ID: 1143121060

View in Genome Browser
Species Human (GRCh38)
Location 17:4607227-4607249
Sequence GTTCCCAAGGACCCACCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143121060_1143121069 21 Left 1143121060 17:4607227-4607249 CCCGCTGGTGGGTCCTTGGGAAC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1143121069 17:4607271-4607293 TGTTCCCGGGACCGAGACACCGG 0: 1
1: 0
2: 0
3: 4
4: 65
1143121060_1143121066 7 Left 1143121060 17:4607227-4607249 CCCGCTGGTGGGTCCTTGGGAAC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1143121066 17:4607257-4607279 TGCCGGCTGAGCTCTGTTCCCGG 0: 1
1: 0
2: 0
3: 9
4: 153
1143121060_1143121064 -10 Left 1143121060 17:4607227-4607249 CCCGCTGGTGGGTCCTTGGGAAC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1143121064 17:4607240-4607262 CCTTGGGAACCTCTGGCTGCCGG 0: 1
1: 0
2: 2
3: 25
4: 270
1143121060_1143121067 8 Left 1143121060 17:4607227-4607249 CCCGCTGGTGGGTCCTTGGGAAC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1143121067 17:4607258-4607280 GCCGGCTGAGCTCTGTTCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143121060 Original CRISPR GTTCCCAAGGACCCACCAGC GGG (reversed) Intronic
900365951 1:2312076-2312098 GTTCCCAAGCCCCCAAGAGCTGG + Intergenic
900951804 1:5862246-5862268 CTTCCCACGGACTCTCCAGCTGG - Intergenic
901165823 1:7220925-7220947 GCTCCCTAGGGCCCTCCAGCTGG + Intronic
901627321 1:10631545-10631567 GCTCCCAGGGACCCTCCAGTGGG - Intergenic
901949850 1:12735044-12735066 ATTCCCAAGGCCCCTCCAGGAGG + Intergenic
903089388 1:20897644-20897666 ATTCTCAAAGACCCATCAGCGGG - Intronic
905281586 1:36852796-36852818 GCTCCCAGGGACCCACTTGCTGG + Intronic
905371443 1:37484603-37484625 GTGCCCATGGACGCACGAGCGGG + Intergenic
907032174 1:51183350-51183372 CTTCCCTAGGTCCCAGCAGCTGG - Intergenic
907194681 1:52676771-52676793 GTGCCCAAGTTCCCTCCAGCTGG - Intergenic
910158862 1:84252490-84252512 TCTCCCAAGCCCCCACCAGCTGG + Intergenic
911273415 1:95831196-95831218 GTTCCCAACGACCCATCATCTGG + Intergenic
912528035 1:110299416-110299438 CTTCCCAAGGCCCCAGAAGCTGG + Intergenic
912557933 1:110529733-110529755 GTGTCCAAGAACTCACCAGCAGG + Intergenic
917772947 1:178300082-178300104 TTTCCCGAGTACCCACCAGAGGG + Exonic
920377828 1:205518845-205518867 CTTCCCAGGGACACAGCAGCCGG - Intronic
920932315 1:210400505-210400527 GGTCCCCAGCACACACCAGCAGG - Exonic
1064001900 10:11670644-11670666 GTTCTCCAGGACCCACGGGCTGG + Intergenic
1064018604 10:11791758-11791780 GTTCCCAAGAAGTCACCAGCAGG - Intergenic
1064158461 10:12923140-12923162 CTCCCCATGGACCCACCATCTGG + Intronic
1066126786 10:32349526-32349548 GTTCCCAAGGACTCAAAGGCTGG + Intronic
1072913456 10:99522939-99522961 ATTCCCAGGGACCCAGCAGTGGG + Intergenic
1077394979 11:2316252-2316274 CTTCCTGAGGACACACCAGCAGG + Exonic
1078735503 11:14016133-14016155 GTTCCTGAGGCACCACCAGCAGG - Intronic
1080221970 11:29916600-29916622 GATCCCAAGGAAACTCCAGCAGG + Intergenic
1084006992 11:66328370-66328392 GGTCCCAGGGACCCACCACTGGG + Intergenic
1085972124 11:81605541-81605563 GTGCACCAGGACCCACCAGCTGG - Intergenic
1088873034 11:113909136-113909158 TTGCCAAAGGCCCCACCAGCTGG + Intronic
1089070094 11:115693141-115693163 GTCCTCAAGGAGCCTCCAGCAGG + Intergenic
1092997773 12:13966193-13966215 CTTCCCAAGAACTCACCAGGAGG - Intronic
1095924072 12:47561102-47561124 CTTCCCCTGGACCCACCAGCAGG + Intergenic
1101876499 12:108599715-108599737 CTCCCCCAGGGCCCACCAGCAGG + Intergenic
1102165113 12:110799794-110799816 GTTCCCAAGATCCCACCTCCTGG - Intergenic
1102260147 12:111438407-111438429 CCTCCCAAGGCCCCTCCAGCTGG - Intronic
1102517079 12:113456946-113456968 GCTCCCAGGAACCCATCAGCAGG + Intergenic
1106563292 13:30864589-30864611 GTTCCCAACATCCCACCAGGTGG - Intergenic
1115089719 14:29559233-29559255 TTTCTCCAGGACCAACCAGCAGG - Intergenic
1118141961 14:63093571-63093593 ATTCCCCAGGACACACTAGCAGG - Intronic
1119806271 14:77484490-77484512 GCTCCCCAGAACCCACCTGCAGG - Exonic
1119806352 14:77484844-77484866 GCTCCCCAGAACCCACCTGCAGG - Exonic
1121017531 14:90557577-90557599 GTTGCCAAGGACCCTCCTCCAGG - Intronic
1121072239 14:91034808-91034830 GAGACCAAGAACCCACCAGCAGG + Intronic
1122944381 14:104999448-104999470 ATGCCCAAGGACCCAGCTGCTGG + Intronic
1123782710 15:23644008-23644030 GTGCCCACGGCCCCACCAGCAGG - Exonic
1130903523 15:88224458-88224480 GTACCCAAGGTCCCCTCAGCTGG - Intronic
1133245060 16:4443158-4443180 GGGCCCAAGCACCCACCTGCAGG - Exonic
1133381942 16:5338367-5338389 GTTCCCAAGGTCCCACAGACAGG - Intergenic
1133768347 16:8853289-8853311 CTTCCCAAGGGCCCATCTGCTGG - Exonic
1133912087 16:10075423-10075445 GTTACCAGGGACCAAGCAGCGGG + Intronic
1134090133 16:11387111-11387133 ATTCCCAGGGGCCCGCCAGCAGG + Exonic
1134408403 16:13982687-13982709 GATTGCAAGGACCCACCAGGAGG - Intergenic
1138130410 16:54474722-54474744 GTTCCCAGTGACCCATCAGGAGG - Intergenic
1139417925 16:66829745-66829767 GTACCCAAGGACCCTCCTGATGG + Intronic
1140588064 16:76318106-76318128 GTACCTATGGACCCACCAGCAGG + Intronic
1141731910 16:85828715-85828737 ATCCCCATGGACCCATCAGCTGG + Intergenic
1142243768 16:88959083-88959105 GATGCCAAGGTCCCAGCAGCTGG + Intronic
1142502236 17:339620-339642 GTGCCCAAGGCCCCATAAGCTGG + Intronic
1142646307 17:1315920-1315942 CTTCCCAAAGACCCAACAGGTGG - Intergenic
1143121060 17:4607227-4607249 GTTCCCAAGGACCCACCAGCGGG - Intronic
1149384970 17:56133870-56133892 GTTCTCCAGCACACACCAGCTGG + Intronic
1156487583 18:37476385-37476407 GTTCCCATGAGCCCACCAGGGGG - Intronic
1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG + Intergenic
1158351376 18:56567724-56567746 GTACCCAGGGACCCACCATCGGG + Intergenic
1159999645 18:75004486-75004508 ATTCCCGAGGAAGCACCAGCAGG - Intronic
1160921652 19:1523656-1523678 GGCCCCAGGGACCCGCCAGCAGG + Intergenic
1161281026 19:3445834-3445856 GTGCCTATGGAACCACCAGCAGG + Intronic
1163695686 19:18762180-18762202 CCTGCCAAGGACCCTCCAGCGGG - Intronic
1164570445 19:29371016-29371038 GGCCCCATGGAGCCACCAGCAGG + Intergenic
1165426212 19:35746789-35746811 GTCCCCAAGGGCACCCCAGCGGG - Exonic
1166600948 19:44094310-44094332 ATTCCCCGGGACCCGCCAGCCGG - Intergenic
1166843167 19:45711364-45711386 CACCCCAAGGACCCACCAGCAGG - Exonic
1167998506 19:53426098-53426120 GGCCCCAGGGACCCACCAGTGGG + Intronic
1168464467 19:56590365-56590387 GTTCCAAAGGACCAACAACCTGG + Intergenic
925160617 2:1681119-1681141 GGTCCCCAGGCCCCTCCAGCCGG + Intronic
927137263 2:20106009-20106031 GAGACCAAGGACCCACCAGAAGG - Intergenic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
933776139 2:85772350-85772372 GCTCCCATGGACTCACCAGCAGG - Intronic
934557475 2:95294991-95295013 GTTCGCAAGGCCCGAACAGCCGG + Intergenic
935218251 2:100991189-100991211 CTTCCCAAGGACCCTCCCCCAGG + Intronic
938187635 2:129246009-129246031 GTCCTCAAGCACCCACCAGAGGG - Intergenic
938452008 2:131429426-131429448 GCTCCCCTGGACCCATCAGCTGG + Intergenic
939600630 2:144185453-144185475 GTTCCATTGGACGCACCAGCTGG + Intronic
939694719 2:145310658-145310680 ATTCCCATGGACCCACTGGCTGG - Intergenic
942402879 2:175622071-175622093 GTGTCCATGGTCCCACCAGCAGG - Intergenic
944736963 2:202575822-202575844 GAGACCAAGGACCCACCAGAAGG + Intergenic
944864981 2:203851256-203851278 GTTTCCAAGGACCAACAGGCAGG + Intergenic
945403658 2:209420693-209420715 GTACCCAAGGTCACACAAGCAGG + Intergenic
1171350766 20:24501544-24501566 GGTCCCAAGGCCACACCGGCTGG + Intronic
1172203875 20:33148199-33148221 GAGCCCAGGGACCCACCAGAGGG - Intergenic
1172430060 20:34882672-34882694 TTGCCCTAGGACCCACCACCTGG - Intronic
1174308433 20:49631749-49631771 GTTAGTAAGGACCCAGCAGCGGG - Intergenic
1174961526 20:55162549-55162571 ATTCCCAAGAGCCCACCAGTGGG - Intergenic
1176377393 21:6093356-6093378 GCCTCCAAGGACCCAACAGCAGG + Intergenic
1179627224 21:42655511-42655533 CTTCCCCAGGGCCCACCTGCAGG - Intronic
1179746081 21:43444888-43444910 GCCTCCAAGGACCCAACAGCAGG - Intergenic
1181671433 22:24427308-24427330 CTGCCCAGGGACCCAACAGCCGG + Intronic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
949741290 3:7237443-7237465 GAGCCCAAGAACCCACCAGAAGG - Intronic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
950964124 3:17134361-17134383 GATCCCAAAGGCACACCAGCGGG + Intergenic
952581890 3:34843759-34843781 ATTAAAAAGGACCCACCAGCTGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
954461495 3:50629494-50629516 GTTCCCAGGGAGCCACAAGGAGG - Intronic
955240651 3:57174985-57175007 TTTCCCAGGGACCCTCCAGGCGG + Intergenic
959901754 3:111669607-111669629 TTTCTCAAGGACACACCACCTGG + Intergenic
966643531 3:182216912-182216934 GTCCTCAGGGATCCACCAGCTGG + Intergenic
969571445 4:8011082-8011104 GTCCCCAAGGGCCCTTCAGCTGG - Intronic
977470784 4:97438676-97438698 GTTCCTGAGGACTCACCAGAAGG + Intronic
984124320 4:175787367-175787389 GTTCACAAGGAGCCAGCGGCCGG - Intronic
985493679 5:193145-193167 GTTCCCCAGGACCCATCACTGGG - Intronic
985677797 5:1241268-1241290 GTTCTCAAGGACCCACCTGAAGG - Intronic
986055358 5:4130940-4130962 CTGCCCAAGGACCCACAGGCTGG + Intergenic
991582419 5:68170087-68170109 GCTCCCAGGGAGCCAGCAGCTGG + Intergenic
992014330 5:72560355-72560377 GAACACAAGGACCCACCAGTAGG + Intergenic
994179280 5:96746080-96746102 CTTCCCAAGGTCACAGCAGCTGG + Intronic
999908922 5:156174717-156174739 GTTCTGAAGGACCCACCAAGGGG + Intronic
1001935601 5:175701510-175701532 CTTCCCATAGAGCCACCAGCAGG + Intergenic
1004974147 6:20946254-20946276 GTTCCCAAGGAACCACAAAGAGG - Intronic
1005640012 6:27787014-27787036 CTTCCCCAGGTCACACCAGCTGG + Intergenic
1005990153 6:30897514-30897536 GTTCCTCAGTGCCCACCAGCTGG + Exonic
1006474171 6:34244421-34244443 GTTCCCCTGCACCCACCAGCGGG + Intronic
1013656451 6:112251701-112251723 GATCCCAACGCCCCACCATCAGG - Intronic
1015505570 6:133983243-133983265 GTTGACATGGACACACCAGCTGG + Intronic
1016369903 6:143362632-143362654 GTTCTCAAAGGCCCCCCAGCGGG - Intergenic
1019296593 7:280069-280091 GATCACAAAGACCCACCAGCGGG + Intergenic
1019682590 7:2359817-2359839 GTTCTCCAGGGGCCACCAGCTGG - Intronic
1023628121 7:42136854-42136876 GTTTCCAAGCACTCCCCAGCTGG + Intronic
1023700632 7:42888756-42888778 CTTCCCGAGAACCCGCCAGCAGG + Intergenic
1029980348 7:104872715-104872737 GTCCCCAAGGACCTTCCAGTGGG - Intronic
1031933741 7:127714026-127714048 ATGCCCAAGGATCCAGCAGCAGG - Intronic
1041001569 8:53460017-53460039 GAGTCCAAGGACCCACCAGAAGG + Intergenic
1043709504 8:83397263-83397285 GAGACCAAGGACCCACCAGAAGG + Intergenic
1045908015 8:107371712-107371734 GTTTACAGGCACCCACCAGCAGG + Intronic
1047300039 8:123606141-123606163 ATTCCCAAGTACCCTCCCGCAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049475543 8:142795468-142795490 GCTCCCAAGCACCCAGGAGCAGG - Intergenic
1056811910 9:89771672-89771694 CACCCCAGGGACCCACCAGCAGG - Intergenic
1057972176 9:99568718-99568740 GTGGCCAAGGACCTACCAACAGG - Intergenic
1060402616 9:123357242-123357264 GTTCCCTTGGACCCCCCAGGAGG - Intronic
1060992807 9:127858330-127858352 GCCCCCAGGGACCCACCAGGCGG + Intergenic
1061956315 9:133963175-133963197 CTTCCCCAGGACCCAGCACCAGG + Intronic
1189740892 X:44116179-44116201 GTTCCCACAGACCCAGAAGCAGG + Intergenic
1199980772 X:152919270-152919292 GTTCTCAAGGGCCCCTCAGCTGG - Intronic
1200209978 X:154342798-154342820 GTTCCCAGGCACCCTCCCGCGGG - Intergenic
1200220874 X:154389294-154389316 GTTCCCAGGCACCCTCCCGCGGG + Intergenic
1201979566 Y:19892439-19892461 GTTCCCTAGGACTAAGCAGCTGG + Intergenic
1202194346 Y:22282115-22282137 GTTCCTAATGATTCACCAGCTGG - Intergenic