ID: 1143116180

View in Genome Browser
Species Human (GRCh38)
Location 17:4582973-4582995
Sequence CCCTTCCCTTCTAAGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143116180_1143116187 19 Left 1143116180 17:4582973-4582995 CCTTGGATCTTAGAAGGGAAGGG No data
Right 1143116187 17:4583015-4583037 GACCAGGGTTTTTGAACTCCAGG No data
1143116180_1143116185 3 Left 1143116180 17:4582973-4582995 CCTTGGATCTTAGAAGGGAAGGG No data
Right 1143116185 17:4582999-4583021 GGGCTTCTGTGGCTGAGACCAGG No data
1143116180_1143116186 4 Left 1143116180 17:4582973-4582995 CCTTGGATCTTAGAAGGGAAGGG No data
Right 1143116186 17:4583000-4583022 GGCTTCTGTGGCTGAGACCAGGG No data
1143116180_1143116184 -8 Left 1143116180 17:4582973-4582995 CCTTGGATCTTAGAAGGGAAGGG No data
Right 1143116184 17:4582988-4583010 GGGAAGGGACTGGGCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143116180 Original CRISPR CCCTTCCCTTCTAAGATCCA AGG (reversed) Intergenic
No off target data available for this crispr