ID: 1143114639

View in Genome Browser
Species Human (GRCh38)
Location 17:4575754-4575776
Sequence CCGTGCGGCCCGGTATCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143114629_1143114639 -3 Left 1143114629 17:4575734-4575756 CCAGGGGTTCCTCCCACCACCCG No data
Right 1143114639 17:4575754-4575776 CCGTGCGGCCCGGTATCAGGTGG No data
1143114624_1143114639 18 Left 1143114624 17:4575713-4575735 CCGAGTCAAAAAGGCCTGGAGCC No data
Right 1143114639 17:4575754-4575776 CCGTGCGGCCCGGTATCAGGTGG No data
1143114628_1143114639 4 Left 1143114628 17:4575727-4575749 CCTGGAGCCAGGGGTTCCTCCCA No data
Right 1143114639 17:4575754-4575776 CCGTGCGGCCCGGTATCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143114639 Original CRISPR CCGTGCGGCCCGGTATCAGG TGG Intergenic
No off target data available for this crispr