ID: 1143114783

View in Genome Browser
Species Human (GRCh38)
Location 17:4576366-4576388
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143114774_1143114783 18 Left 1143114774 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG No data
Right 1143114783 17:4576366-4576388 TGTCCTAGTGGGCACCGTGCAGG No data
1143114773_1143114783 19 Left 1143114773 17:4576324-4576346 CCCTGCTTTGGAGGAGGAAGATG No data
Right 1143114783 17:4576366-4576388 TGTCCTAGTGGGCACCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143114783 Original CRISPR TGTCCTAGTGGGCACCGTGC AGG Intergenic
No off target data available for this crispr