ID: 1143121199

View in Genome Browser
Species Human (GRCh38)
Location 17:4608102-4608124
Sequence GGGAAGAACAGGAGGACTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143121199_1143121213 18 Left 1143121199 17:4608102-4608124 CCCAAAGTCCTCCTGTTCTTCCC 0: 1
1: 0
2: 2
3: 30
4: 352
Right 1143121213 17:4608143-4608165 TTGGCTAAGCACAGGCTCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 145
1143121199_1143121207 -1 Left 1143121199 17:4608102-4608124 CCCAAAGTCCTCCTGTTCTTCCC 0: 1
1: 0
2: 2
3: 30
4: 352
Right 1143121207 17:4608124-4608146 CAGGAGGCCCCACAAGTGTTTGG 0: 1
1: 0
2: 2
3: 14
4: 117
1143121199_1143121211 10 Left 1143121199 17:4608102-4608124 CCCAAAGTCCTCCTGTTCTTCCC 0: 1
1: 0
2: 2
3: 30
4: 352
Right 1143121211 17:4608135-4608157 ACAAGTGTTTGGCTAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 115
1143121199_1143121212 17 Left 1143121199 17:4608102-4608124 CCCAAAGTCCTCCTGTTCTTCCC 0: 1
1: 0
2: 2
3: 30
4: 352
Right 1143121212 17:4608142-4608164 TTTGGCTAAGCACAGGCTCTCGG 0: 1
1: 0
2: 0
3: 22
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143121199 Original CRISPR GGGAAGAACAGGAGGACTTT GGG (reversed) Exonic
900150618 1:1177829-1177851 ACCCAGAACAGGAGGACTTTTGG - Intronic
900421090 1:2556265-2556287 GGGAAACACAGATGGACTTTGGG + Intronic
900913712 1:5619969-5619991 GGGAGCCACAGGAGGGCTTTGGG + Intergenic
902973771 1:20074044-20074066 GGGAAAAACAGGGTGACCTTGGG + Intronic
903263694 1:22143923-22143945 TGGGAGGACAGGAGGAGTTTAGG + Intronic
904163246 1:28536528-28536550 TGGAAGAACACCAGGACTCTAGG - Intronic
904292712 1:29498117-29498139 GGGAAGGACAGGATGACCTCTGG + Intergenic
904336505 1:29801652-29801674 GGGAGGAGCAGCAGGCCTTTGGG + Intergenic
904603619 1:31686947-31686969 GGGAAGAAGCGGATGAATTTGGG + Intronic
905261821 1:36724747-36724769 GGAAAGAACAGCATGAATTTAGG + Intergenic
905382378 1:37572129-37572151 GGGGAGATGAGGAGTACTTTGGG - Intronic
905919123 1:41707600-41707622 GGGAAGAACAAGAAGCCTATTGG + Intronic
906773900 1:48511100-48511122 GGAAAAAAGAGGAGGACATTTGG + Intergenic
906835431 1:49078714-49078736 AGAAAGATAAGGAGGACTTTGGG - Intronic
906915822 1:50008348-50008370 GTCAAGAACAAGAGGAATTTTGG + Intronic
906933171 1:50189252-50189274 GGGAAGAACAGCATGACCTGAGG - Intronic
907163011 1:52385280-52385302 CGGGAGAAAAGGAAGACTTTAGG + Intronic
907929525 1:58986374-58986396 GGGAAGAACAGTAAGACTGAAGG - Intergenic
909152035 1:72018982-72019004 TGGAGGAACATGAGGGCTTTGGG + Intronic
909811396 1:79935372-79935394 GGGAAGAACCAGAGTCCTTTGGG + Intergenic
910356608 1:86364448-86364470 TGTAAGAACAGGAGAACTATAGG + Intronic
915324307 1:155072789-155072811 GGGAAGGAAAGGAGGGCTTCTGG + Intergenic
915568293 1:156728982-156729004 AGGCAGAACAGGAAGAGTTTTGG - Exonic
915929662 1:160052101-160052123 GAGAAGAATAGGAGGCTTTTGGG - Intronic
916916730 1:169415359-169415381 ATGAAGGACAGGAGGAATTTGGG - Intronic
919065562 1:192688847-192688869 GGGAAGAAAATGATGAGTTTGGG - Intergenic
919739949 1:200975355-200975377 AGGGAGAACAGGAGGGCTTGGGG + Intronic
919932229 1:202228814-202228836 GGGAAGAAAAGGAGGATATTAGG + Intronic
920008997 1:202854184-202854206 GGGAAGAATAGGCTGCCTTTAGG - Intergenic
922199470 1:223389847-223389869 GGGCAGGGCTGGAGGACTTTAGG - Intergenic
923231452 1:231990363-231990385 GGGATGAGCAGGGGGACTCTTGG - Intronic
924147213 1:241088750-241088772 AGAGAGAACAGGAGCACTTTGGG + Intronic
924147334 1:241089744-241089766 AGAGAGAACAGGAGCACTTTGGG + Intronic
924495102 1:244580625-244580647 GGAAAACACAGGAGGGCTTTGGG - Intronic
924709916 1:246523285-246523307 AGAAAGAACAGGAGAACTCTGGG + Intergenic
1064177505 10:13087611-13087633 GGGAAAAACAGGAGGTCCTAAGG + Intronic
1064578622 10:16770699-16770721 GGGATGAAGAGGAGGACTTAAGG + Intronic
1065365338 10:24929823-24929845 TGGAAAAACAGGAGGATTTGAGG - Intronic
1065386801 10:25142217-25142239 GGGTTGAACAGGAGAACCTTAGG - Intergenic
1065777319 10:29132904-29132926 GGGAAGAGGAAGAGGACGTTTGG - Intergenic
1066276123 10:33870549-33870571 AGGAAGAACTGGAGGACAGTTGG + Intergenic
1067011670 10:42720173-42720195 GGAATGAAGAGGAGGACTTAGGG - Intergenic
1067311920 10:45121683-45121705 GGAATGAAGAGGAGGACTTAGGG + Intergenic
1067371408 10:45686770-45686792 TGGAAGGACAGGTGGACTTGGGG + Intergenic
1067388376 10:45839379-45839401 TGGAAGGACAGGTGGACTTGGGG - Intronic
1067417693 10:46117578-46117600 TGGAAGGACAGGTGGACTTGGGG + Intergenic
1067445891 10:46345199-46345221 TGGAAGGACAGGTGGACTTTGGG + Intergenic
1067503105 10:46824466-46824488 TGGAAGGACAGGTGGACTTGGGG + Intergenic
1067591490 10:47515542-47515564 TGGAAGGACAGGTAGACTTTGGG - Intronic
1067638608 10:48023637-48023659 TGGAAGGACAGGTAGACTTTGGG - Intergenic
1067874879 10:49996684-49996706 TGGAAGGACAGGTGGACTTGGGG + Intronic
1069237483 10:66095198-66095220 AGGAAGAGCTGGAGGACTATAGG + Intronic
1069518671 10:69100641-69100663 GGGAAGGACAGGAGGATCTGAGG - Intronic
1070135208 10:73688057-73688079 TGGAAGGACAGGTGGACTTGAGG - Intronic
1070892142 10:79948905-79948927 GGGGAGCACAGGAGGTCTTATGG - Intronic
1074144190 10:110701946-110701968 GGATAGAGCAGCAGGACTTTGGG + Intronic
1074825273 10:117210144-117210166 GAGAAGAACAGGAAGAAGTTAGG - Exonic
1075030722 10:119023033-119023055 GGGAAGCACAGGAGGAGGTGGGG + Intergenic
1075779369 10:125006949-125006971 GGGAAGAACAGCAGCACTGCAGG - Intronic
1078719651 11:13872593-13872615 GGGAGGAAGAGGAGGACATGAGG - Intergenic
1079033619 11:17003925-17003947 AGGATGTACAGGAGGACTTAAGG - Intronic
1079828578 11:25231667-25231689 GGGAATAACAGGAGGGTTATGGG - Intergenic
1080342137 11:31277103-31277125 GAAAAGAACATGAGGAATTTTGG - Intronic
1080453650 11:32399221-32399243 GGGAAGAACAGGTGGAGTGTAGG + Intronic
1080583181 11:33659969-33659991 GGGAAGCAGAGGAGGACTCTGGG - Intronic
1081594070 11:44447094-44447116 GGGAAGCAAAGGAGGACATGCGG + Intergenic
1081997850 11:47376602-47376624 GGGAAGAAAAGGAGGACAGAGGG - Intronic
1082137783 11:48569704-48569726 GGAAAGGACATGAGGCCTTTGGG - Intergenic
1082793314 11:57362384-57362406 GGTAAGAACCAGAGGACTTGGGG + Intronic
1083665389 11:64271480-64271502 GGAAGGAACAGGACGGCTTTGGG + Intronic
1084148156 11:67275825-67275847 GGGAAGGAGAGGAGGCCTCTGGG - Intronic
1084169860 11:67395883-67395905 GGGAAGAACAGGAGTAACCTGGG - Intronic
1084348961 11:68580211-68580233 GGAGAGAACAGAAGGACTTGAGG + Intronic
1088584190 11:111346282-111346304 TGGAAGAGCTGGAGGACTTGAGG - Intergenic
1088664049 11:112076357-112076379 GGGATGAAGAAGAGGAATTTAGG + Intronic
1088711394 11:112512088-112512110 GTGAAGAGCTGGATGACTTTTGG + Intergenic
1089433447 11:118441365-118441387 GGAAAAAACATAAGGACTTTGGG + Intronic
1089928113 11:122280674-122280696 GGGGAGAAAAGGGGGACTCTAGG - Intergenic
1090008635 11:123025364-123025386 GGGAAGAACAGAATGAACTTAGG + Intergenic
1090351919 11:126113302-126113324 GGGAGGAACAGGGGCGCTTTGGG + Intergenic
1090639457 11:128717933-128717955 GGGAACATCTGGAGGACTTCTGG - Intronic
1091391459 12:128746-128768 GGGAAGCACAGGAGGTCTCCCGG - Intronic
1091484765 12:874930-874952 GGGAATATCAGGAAGACTTTAGG + Intronic
1091964116 12:4723526-4723548 GGAAAGAATAGCAGGGCTTTGGG - Intronic
1092022927 12:5217082-5217104 GGGAAGAACTGGAGGGCAGTGGG - Intergenic
1092193078 12:6534152-6534174 GGATGAAACAGGAGGACTTTGGG - Exonic
1092577274 12:9800452-9800474 GGGAAGAATAGGAGGGGTTTTGG - Intergenic
1093138264 12:15477677-15477699 GGCAAGAACAGGAGCACCCTTGG + Intronic
1094010959 12:25808977-25808999 GGGAAGAAAAGGAGGAAGATAGG + Intergenic
1095822386 12:46492597-46492619 GGAAAGAACTGTAGGATTTTTGG - Intergenic
1095895712 12:47278576-47278598 GGGAAGAAGAGGTAGGCTTTGGG - Intergenic
1096695883 12:53347957-53347979 AGAAAGAACACAAGGACTTTTGG - Intergenic
1097240184 12:57569717-57569739 GGGAAGAGGAGGAGGATGTTTGG + Intronic
1099165251 12:79298414-79298436 GGGAAGAAAAGGAAGAATATTGG - Intronic
1100953156 12:99875699-99875721 TGGAAGAACAATGGGACTTTGGG + Intronic
1101974234 12:109341573-109341595 GGGAAGAGGAGGATGACTTCAGG + Intergenic
1103298826 12:119911326-119911348 AGGTGGAAAAGGAGGACTTTAGG + Intergenic
1104654364 12:130562524-130562546 AGGAAGTACAGGAGTACTTCTGG + Intronic
1104969933 12:132526693-132526715 AGGAAGAAAAGGAGGGCTTTGGG - Intronic
1105406259 13:20134918-20134940 GGGAAAAGCAGCAGGCCTTTGGG - Intergenic
1107086732 13:36433195-36433217 GGGCAGTACAGGAGGACCTGTGG + Exonic
1107237047 13:38184025-38184047 GGAAAGTACTGGAGGACATTAGG + Intergenic
1107389744 13:39951554-39951576 GGGAAGAACAGGGAAACTTTGGG + Intergenic
1108176150 13:47795115-47795137 GAGAAGAGCAGGAAGGCTTTAGG - Intergenic
1108784617 13:53881023-53881045 TGGAAGAACAGGAAGATTTGAGG + Intergenic
1108878080 13:55073143-55073165 AAGGAGAGCAGGAGGACTTTTGG + Intergenic
1109432167 13:62250266-62250288 GGGAGGCACAGGAGCACATTAGG + Intergenic
1110739832 13:78981760-78981782 GGGAAAAATAGGAGGAGTCTTGG + Intergenic
1112379880 13:98878782-98878804 GGGAGGAAAAGGAGGGCTTTAGG + Intronic
1114704812 14:24714399-24714421 AGGAAGAGCAGGAGGAATCTCGG - Intergenic
1118349341 14:64962284-64962306 GGGAAGAACAGAAGTCCTCTAGG + Intronic
1118579429 14:67279349-67279371 GGCAACAACAGGAGGACATGAGG + Exonic
1118703124 14:68454447-68454469 AGGAAGAACAGCAAGACTTGTGG + Intronic
1119174927 14:72562033-72562055 GGGAGGAAAAGGTGGACTTGGGG - Intronic
1119689474 14:76660157-76660179 GGCAGAAACAGGAAGACTTTTGG - Intergenic
1121520989 14:94586147-94586169 GGGAGGAAGAGGAGGACTGAAGG + Intronic
1121982974 14:98470926-98470948 GGGAAGGACAGGAGAACTGCAGG - Intergenic
1124403047 15:29367147-29367169 GGTAAGAACAGTAGGATTTGGGG + Intronic
1125176598 15:36829788-36829810 GGTAGGACCTGGAGGACTTTTGG + Intergenic
1125600026 15:40910456-40910478 GGGATGAAAAGGAGGCCCTTAGG - Intergenic
1127365335 15:58284263-58284285 GAGAAGGACAGGAGGTCCTTGGG + Intronic
1128899861 15:71410533-71410555 AGGAAGAACAGGAGGAAATGAGG + Intronic
1130803446 15:87292038-87292060 AGGAATGTCAGGAGGACTTTGGG - Intergenic
1131436161 15:92423952-92423974 GTGAGGAACAGGATGACTTGGGG - Intronic
1132211311 15:100024695-100024717 GGGATACATAGGAGGACTTTTGG - Intronic
1132890255 16:2200210-2200232 AGGAAGATGAGGAGGACTATGGG + Intergenic
1133895864 16:9928293-9928315 GGGATGATCAGGAGAGCTTTTGG + Intronic
1135140743 16:19919370-19919392 GGCCAGGGCAGGAGGACTTTTGG + Intergenic
1135407984 16:22211768-22211790 TGGAGAAACAGAAGGACTTTTGG - Intronic
1135968936 16:27058299-27058321 ATCAAGAACAGGAGGACTCTTGG - Intergenic
1137033504 16:35547071-35547093 GGGAACAACCGGAGCACTTCTGG + Intergenic
1137717607 16:50608331-50608353 AGGAAGAGGAGGACGACTTTCGG + Exonic
1138852964 16:60652157-60652179 TGGAAAAACTGGAGGACATTAGG - Intergenic
1139765044 16:69220909-69220931 GTGAGGAACAGGGGAACTTTTGG - Intronic
1139996889 16:70989725-70989747 GGGGAGAACCGGAGAACTGTAGG - Intronic
1140232182 16:73126403-73126425 GGGAAGCACAACAGGACTTGGGG + Intergenic
1140715304 16:77721058-77721080 GAAAAGAAAAGGTGGACTTTGGG - Intergenic
1140733464 16:77876992-77877014 GGGACGCTCAGGAGGAGTTTAGG - Intronic
1141977877 16:87529639-87529661 GGGAAGAGCAGGAAGAGATTAGG + Intergenic
1143121199 17:4608102-4608124 GGGAAGAACAGGAGGACTTTGGG - Exonic
1143199603 17:5103136-5103158 GGCAAGATCAGTAGGACTTTTGG - Intergenic
1143433584 17:6905415-6905437 GTGAAAATCAGGATGACTTTGGG - Intronic
1146657795 17:34645285-34645307 GGGAACCACAGGAGGGCTGTTGG - Intergenic
1146742229 17:35296867-35296889 GGGAAGAAAAGGAGGTTTATTGG - Intergenic
1147162893 17:38578345-38578367 GGGAAGAAGGGGAGGAGTTGGGG - Intronic
1147463317 17:40589885-40589907 GGGAGGAACAGGAGGGTTTCAGG - Intergenic
1147741183 17:42671777-42671799 AGGAAGATCACGAAGACTTTTGG - Intronic
1148595462 17:48851138-48851160 TGAAAGAACAGAAGGACTATTGG + Exonic
1148996327 17:51713414-51713436 GGGGACAACGGGAGGACTTGAGG + Intronic
1149374594 17:56031463-56031485 GGGAAGAAAAGCAGAAGTTTGGG + Intergenic
1149864803 17:60145423-60145445 GGGAAGGACAGGAGCCTTTTTGG - Intergenic
1150448384 17:65245239-65245261 GGGAGCCACAGGAGGATTTTGGG + Intergenic
1151930346 17:77228133-77228155 GGGAAGAACTGGAGGGCCATGGG - Intergenic
1152184432 17:78845295-78845317 GGAAAGAAAAGGAGGCCATTGGG + Intergenic
1153256863 18:3180502-3180524 GGGAAGAAAAGAAGGATTTGGGG + Intronic
1153737225 18:8083393-8083415 GGGAAGAACAGTAGGAACTAAGG - Intronic
1154292981 18:13126873-13126895 GGGAACAACATGAGGGCTTGAGG - Intergenic
1155068064 18:22285679-22285701 GGGAAGTCCAGGATGACTTCCGG + Intergenic
1156453971 18:37282525-37282547 GGGAAGAAAAGGAAGCCTCTGGG - Intronic
1157312092 18:46560204-46560226 AGGAGGAAGAGGAGGAGTTTGGG - Intronic
1158860023 18:61582606-61582628 GGGGAGAACACACGGACTTTGGG - Intergenic
1159150821 18:64521371-64521393 GAGAAGAACAGGAGGAGATGAGG + Intergenic
1160785292 19:897560-897582 GGCAAGAACGGGAGGAATTTGGG + Intronic
1161032006 19:2061859-2061881 GGGCAAAACAGGAGGACGTGGGG - Intergenic
1161095447 19:2387780-2387802 GTGAAGGTCAGGAGCACTTTGGG + Intergenic
1164528306 19:29027848-29027870 GGGAAGAGCAGGCTGACTTCTGG + Intergenic
925231976 2:2241332-2241354 GGGAAGAACAGGAACACAATGGG + Intronic
925463924 2:4089353-4089375 GGGATGAAGAGGAGGCATTTGGG + Intergenic
925766956 2:7245519-7245541 AGCAACAACAGGAAGACTTTTGG - Intergenic
926466740 2:13200021-13200043 GGAAAGAACATGAAGATTTTAGG + Intergenic
926695877 2:15770047-15770069 AGAAAGGACAGGAGGGCTTTGGG - Intergenic
927190049 2:20511334-20511356 GGGGAGAACAGGAGGAGATAAGG - Intergenic
928878834 2:36073563-36073585 GGGAAGAGAATGAGGACATTTGG + Intergenic
929543634 2:42841532-42841554 GGGAAACACGGGAGGACTCTGGG - Intergenic
930090024 2:47525336-47525358 GGGAAGGTCAAGAGGACTTATGG + Intronic
931859524 2:66340038-66340060 AGGAAAACCAGAAGGACTTTAGG + Intergenic
932012115 2:67989038-67989060 GGGAATAGCAGGTGGTCTTTAGG - Intergenic
936575811 2:113654187-113654209 TGGATGAACTGGAGGACATTAGG - Intergenic
937203758 2:120223102-120223124 GGGACGACCAGGAGGAGGTTCGG + Exonic
937255251 2:120550907-120550929 GGGAAGAAAAGCAGGACTGAGGG + Intergenic
938811933 2:134861854-134861876 AGGGAGAGCAGGAGGAGTTTAGG + Intronic
939127346 2:138193322-138193344 CTGCAGAACATGAGGACTTTTGG - Intergenic
939440300 2:142240019-142240041 GGGAACAACATGAGGACTATAGG + Intergenic
940001950 2:148975399-148975421 AGGTAGAACAGGAGGTATTTAGG + Intronic
940640382 2:156339566-156339588 ATGAAGCACAGCAGGACTTTCGG + Intronic
941651257 2:168094843-168094865 GGGAAGATCAGGAGTTCATTAGG - Intronic
942631994 2:177960255-177960277 TGGATGAAAAGGAGAACTTTGGG - Intronic
943098505 2:183458073-183458095 GGGAAGTACTGAAGGATTTTAGG + Intergenic
943279859 2:185918149-185918171 GGGAAGAAGAGGAATTCTTTTGG - Intergenic
943355720 2:186852761-186852783 GAAAAGTACTGGAGGACTTTAGG - Intergenic
943948032 2:194092507-194092529 GGAAAGAACAGGTGGCCATTTGG - Intergenic
944290578 2:197999795-197999817 GGGAAGAAAGGGAGGAATGTTGG - Intronic
947983577 2:234429800-234429822 GGGAAGACCAAGAGGACTCAGGG - Intergenic
948752414 2:240140207-240140229 GGAGAGAACAGGAGGGCTGTCGG + Intronic
1169195341 20:3679663-3679685 GGGAGGCACTGGAGGCCTTTTGG + Intronic
1169252635 20:4072166-4072188 GGGGAGAACAGATGGAATTTAGG + Intronic
1169949471 20:11027364-11027386 TGGAAGAACAGTGGGTCTTTTGG + Intergenic
1170336127 20:15272314-15272336 AGGAACATGAGGAGGACTTTGGG - Intronic
1170394281 20:15909158-15909180 TGGAAGAACTGGAGCTCTTTGGG + Intronic
1171342720 20:24443317-24443339 GGGAAGATGAGCAGGACTCTTGG + Intergenic
1174197568 20:48784605-48784627 GGGAAGAGGGGGAGGCCTTTCGG - Intronic
1174209150 20:48863411-48863433 GTGAAGCACAGGAGAATTTTAGG - Intergenic
1175082222 20:56430272-56430294 AGGAAGAACAGGAGGAGGATAGG - Intronic
1175789016 20:61730307-61730329 GGGATGAACAGGAGGGCATGGGG - Intronic
1175965183 20:62656758-62656780 AGGAAGAACAGGATGCCCTTGGG - Exonic
1179883141 21:44301747-44301769 GGGAACCACAGGTGGGCTTTGGG - Intronic
1180899511 22:19360267-19360289 GGGAAGGGCTGGAGGAGTTTGGG + Intronic
1181735280 22:24876638-24876660 AGGATGAACAGGAGGACTTCCGG - Exonic
1182527125 22:30927402-30927424 AGGAAGAAGAGCAGGACTTGAGG - Intronic
1183398987 22:37589984-37590006 GGGAAGGGCTGGAGGACTCTAGG - Intergenic
1183525365 22:38319395-38319417 CTGAAGAAGAGGAGGGCTTTGGG - Intronic
1183680607 22:39326867-39326889 TGGAAGATTAGGAGGACTTGAGG + Intergenic
1183804564 22:40197229-40197251 GTGCAGAATAGGAGGTCTTTGGG + Intronic
1183901551 22:41009698-41009720 GGGAAGAACAGGAGGAAGTGTGG + Intergenic
1185424598 22:50759271-50759293 TGGATGAACTGGAGGACATTAGG + Intergenic
950969304 3:17170366-17170388 AGGAAGAACAGGGGGCTTTTTGG + Intronic
952603551 3:35114941-35114963 GGGAAGAAAAGGGGGATTGTAGG + Intergenic
953271642 3:41451236-41451258 GGGAACAAGAGGGGGCCTTTGGG + Intronic
953540721 3:43815405-43815427 GACAAGAACATGAGGACCTTGGG - Intergenic
954155425 3:48682557-48682579 TGGAAGGACAGGAAGACTATTGG + Intronic
956799027 3:72740131-72740153 GGCAAGGTCAGGGGGACTTTGGG - Intergenic
958552171 3:95630042-95630064 AGTAAGAACAGCAGGACTTATGG - Intergenic
958682260 3:97346170-97346192 GGGAAGAACACAAGGACTTTAGG - Intronic
960057007 3:113283090-113283112 GGGAAGAACTGGTGAACTTTTGG - Intronic
960247961 3:115420500-115420522 TAGAAGAACAGGAGGACTAGAGG + Intergenic
961086490 3:124072111-124072133 GGGAAGAAAAAGAGGATATTGGG + Intergenic
962388634 3:134953481-134953503 GGGACAAAGAGGAGGACTGTGGG - Intronic
962679067 3:137780258-137780280 AGAAGGAACAGGAGGCCTTTGGG - Intergenic
962723753 3:138201409-138201431 GGGAAGAAGACAAGGACTCTAGG - Intronic
962813148 3:138975740-138975762 GGGAAGAAAGGAAGGAGTTTTGG - Intergenic
963056002 3:141186850-141186872 GGGAAGCACAGGAGGCTGTTGGG - Intergenic
963635249 3:147786663-147786685 GGATAGAACTGGAGGACATTAGG + Intergenic
964018419 3:151976846-151976868 TGGAAAACCAGGAGGTCTTTGGG - Intergenic
967080173 3:186042612-186042634 GGGAAGAACAGGCATTCTTTAGG - Intergenic
968276149 3:197441908-197441930 GGGAAGACCTAGAGGACTCTGGG + Intergenic
968725450 4:2245844-2245866 GGGACCCAGAGGAGGACTTTAGG + Intergenic
969253987 4:5990340-5990362 GGGAAGGCAAGGGGGACTTTGGG - Intergenic
970152128 4:13101119-13101141 GGGAACACCAGGAGGGCTCTAGG - Intergenic
971457174 4:26856260-26856282 GGGTGGAACTGGAGGACATTAGG - Intergenic
972633774 4:40864512-40864534 GGGCAGAACAGGAAGACTCCAGG - Intronic
972901834 4:43695034-43695056 TGGAAGAACAAGAGGAATTTTGG - Intergenic
972930956 4:44071231-44071253 GAGAAGAGCAGCAGCACTTTGGG - Intergenic
972993165 4:44847360-44847382 GGGAAAATCAGGAGGACTGAAGG + Intergenic
973289207 4:48453767-48453789 GGAAAGAACATGAGTGCTTTGGG + Intergenic
975752184 4:77535190-77535212 GGGAAGAACTGGGGGCCTTTAGG + Intronic
976299710 4:83506386-83506408 CAGAAGAAAAGGAGGACTTCCGG - Intronic
976353256 4:84084576-84084598 GGGAAGAAGAGGGGCACTCTAGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976536115 4:86219403-86219425 AGGAAGAAAAGGAGGATATTTGG + Intronic
977319204 4:95489753-95489775 GGGATGCAGAGGAGGAATTTTGG + Intronic
977550352 4:98435543-98435565 GGGAAGAACAGAAGGGGCTTAGG + Intronic
977561715 4:98539615-98539637 GGGAAGAAAAGGAGAACTGTGGG + Intronic
977989621 4:103425160-103425182 GGGGAGAAGAGGAGGACCTCAGG + Intergenic
979035723 4:115714288-115714310 GGGACTAACAGGAGGTGTTTAGG + Intergenic
980106254 4:128591442-128591464 GGAAAGGACAGGAAGAGTTTGGG + Intergenic
982360981 4:154518734-154518756 GGGAAGAGCAGGAGGGCTGGAGG + Intergenic
982742381 4:159071400-159071422 AGGAAGAACAGGAGGAGCCTTGG + Intergenic
984163412 4:176281510-176281532 AGCAAGAACAGGAGGAATTGAGG + Intergenic
984766193 4:183402353-183402375 GGGAAGAAGAGCAGGACATGGGG - Intergenic
985399546 4:189580735-189580757 GGGAAGAAAAAGAAGGCTTTTGG - Intergenic
986374830 5:7119830-7119852 GGCAAGAACAGCCTGACTTTGGG + Intergenic
986730605 5:10632353-10632375 GGGAAGCACAGGAGCACTGCTGG + Intronic
986969485 5:13315459-13315481 GTGAAGAACAGGTGAACTTTAGG - Intergenic
987248342 5:16073118-16073140 AGGAAGCAAATGAGGACTTTGGG + Intronic
988263607 5:28923614-28923636 GAGCAGAACAGAAGTACTTTAGG - Intergenic
988825206 5:34929348-34929370 GGGAAGAACAGGAGGAAGGCGGG - Intergenic
989458831 5:41672807-41672829 GGTAATAACAGGAGGGCTTATGG + Intergenic
990570386 5:57072646-57072668 GGAAAGAATGGGAGGAATTTAGG + Intergenic
991641303 5:68756944-68756966 GGGAAGCAAAAGAGGACTTTAGG - Intergenic
992007817 5:72495648-72495670 GGAAAGAACAAGAGGAATGTCGG + Intronic
993645662 5:90457356-90457378 TGGAAGATAAGGAGTACTTTAGG - Intergenic
993821542 5:92623571-92623593 TCAAAGAACAGGATGACTTTAGG + Intergenic
999572204 5:152932160-152932182 GGAATGAACAGGATGAGTTTGGG - Intergenic
999811958 5:155136146-155136168 GGGTAGTACTGGAGGACGTTGGG + Intergenic
999894762 5:156019686-156019708 GGGAAGAACTGGAGAACTTGTGG + Intronic
1000278765 5:159764003-159764025 GGGAAGACAAGGAGGACCTGGGG - Intergenic
1002596243 5:180325324-180325346 AGGAACAACAGGGGGTCTTTGGG - Intronic
1002846194 6:947438-947460 TGGAAGCCCAGGAGGACCTTAGG + Intergenic
1003278669 6:4673918-4673940 GGGAAGGACAGAAGGAGGTTAGG + Intergenic
1004566333 6:16801442-16801464 GGGAAGGAAGGGAGGACCTTTGG - Intergenic
1007092793 6:39194518-39194540 GGGGAGGACAGGAGGCCTCTAGG - Intronic
1007381859 6:41495292-41495314 GGGAAGTTCAAGGGGACTTTGGG - Intergenic
1008544838 6:52575861-52575883 GGGAAGAACTGGAGGAAGCTTGG - Intronic
1009219783 6:60969484-60969506 GGGAAGAAGAGGAGGGATTTAGG - Intergenic
1009323632 6:62322331-62322353 GGGAAGAGCAGGAGGGCTGAAGG - Intergenic
1010189155 6:73176706-73176728 GGAAAGAACAGGAGGAATCAAGG + Intronic
1010202932 6:73298938-73298960 GGGAGGAAGAGGAGGAGTGTGGG + Intronic
1011246018 6:85322138-85322160 GGGAACAACAGGAGGGGCTTGGG - Intergenic
1012990673 6:105922669-105922691 AAGAAGAACAGGAGGAAGTTAGG + Intergenic
1013963608 6:115929304-115929326 AGGAAGAATGGGAGGACTTCTGG + Intergenic
1014825517 6:126045392-126045414 TGGAAGAGGAGGAGGGCTTTGGG + Intergenic
1014835679 6:126157565-126157587 GGGAAGATAAGGAGAACTATAGG + Intergenic
1015378407 6:132536666-132536688 GGGAAGAAGAGGAGAACATGGGG + Intergenic
1015650702 6:135455735-135455757 TCAAAGAACAGGATGACTTTAGG + Exonic
1015872882 6:137794791-137794813 GGGAAGAAAAGGAGGAAGGTGGG + Intergenic
1016307701 6:142700718-142700740 GGGAAGAATGGGATGAGTTTAGG - Intergenic
1016455489 6:144226097-144226119 GGGAAGTATGGGAGCACTTTTGG + Intergenic
1018828558 6:167424556-167424578 GGAAAGTACAGGAGGACCCTGGG - Intergenic
1019551799 7:1606823-1606845 GGGAAGAAGAGGAGGACGAGAGG - Intergenic
1020047967 7:5057653-5057675 GGGAAAAGAAGGAGGACTTGGGG - Intronic
1020651499 7:10882240-10882262 GGGGACAAGAAGAGGACTTTGGG - Intergenic
1021106909 7:16647499-16647521 GGGAAAAACAGCTGGAGTTTAGG - Intronic
1021321741 7:19220940-19220962 TGGAAAAACTGGAGGACTTGAGG - Intergenic
1022659545 7:32354001-32354023 GACAACAACAGGAGAACTTTTGG + Intergenic
1024134219 7:46390187-46390209 GGGAATAACAAGAGGAATTTTGG - Intergenic
1024626521 7:51212622-51212644 GGCATGAACAGGGGGACTGTAGG - Intronic
1025958246 7:66199112-66199134 AGGGAGAACAGGAGGACACTTGG - Intergenic
1026294843 7:69042233-69042255 GGGAAGACCAGGAGGGAGTTGGG - Intergenic
1026876714 7:73883452-73883474 GGGAAAGCCAAGAGGACTTTAGG + Intergenic
1027515321 7:79135552-79135574 GGGAAGCAGAGGAGGATTCTGGG - Intronic
1029200629 7:98836968-98836990 CAGAGGAACAGGAGGAGTTTAGG - Intergenic
1030058717 7:105606376-105606398 GGAAAGAAAAGGAAAACTTTGGG + Exonic
1030168392 7:106577202-106577224 GGGGAGAAAAAGAGGACTGTGGG - Intergenic
1030489648 7:110215588-110215610 GGGAAAAATAGGAAGAGTTTGGG - Intergenic
1030761057 7:113352227-113352249 AGGAAGAACAGGAGGAGATATGG + Intergenic
1030952577 7:115810015-115810037 GGGAAGAACAGGAAGAAAATAGG + Intergenic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1032199253 7:129807874-129807896 AGGAGGCACAGGAGGAATTTGGG - Intergenic
1032986945 7:137347455-137347477 AGGAAGAAGGGGAAGACTTTTGG - Intergenic
1032991312 7:137397731-137397753 GGGAAGATTAGGTGGGCTTTAGG + Intronic
1033742245 7:144284367-144284389 GGGAGGAGCAGGAGCACTTGGGG - Intergenic
1034380553 7:150688624-150688646 GGAAGGGAGAGGAGGACTTTTGG - Intronic
1034422003 7:150995447-150995469 GGGAAGAACCAGAGGAGTTGAGG + Intronic
1036117283 8:5972072-5972094 GGAAAGAACCTGAGGACATTGGG - Intergenic
1036999418 8:13699996-13700018 ATTAAGAACAGGATGACTTTCGG + Intergenic
1037346363 8:17905542-17905564 GGGAAGAGGAAGAGGAATTTAGG - Intronic
1038951191 8:32416326-32416348 GGGAAGGACAGAAGGAATTAAGG - Intronic
1040551859 8:48444073-48444095 GGGATGACCAGGAGGCCTCTTGG + Intergenic
1043160004 8:76834822-76834844 GGGAAAATCTGGATGACTTTGGG - Intronic
1043245515 8:77994927-77994949 GGTAAGAACAGGAGTACTTTTGG - Intergenic
1045342614 8:101268031-101268053 GGGGAGAATGGGAGGGCTTTGGG - Intergenic
1045766836 8:105682369-105682391 GGGAAGAACAAATGCACTTTGGG + Intronic
1046764905 8:118058928-118058950 GGGGAGAACAAGAGAAATTTTGG - Intronic
1047776938 8:128079587-128079609 GGGAAGCACAGGGGAATTTTAGG - Intergenic
1048518918 8:135136137-135136159 GGGAAGAAAACAATGACTTTTGG + Intergenic
1051212742 9:14762244-14762266 GGGAAGGAAAGGAGGACAGTGGG + Intronic
1051599953 9:18862771-18862793 GGGAAGACCAGGATGACCCTAGG - Intronic
1052128146 9:24805214-24805236 GGGAAGAACAAGAAAAATTTTGG - Intergenic
1056740256 9:89248530-89248552 GGGGAGAACAGTAAGACTGTGGG - Intergenic
1057218466 9:93242848-93242870 GGCAAGGATAGGAGGACATTTGG + Intronic
1058253961 9:102737496-102737518 GAAAAGTACTGGAGGACTTTAGG - Intergenic
1059666668 9:116452927-116452949 TGGAAGAAGAGAAGGGCTTTAGG - Intronic
1059702419 9:116788161-116788183 GGGAAGAAGATGAGGAATTGCGG + Intronic
1060622447 9:125080293-125080315 GGGAAGAAGAACATGACTTTGGG - Intronic
1061670766 9:132186974-132186996 GGGAGGAAAGGGAGCACTTTAGG - Intronic
1061794811 9:133080236-133080258 GGGACAAACACGAGGACTTTAGG - Intronic
1062424871 9:136501563-136501585 TGGAAGAACAGGAGGACTCCAGG + Intronic
1186137463 X:6534361-6534383 GGGAAGACGAGGAGGAGCTTGGG + Intronic
1186266969 X:7843318-7843340 GGGAAGACGAGGAGGAGCTTGGG - Intronic
1186298135 X:8170507-8170529 GGGAAGACGAGGAGGAGCTTGGG + Intronic
1186324659 X:8465565-8465587 GGGAAGACGAGGAGGAGCTTGGG - Intronic
1186809439 X:13173791-13173813 GTGAAGAACAGGCAGACTTTAGG + Intergenic
1187500210 X:19833139-19833161 GGGAAGGAGAGGAGGACCATGGG - Intronic
1187500216 X:19833159-19833181 GGGAAGGAGAGGAGGACCGTGGG - Intronic
1187500259 X:19833301-19833323 GGGAAGGCAAGGAGGACTGTGGG - Intronic
1187500313 X:19833484-19833506 GGGAAGGTGAGGAGGACTGTGGG - Intronic
1188107605 X:26163172-26163194 GGGCAGAGCAGGATGATTTTGGG - Intergenic
1188110996 X:26196401-26196423 GGGCAGAGCAGGATGATTTTGGG - Intergenic
1188473875 X:30569387-30569409 GGGAAGATCAGGAGGAGCTGTGG + Intronic
1189195954 X:39152521-39152543 GAGAAAAACAGCAGGACTTGGGG - Intergenic
1189353135 X:40292084-40292106 GAGAAGGGCAGGAGGAGTTTGGG + Intergenic
1189371923 X:40435481-40435503 GGGAAGAAGTGCAGGAGTTTAGG + Intergenic
1189564998 X:42232438-42232460 GGGAAGAAAAGAAGGAGTTTTGG + Intergenic
1189671907 X:43420140-43420162 GTCAAGACCAGGAAGACTTTTGG + Intergenic
1190150462 X:47943023-47943045 GGGGAGGACAGGAGGAGTATGGG + Intronic
1190438262 X:50449270-50449292 GGGAAAAACAGGAGGAGTGAGGG - Intronic
1192362314 X:70447579-70447601 GGGAAGCACAGCAGGACATGTGG + Intronic
1193998098 X:88391526-88391548 GGGAACAACAGGGGGTCCTTTGG - Intergenic
1194511526 X:94801943-94801965 GGAAAGAAGAACAGGACTTTTGG - Intergenic
1194796163 X:98213837-98213859 AGAAATAACAGGAGGAATTTTGG + Intergenic
1195761896 X:108255392-108255414 GGGAAGGTCAGGATGACCTTGGG + Intronic
1196569274 X:117246857-117246879 GGGAATAAAAGGACAACTTTAGG - Intergenic
1197890533 X:131265684-131265706 GGGAATAACCTGAGGACTTTAGG + Intergenic
1198935543 X:141899722-141899744 GCTCAGAACAAGAGGACTTTAGG - Intergenic
1198937640 X:141915638-141915660 GGGATGCACAGGAGAATTTTAGG + Intergenic
1198959455 X:142168968-142168990 GCTTAGAACAGGAGGACTTTAGG + Intergenic
1198960430 X:142176311-142176333 GGGATGCACAGGAGAATTTTAGG - Intergenic
1198963666 X:142206370-142206392 GGGATGCACAGGAGAAGTTTAGG - Intergenic
1199550552 X:149056920-149056942 GGGAAGACAAGGAGGAGCTTGGG - Intergenic
1199617775 X:149671492-149671514 GGGAAGACGAGGAGGAGCTTGGG + Intergenic
1199624867 X:149731757-149731779 GGGAAGACGAGGAGGAGCTTGGG - Intergenic
1199831509 X:151553094-151553116 GCAAAGAACAGGAAGAGTTTGGG - Intergenic
1200016070 X:153164695-153164717 GGGAAGACAAGGAGGAGCTTGGG + Intergenic
1201438810 Y:13986304-13986326 GGGAAGACGAGGAGGAGCTTGGG + Intronic
1201445763 Y:14056404-14056426 GGGAAGACGAGGAGGAGCTTGGG - Intronic