ID: 1143112620

View in Genome Browser
Species Human (GRCh38)
Location 17:4560698-4560720
Sequence CCATTAGGACACAAGGCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143112613_1143112620 3 Left 1143112613 17:4560672-4560694 CCAAGGAGGCTGCATGTGAGCCT 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1143112620 17:4560698-4560720 CCATTAGGACACAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143112620 Original CRISPR CCATTAGGACACAAGGCCCG AGG Exonic
900619960 1:3582112-3582134 CCAGCAGGACACCAGGCCCGGGG + Intronic
903058241 1:20651744-20651766 CCATTAGCAAACCAGGACCGGGG + Intergenic
911062222 1:93758294-93758316 CCATCAGGATACAGGGCCAGGGG + Intronic
915496349 1:156285293-156285315 CCATTGGGAACCAAGGCCTGGGG - Exonic
917442521 1:175079935-175079957 CCATTAGATCACAAGACCAGTGG - Intronic
920259130 1:204677221-204677243 CCATAAGGACAAAAGCCCCAGGG + Intronic
920285299 1:204874589-204874611 CCATCAGGACCCAGGGCCCGAGG - Intronic
1065811242 10:29445734-29445756 CCATTAGGACACAGGGAGCATGG - Intergenic
1065908811 10:30283546-30283568 CCATTAGGACACAGGGAGCATGG - Intergenic
1073137208 10:101226711-101226733 ACATGAGGAAAAAAGGCCCGAGG + Exonic
1074964964 10:118482748-118482770 CCAGTAGGACACAAGGGCCTTGG + Intergenic
1089701150 11:120244780-120244802 CCATTGGAACAGAAGGCCAGTGG + Intronic
1096245683 12:49984260-49984282 TCATTAGGAAGCAAAGCCCGGGG - Intronic
1103733964 12:123046836-123046858 CCATAATGACACAAAGCCCTGGG - Intronic
1103872195 12:124099946-124099968 CCTATGGGACACACGGCCCGAGG - Intronic
1119125250 14:72119394-72119416 CCACTAGCACAAAAGGCCCATGG - Intronic
1121302268 14:92881185-92881207 CCCTGAGGACACCAGGCCAGAGG - Intergenic
1121887186 14:97554234-97554256 CCATTAGAACACCAGGACCAAGG + Intergenic
1131517902 15:93091399-93091421 CCATTAAGAAACAAGGGGCGGGG + Intergenic
1132879842 16:2157261-2157283 CCCTCAGGACACGGGGCCCGAGG - Intronic
1136586590 16:31190268-31190290 GCATTAGGACCCATGGGCCGTGG + Exonic
1143112620 17:4560698-4560720 CCATTAGGACACAAGGCCCGAGG + Exonic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1153607205 18:6846616-6846638 CCACCAGGACACTTGGCCCGAGG + Intronic
1153746471 18:8184932-8184954 GCATTAGAATTCAAGGCCCGTGG - Intronic
925028525 2:628838-628860 AAATTAGGACACAAGTCCCCAGG + Intergenic
925140881 2:1549248-1549270 ACATGAGGACCCAAGGCCCCGGG - Intergenic
925230868 2:2232844-2232866 CCATGAGGACGCAGGGCCTGAGG - Intronic
948859768 2:240747119-240747141 CCAAGAGGACTCAGGGCCCGTGG + Intronic
1181464784 22:23105118-23105140 ACCTTAGGATACAAGGCCCAGGG - Intronic
1183614343 22:38934266-38934288 CCATTAAGTCAAAAGGCACGGGG + Intergenic
1184777933 22:46632640-46632662 CTATTGGGACACAAGGCCCTGGG - Intronic
952906421 3:38141893-38141915 CCATTAGGAAATAAGGCTCAAGG - Exonic
953792152 3:45955908-45955930 ACAGTCGGACACAAGGCCCCTGG - Intronic
956864287 3:73353851-73353873 CCGTTCAGACACAAGGCCCCAGG - Intergenic
960423743 3:117480962-117480984 CCTTTAGGAAACAAGGCCCTAGG - Intergenic
973800062 4:54468916-54468938 CCATAAGGACACCAGTCCTGTGG + Intergenic
975660984 4:76689191-76689213 CCGTAAGGACCCAAGGACCGCGG + Intronic
986671937 5:10150401-10150423 CCATCTGGACACCAAGCCCGGGG - Intergenic
991087383 5:62660681-62660703 CCATTAGAATGCAAGGTCCGTGG - Intergenic
995062491 5:107826351-107826373 CCATCAGAAAACAAGGCCCATGG - Intergenic
999978783 5:156938908-156938930 GCATAAGCACACAAGGGCCGAGG - Intronic
1003373338 6:5550180-5550202 CCATTAGGTTTCAAGGCCTGGGG + Intronic
1019206992 6:170370206-170370228 GCAGGAGGACACAAGGCCTGGGG - Intronic
1034887676 7:154810490-154810512 CCCTTGGGACAGAAGGCCAGTGG - Intronic
1035203888 7:157282274-157282296 CCATTAGGTCACAGAGCCTGAGG - Intergenic
1035344458 7:158188897-158188919 TCATTAGGCCAAAGGGCCCGTGG - Intronic
1035743391 8:1945202-1945224 CCTTTAGGACACAAGCTCAGTGG + Intronic
1055843996 9:80539236-80539258 CCATTAGTTCACAAGTCCTGAGG - Intergenic
1056634318 9:88319247-88319269 CCATTAGGTGAGAAGGCCTGGGG - Intergenic
1191682994 X:63860262-63860284 TCATAAGGACAGAAGGCCCAAGG - Intergenic
1195934767 X:110114390-110114412 CCATCAGGACAAATGGCCAGCGG - Intronic