intronic
1096530694 12:52241101-52241123 CAGAGTATTCTGTAGCATGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096947516 12:55423330-55423352 CGGAGGTAACTGAATCATGGGGG + Intergenic
1098833150 12:75388089-75388111 GAGAGGTAACTGAATCATGGGGG + Intronic
1100077660 12:90805438-90805460 GAGAGTTATAGGAAGCATGTGGG + Intergenic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1103260313 12:119582512-119582534 GGGAGTTAACTGAATCATGGGGG + Intergenic
1104180174 12:126372211-126372233 CAAAGATAACTGAATCATGGGGG - Intergenic
1105693989 13:22870527-22870549 GGGAGGTATCTGAATCATGGGGG + Intergenic
1106508256 13:30390543-30390565 CAAAGTTATCTGAAGAATTTGGG + Intergenic
1106978679 13:35252313-35252335 CAGAGCTGACTGAATCATGGGGG - Intronic
1110190011 13:72719365-72719387 CAGAATTATCCTAAGTATGGTGG - Intronic
1111234454 13:85390420-85390442 CAGAGGTGACTGAATCATGGGGG + Intergenic
1111615177 13:90653144-90653166 GAGAGGTAACTGAATCATGGGGG + Intergenic
1112295068 13:98179314-98179336 CAGAGATAACTGAATCATGGGGG - Intronic
1112582936 13:100691919-100691941 CAGAGATAAATGAATCATGGGGG + Intergenic
1112622992 13:101071077-101071099 CAGAGATAATTGAATCATGGGGG - Intronic
1112626164 13:101106604-101106626 CAGAGATAATTGAATCATGGGGG + Intronic
1113043620 13:106130629-106130651 TAGAGGTAACTGAATCATGGGGG - Intergenic
1113422088 13:110178862-110178884 CATGCTTTTCTGAAGCATGGGGG - Intronic
1113741125 13:112713093-112713115 CAGAGTATTCTAAAACATGGAGG + Intronic
1114083199 14:19219250-19219272 GAGAGGTAACTGAATCATGGCGG - Intergenic
1115919506 14:38356321-38356343 GAGAAGTAACTGAAGCATGGGGG + Intergenic
1116267504 14:42712599-42712621 GAGAGATAACTGAATCATGGGGG - Intergenic
1116641655 14:47470973-47470995 AAGTGTTATCTGAAGGTTGGTGG + Intronic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117085350 14:52195275-52195297 GAGAGGTAACTGAATCATGGTGG + Intergenic
1117141835 14:52797160-52797182 GAGAGGTAACTGAATCATGGAGG - Intergenic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1118173354 14:63411543-63411565 GAGAGGTATCTGGATCATGGAGG + Intronic
1118920753 14:70147745-70147767 CTGTCTTATCTGAAGCATGGGGG - Intronic
1121063578 14:90939721-90939743 GGGAGTTAACTGAATCATGGGGG - Intronic
1121372627 14:93374314-93374336 TAGAGTTACCTGAGGCATTGGGG + Intronic
1121451083 14:94008779-94008801 CGGAGCACTCTGAAGCATGGGGG - Intergenic
1122761600 14:104032895-104032917 CAGAGAAATCTGAGGCCTGGCGG + Intronic
1202831557 14_GL000009v2_random:40150-40172 AACACTTATCTGAGGCATGGTGG + Intergenic
1202894822 14_GL000194v1_random:1020-1042 GAGAGGTAACTGAATCATGGCGG - Intergenic
1127393266 15:58523513-58523535 CAGAGTTCTCTGGGGCATGAAGG + Intronic
1127443542 15:59036577-59036599 CAGAGATAACTGAATCATGGGGG - Intronic
1128081337 15:64858857-64858879 GAGAGTTATGTGATGGATGGTGG - Intronic
1128688982 15:69708893-69708915 CAGAGGTACTTGAATCATGGAGG - Intergenic
1128889405 15:71317540-71317562 GAAAGTTACCTGAATCATGGGGG - Intronic
1129002861 15:72348291-72348313 CAAAGTTATGTGAAGCAGGTGGG + Intronic
1130075348 15:80684169-80684191 GAGAGATAACTGAATCATGGGGG + Intronic
1131427506 15:92358541-92358563 CAGAGATAATTGAATCATGGTGG - Intergenic
1131712117 15:95067466-95067488 GAGAGGTAACTGAATCATGGGGG - Intergenic
1131789846 15:95952392-95952414 GAGAGTTAATTGAATCATGGAGG - Intergenic
1132082422 15:98878290-98878312 CAGAGTTATGTGAGGTATTGTGG - Intronic
1132084680 15:98898108-98898130 CAGAGTTATCTCCATCACGGAGG - Intronic
1134332167 16:13261059-13261081 CAGAGGTAATTGAATCATGGGGG - Intergenic
1135881531 16:26262457-26262479 GGGAGGTAACTGAAGCATGGAGG + Intergenic
1136024930 16:27463128-27463150 CAGAGTTACAGGAAGCAAGGGGG - Intronic
1136674648 16:31892322-31892344 CGGAGGTAACTGAATCATGGGGG - Intronic
1138725934 16:59139267-59139289 CAGAGTTATCTGCCCCATTGAGG - Intergenic
1138859843 16:60743455-60743477 GAGAGGTAACTGAATCATGGGGG - Intergenic
1140178053 16:72684763-72684785 CAGAACTATCTGAAGAATAGAGG + Intergenic
1141890942 16:86926100-86926122 CACAGTTCTCAGAAGCAGGGTGG + Intergenic
1143111945 17:4557965-4557987 CAGAGTTATCTGAAGCATGGGGG - Exonic
1144353494 17:14422280-14422302 CAGAGATATCTGAAGGATTCTGG - Intergenic
1144436987 17:15251098-15251120 CTGAGTTAGCTGAAGAAAGGAGG - Intronic
1145753793 17:27374887-27374909 CAGAGGTACCTGAATCATGGCGG + Intergenic
1147574915 17:41593462-41593484 CACAGTTTTCTGAGGCTTGGCGG - Intergenic
1149397506 17:56260077-56260099 TAGATTTATCTAAACCATGGTGG + Intronic
1149853969 17:60062820-60062842 GAGAGGTAACTGAATCATGGGGG + Intronic
1150175400 17:63049548-63049570 CTGACTTTTCTGAAGCATGCTGG - Intronic
1150576933 17:66438858-66438880 CAGAGATAATTGAATCATGGGGG - Intronic
1151222513 17:72623462-72623484 AAGATGTATCTGAAGCGTGGTGG + Intergenic
1151410078 17:73919129-73919151 GAGAGGTAACTGAATCATGGGGG + Intergenic
1151539670 17:74758645-74758667 CAGAGGGGTCCGAAGCATGGTGG - Intronic
1153166093 18:2263488-2263510 CAGGGTTAACTGACGCACGGGGG - Intergenic
1153684417 18:7530951-7530973 CAGAGACAACTGAAACATGGAGG - Intergenic
1155803344 18:30136405-30136427 CATAATTATCTGAAGCTTGATGG + Intergenic
1157454270 18:47812158-47812180 GAGAGGTAACTGAATCATGGGGG + Exonic
1157934826 18:51861321-51861343 CAGAGGGATTTGAAGCATGATGG - Intergenic
1158321248 18:56267131-56267153 CAGAGTTTGTTAAAGCATGGTGG - Intergenic
1158854754 18:61531717-61531739 TAGAGATAACTGAATCATGGGGG + Intronic
1159765087 18:72479770-72479792 GAGAGATAACTGAATCATGGGGG + Intergenic
1159850423 18:73520667-73520689 CATAGATAACTGAATCATGGGGG + Intergenic
1162926964 19:13935676-13935698 CAGATGTATCTGAGGCCTGGGGG + Intronic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1165174484 19:33917584-33917606 CAGAGATAATTGAATCATGGGGG + Intergenic
1165221417 19:34319753-34319775 CAGATCCTTCTGAAGCATGGTGG + Intronic
1166573684 19:43816781-43816803 GAGAGATAACTGAATCATGGGGG + Intronic
1202641145 1_KI270706v1_random:87605-87627 AACACTTATCTGAGGCATGGTGG - Intergenic
925416478 2:3673308-3673330 CAGAGAGATCTGGAGCAAGGGGG + Intronic
925730130 2:6914002-6914024 GAGAGGTAACTGAATCATGGGGG - Intergenic
926588410 2:14714459-14714481 CAGAGATAAATGAGGCATGGAGG + Intergenic
926638783 2:15212658-15212680 GGGAGGTAACTGAAGCATGGGGG + Intronic
930335151 2:50036167-50036189 CGGAGGTAACTGAATCATGGGGG + Intronic
930954069 2:57182794-57182816 CAGAGTTATTTTAAGAATGCAGG - Intergenic
932711717 2:74070409-74070431 GAGAGATAACTGAATCATGGAGG - Intronic
933423834 2:82085831-82085853 CAGAGACAACTGAATCATGGGGG - Intergenic
934774456 2:96928241-96928263 CAGAGTGTTTTGAAGCCTGGAGG - Intronic
937142286 2:119612517-119612539 TAGAGATAACTGAATCATGGGGG - Intronic
938202607 2:129387508-129387530 CACAGTGATGTGAATCATGGAGG - Intergenic
938493382 2:131777383-131777405 GAGAGGTAACTGAATCATGGCGG + Intergenic
938499106 2:131821284-131821306 GAGAGGTAACTGAATCATGGCGG - Intergenic
938997647 2:136697643-136697665 AAGTATTATCTGAAGCATTGGGG + Intergenic
939034260 2:137112033-137112055 CTGAGTTTTCTGGAGCCTGGAGG + Intronic
939176784 2:138758337-138758359 CAGAATTTTCTCAAGAATGGAGG - Intronic
939475462 2:142680941-142680963 CAAAGTTATGAGAAGCATTGAGG + Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
940309937 2:152267837-152267859 AAGAGATAACTGAATCATGGGGG + Intergenic
940827823 2:158433650-158433672 AAGTGTGAGCTGAAGCATGGTGG + Intronic
941071997 2:160966001-160966023 GATAGTTTTATGAAGCATGGTGG + Intergenic
942279448 2:174345065-174345087 CAGAGGTTTCTGCAGCATAGTGG - Intergenic
942309739 2:174644602-174644624 CAGAGGTATCTGTAGAAGGGAGG + Intronic
942614574 2:177776898-177776920 GGGAGGTAACTGAAGCATGGGGG + Intronic
943622620 2:190167313-190167335 GAGAGGTAACTGAAACATGGGGG - Intronic
944761399 2:202818584-202818606 GAGAGATAACTGAATCATGGGGG + Intronic
945207147 2:207344304-207344326 CAGAGGGAGCTGAAGCAGGGTGG + Intergenic
946256832 2:218448470-218448492 CAGAGTTATTTGAATCTGGGAGG + Intronic
946985641 2:225269718-225269740 TAGAGGTAATTGAAGCATGGGGG - Intergenic
1170364800 20:15587286-15587308 CAGAGGTAATTGAATCATGGGGG - Intronic
1170508453 20:17053188-17053210 CGGAGATAACTGAATCATGGGGG - Intergenic
1170750218 20:19138749-19138771 CAGAGATAATTGAAACATGGAGG - Intergenic
1170760378 20:19243873-19243895 CATAGTCATCTGAATCAAGGTGG - Intronic
1171164732 20:22959687-22959709 CAGAGGTAGCTGAATCATGGGGG + Intergenic
1171306394 20:24110348-24110370 ATGAGTTAGCTGAGGCATGGGGG + Intergenic
1173072918 20:39786725-39786747 GAGAGATAACTGAATCATGGGGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1176610745 21:8884982-8885004 AACACTTATCTGAGGCATGGTGG + Intergenic
1176614521 21:9017007-9017029 GAGAGGTAACTGAATCATGGCGG - Intergenic
1176710683 21:10146867-10146889 GAGAGGTAACTGAATCATGGCGG + Intergenic
1177018067 21:15816113-15816135 CGGAGGTAACTGAATCATGGTGG + Intronic
1177742296 21:25168640-25168662 GAGAGATAACTGAATCATGGGGG + Intergenic
1177959274 21:27641881-27641903 CAAAATTAGCTGAGGCATGGTGG - Intergenic
1177991565 21:28041233-28041255 TAGAGGTAACTGTAGCATGGAGG + Intergenic
1178117656 21:29434177-29434199 CAGAGTTAATTGAATCATAGGGG + Intronic
1178470442 21:32887544-32887566 AAGAGGTATCTGAGGCATGCAGG - Intergenic
1180294774 22:10874017-10874039 GAGAGGTAACTGAATCATGGCGG + Intergenic
1180360818 22:11894267-11894289 AACACTTATCTGAGGCATGGTGG + Intergenic
1180497580 22:15903431-15903453 GAGAGGTAACTGAATCATGGCGG + Intergenic
1182834657 22:33332209-33332231 GGGAGTTAACTGAATCATGGGGG + Intronic
1182913790 22:34009539-34009561 CAGAGGCCTCTGAACCATGGAGG - Intergenic
951263080 3:20534855-20534877 TAGATATATCTGAAGCATGAAGG - Intergenic
952548224 3:34446118-34446140 GGGAGATAACTGAAGCATGGGGG + Intergenic
953298681 3:41749826-41749848 CAAAGATGTCTGAAGCATGAGGG + Intronic
957991499 3:87633101-87633123 CAGAGTTATTTGAACCAAGTAGG - Intergenic
958151852 3:89702083-89702105 CAGAGATAATTGAATCATGGGGG - Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959486793 3:106936079-106936101 CAGAGTGTTCTCAAGTATGGAGG - Intergenic
959894249 3:111588721-111588743 GAGAGGTAACTGAATCATGGGGG - Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
961705996 3:128785657-128785679 CAGAGTTGCCTGAACCCTGGAGG + Intronic
962082413 3:132154594-132154616 TAGAGTTTTCAGAAGCATGCTGG + Intronic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
964275243 3:155002818-155002840 TAGAGTTAATTGAATCATGGGGG + Intergenic
964796120 3:160498726-160498748 CAGTCTTATCTGAAGCTAGGGGG - Exonic
964836298 3:160941452-160941474 CAGAGGTAATTGAATCATGGGGG + Intronic
965300010 3:166997245-166997267 GAGAGGTAACTGAATCATGGGGG - Intergenic
965305424 3:167058510-167058532 TAGAGATAACTGAATCATGGTGG - Intergenic
1202737426 3_GL000221v1_random:19786-19808 AACACTTATCTGAGGCATGGTGG + Intergenic
970099232 4:12502310-12502332 CAGGGGTAACTGAACCATGGGGG - Intergenic
970250803 4:14113959-14113981 CAGAGATATCTGAAGAAATGTGG - Intergenic
971430783 4:26565059-26565081 GAGAGGTAACTGAATCATGGGGG + Intergenic
971977022 4:33703383-33703405 CAGAGGCAACTGAATCATGGGGG + Intergenic
973384655 4:49498136-49498158 AACACTTATCTGAGGCATGGTGG - Intergenic
973542042 4:51944585-51944607 GAGAATTACCTGGAGCATGGGGG + Intergenic
975176070 4:71290429-71290451 CAGTGCTAACTGAAGCATAGAGG + Intronic
975449274 4:74505471-74505493 AAGAGTGAGCTGAAGCAGGGTGG + Intergenic
975804176 4:78095762-78095784 CAGAGATAACTGAATCATGGGGG - Intronic
976581475 4:86741472-86741494 GAGAGGTAACTGAATCATGGGGG - Intronic
976979344 4:91207078-91207100 CAACGTTATGTAAAGCATGGTGG + Intronic
977303948 4:95299782-95299804 GGGAGTTAACTGAATCATGGGGG - Intronic
978028889 4:103913768-103913790 TAGAGTATTTTGAAGCATGGTGG - Intergenic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
980442674 4:132868445-132868467 GGGAGTTAACTGAATCATGGGGG + Intergenic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980953359 4:139403891-139403913 CAGAGAACTCTGAATCATGGCGG + Intronic
981945597 4:150339953-150339975 CGGAGGTAACTGAATCATGGTGG + Intronic
982477104 4:155867488-155867510 GAGAGTTAATTGAATCATGGAGG - Intronic
982886321 4:160787601-160787623 GAGAGGTAACTGAATCATGGGGG + Intergenic
982896482 4:160934374-160934396 CTCAGTTATCTGAAGCAAGCAGG + Intergenic
983286079 4:165741098-165741120 CAGAATTATCTGTATCATGTTGG + Intergenic
983297916 4:165890169-165890191 GAGAGTTAATTGAATCATGGGGG - Intronic
983463049 4:168049805-168049827 GAGAGGTAACTGAATCATGGGGG + Intergenic
983760541 4:171400880-171400902 TAGACTGATCTGAAGCATTGAGG - Intergenic
983864811 4:172753108-172753130 TAGAGATAACTGAATCATGGGGG + Intronic
984275384 4:177603453-177603475 CAGAGATAATTGAATCATGGGGG - Intergenic
984410069 4:179386542-179386564 GGGAGATATCTGAATCATGGGGG - Intergenic
1202768506 4_GL000008v2_random:173455-173477 AACACTTATCTGAGGCATGGTGG - Intergenic
985949028 5:3209208-3209230 GAGAGGTAACTGAATCATGGGGG - Intergenic
987024579 5:13911274-13911296 CAGAGGTATCTTCATCATGGAGG - Intronic
987150017 5:15028959-15028981 TAGAGGTAACTGAATCATGGAGG - Intergenic
987496685 5:18653670-18653692 CAGATTTCTCTGCAGCATGAGGG + Intergenic
988097536 5:26636658-26636680 GAGAGTCATTTGAACCATGGAGG + Intergenic
988199150 5:28048156-28048178 GAGAGTTACCCGAAGCTTGGCGG - Intergenic
988699181 5:33656141-33656163 CAGAACTATCTGATGCATTGTGG - Intronic
990353616 5:54942784-54942806 GATAGCTATCTGAAGCATGTGGG - Intergenic
991639497 5:68738785-68738807 CAGAGTGTGTTGAAGCATGGAGG - Intergenic
993033753 5:82734128-82734150 CAGAGCTGTCTGAAGAATGTAGG - Intergenic
993307059 5:86286935-86286957 CAGAGTTACCTGGGGCATGGTGG - Intergenic
994853316 5:105085029-105085051 GGGAGTTAACTGAATCATGGGGG + Intergenic
995366759 5:111370448-111370470 CAGAAATATCTGAAAAATGGCGG + Intronic
995508950 5:112888909-112888931 GAGAGATAACTGAATCATGGGGG + Intronic
997184051 5:131863755-131863777 GAGAGATAACTGAATCATGGGGG + Intronic
998613641 5:143716411-143716433 CAGACTTATTTGCAGCCTGGAGG - Intergenic
998669042 5:144333008-144333030 GAGAGGTAACTGAATCATGGTGG - Intronic
998758887 5:145410666-145410688 TAGAGATAACTGAATCATGGGGG - Intergenic
999214611 5:149921779-149921801 CAGTGTTAGCTGACTCATGGAGG - Intronic
999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG + Intergenic
1000139281 5:158385821-158385843 TAGAGATAACTGAATCATGGGGG - Intergenic
1001370945 5:171200627-171200649 CATAGTTATTTGAAGTATGTTGG + Intronic
1001470668 5:172010106-172010128 AAGAGCTATCTGAAACACGGTGG - Intergenic
1001515486 5:172352624-172352646 CGGAGGTAACTGAATCATGGGGG + Intronic
1001654147 5:173336518-173336540 CAGAGTTAACTGAGGCTTGGAGG - Intergenic
1002445966 5:179290145-179290167 GTGAGGTATCTGAATCATGGAGG + Intronic
1004076733 6:12350788-12350810 GAGAGGTAACTGAATCATGGGGG - Intergenic
1004192014 6:13472151-13472173 GGGAGTTAACTGAATCATGGGGG - Intronic
1005655401 6:27930252-27930274 GAGAGGTAACTGAATCATGGGGG - Intergenic
1007503053 6:42313241-42313263 CTGAGTCATCTGAAGCAGAGAGG + Intronic
1009482942 6:64183020-64183042 TAGAGATAACTGAATCATGGGGG + Intronic
1010450272 6:75994690-75994712 CAGAGGTAATTGAATCATGGGGG - Intronic
1012025996 6:93992127-93992149 CACAGTTATTTGAAGCTTTGGGG - Intergenic
1012248713 6:96956182-96956204 GAGAGGTAACTGAATCATGGGGG - Intronic
1013873056 6:114791579-114791601 CAAAGTTATCTGATTCATGCTGG + Intergenic
1014670874 6:124302058-124302080 CAGAGATAACTGAATCATGGGGG + Intronic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1017313253 6:152999598-152999620 GAGAGGTAACTGAATCATGGGGG + Intronic
1018573608 6:165235576-165235598 GAGAGATAACTGAATCATGGGGG + Intergenic
1019039226 6:169089721-169089743 TGGAGATAACTGAAGCATGGGGG + Intergenic
1021280436 7:18710192-18710214 GAGAGTTAACTGAATCATGGGGG - Intronic
1021323352 7:19239025-19239047 AAGAGATAACTGAATCATGGGGG - Intergenic
1021687891 7:23205322-23205344 CAGACTTATTTCAAGCATGTGGG - Intergenic
1021997050 7:26189297-26189319 GAGGGTTTACTGAAGCATGGGGG - Intergenic
1024962634 7:54993762-54993784 TGGAGTGATCTGAAGCAGGGTGG + Intergenic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1028668214 7:93371605-93371627 GGGAGATATCTGAATCATGGAGG - Intergenic
1033980535 7:147159139-147159161 TAGAGGTTTCTGAAGCATGTGGG + Intronic
1036785859 8:11686493-11686515 CAGAATTTTCTGAAGACTGGAGG + Intronic
1037037183 8:14181589-14181611 TGGAGATAACTGAAGCATGGGGG + Intronic
1037085556 8:14844906-14844928 CAGAGTTTTCAGATGCAGGGAGG + Intronic
1037307416 8:17520249-17520271 GACAGTTATCTGAAGCATAGGGG + Intronic
1039089856 8:33816167-33816189 GAGAGGTAACTGAATCATGGAGG - Intergenic
1039350265 8:36756538-36756560 CAGAGATAACTGAATCATGGAGG + Intergenic
1039388166 8:37154765-37154787 CAGCTTTACCTGAAGCCTGGTGG - Intergenic
1040519204 8:48160514-48160536 AGGAGCTCTCTGAAGCATGGGGG - Intergenic
1040617576 8:49053757-49053779 TAGAGGTAACTGAATCATGGGGG - Intergenic
1042440698 8:68822405-68822427 AAGTGTTATATGAAGCAGGGTGG - Intergenic
1042589002 8:70376942-70376964 CAGTGTTAGCTAAAGCTTGGGGG - Intronic
1042594904 8:70436846-70436868 CACCGTTATCTGAAGCATAGAGG + Intergenic
1043262950 8:78224796-78224818 CAGAGTTATTGGAAGCTTGATGG - Intergenic
1043694618 8:83203441-83203463 CGGAGATAACTGAATCATGGGGG + Intergenic
1044005945 8:86937266-86937288 GGGAGGTATCTGAATCATGGGGG - Intronic
1046994222 8:120498375-120498397 CAGAGTTATCTGAAAGGTGCTGG + Intronic
1048668516 8:136690892-136690914 GGGAGTTAACTGAATCATGGGGG + Intergenic
1048887770 8:138922407-138922429 GAGAGGTAACTGAACCATGGAGG + Intergenic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049005216 8:139850928-139850950 CAGAGTTCTTTTGAGCATGGAGG - Intronic
1050336906 9:4598086-4598108 CAAAGTTAGCTGAAGCCTGTAGG - Intronic
1050809425 9:9725206-9725228 AAGAGATAACTGAATCATGGGGG + Intronic
1052518314 9:29511398-29511420 GGGAGTTAACTGAATCATGGGGG - Intergenic
1053265072 9:36706583-36706605 GAGAGATAATTGAAGCATGGGGG - Intergenic
1053647667 9:40132563-40132585 GAGAGGTAACTGAATCATGGCGG + Intergenic
1053758064 9:41331280-41331302 GAGAGGTAACTGAATCATGGCGG - Intergenic
1054328641 9:63730517-63730539 GAGAGGTAACTGAATCATGGCGG + Intergenic
1054536912 9:66243607-66243629 GAGAGGTAACTGAATCATGGTGG - Intergenic
1055393730 9:75850979-75851001 GAGAGGTAACTGAATCATGGGGG + Intergenic
1055639502 9:78308570-78308592 CAGAGTTACCTGAAACATGGAGG - Exonic
1056702175 9:88919951-88919973 AAGAGGTAACTGAATCATGGGGG - Intergenic
1057463261 9:95286788-95286810 CAGAGTTTAGTGAGGCATGGTGG + Intronic
1057505170 9:95627540-95627562 CAGAGATCTCGGACGCATGGCGG + Intergenic
1058278147 9:103074061-103074083 GAGAGGTAACTGAATCATGGAGG + Intergenic
1060909666 9:127339501-127339523 GAGAGGTAACTGAATCATGGGGG - Intronic
1061066996 9:128284651-128284673 CAAAGTTATCTTAACCATGATGG - Intronic
1061165126 9:128917767-128917789 CCGAGTGATCTAAAGCAGGGTGG - Exonic
1202795443 9_KI270719v1_random:115855-115877 GAGAGGTAACTGAATCATGGCGG + Intergenic
1203706151 Un_KI270742v1:50230-50252 AACACTTATCTGAGGCATGGTGG + Intergenic
1185690282 X:2149133-2149155 GAGAGGTAACTGAACCATGGGGG + Intergenic
1185720191 X:2375110-2375132 CAGTGTTGTCTGAAGAATGCAGG - Intronic
1186217176 X:7312563-7312585 CAGAGGTAATTGAATCATGGGGG + Intronic
1189674462 X:43446845-43446867 GAGAGATAACTGAATCATGGAGG + Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1193199107 X:78666572-78666594 CAGAGATAATTGAATCATGGGGG + Intergenic
1193348020 X:80426886-80426908 GAGAGGTAACTGAATCATGGGGG + Intronic
1193792582 X:85833537-85833559 CAGAGATAATTGAATCATGGGGG + Intergenic
1194162258 X:90468275-90468297 CAGAGGTAAATGAATCATGGGGG + Intergenic
1194257056 X:91646968-91646990 GAGAGATAACTGAATCATGGGGG + Intergenic
1194739988 X:97561000-97561022 TAGAGTTATCTGAAGCATCTGGG + Intronic
1195223518 X:102769001-102769023 GGGAGTTATCTGAAGAATGAAGG + Intergenic
1195654059 X:107317482-107317504 CAGAGTTTTCTCAAGCACAGTGG - Intergenic
1195749610 X:108150753-108150775 TAGAGATAACTGAATCATGGGGG - Intronic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197400239 X:125980554-125980576 CAGAGGTAATTGAATCATGGGGG - Intergenic
1197596054 X:128465372-128465394 CAGAGTCATCTGAGACATGTGGG - Intergenic
1199613525 X:149637200-149637222 GAGAGTTAATTGAATCATGGGGG + Intergenic
1200508534 Y:4046012-4046034 CAGAGGTAAATGAATCATGGGGG + Intergenic
1202123906 Y:21552749-21552771 CAGAATTATCTAAAGCTTAGTGG + Intergenic
1202155102 Y:21876631-21876653 CAGAATTATCTAAAGCTTAGTGG - Intergenic