ID: 1143115879

View in Genome Browser
Species Human (GRCh38)
Location 17:4581723-4581745
Sequence GAGCAGAAGCACAGTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143115872_1143115879 3 Left 1143115872 17:4581697-4581719 CCTGGGGACCACCTCAGTGAAGG No data
Right 1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG No data
1143115871_1143115879 4 Left 1143115871 17:4581696-4581718 CCCTGGGGACCACCTCAGTGAAG No data
Right 1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG No data
1143115869_1143115879 16 Left 1143115869 17:4581684-4581706 CCCAGCTCAGAGCCCTGGGGACC No data
Right 1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG No data
1143115877_1143115879 -8 Left 1143115877 17:4581708-4581730 CCTCAGTGAAGGGAGGAGCAGAA No data
Right 1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG No data
1143115870_1143115879 15 Left 1143115870 17:4581685-4581707 CCAGCTCAGAGCCCTGGGGACCA No data
Right 1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG No data
1143115876_1143115879 -5 Left 1143115876 17:4581705-4581727 CCACCTCAGTGAAGGGAGGAGCA No data
Right 1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143115879 Original CRISPR GAGCAGAAGCACAGTCAGGA AGG Intergenic
No off target data available for this crispr